Use of a dkk1 inhibitor in the manufacture of a medicament for treating dry age-related macular degeneration

By developing DKK1 inhibitors, especially siRNA and shRNA, and downregulating DKK1 expression, the problem of cell damage caused by DKK1 overexpression in dry AMD has been solved, retinal pigment epithelial cells have been protected, and a treatment option for dry AMD has been provided.

CN120158507BActive Publication Date: 2026-05-19ZHONGSHAN OPHTHALMIC CENT SUN YAT SEN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510313317.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-17
Publication Date
2026-05-19
Estimated Expiration
2045-03-17

AI Technical Summary

Technical Problem

Currently, there is no effective treatment for dry age-related macular degeneration (AMD). The mechanism of action of DKK1 in dry AMD has not been thoroughly reported. Overexpression of DKK1 can inhibit WNT signaling, leading to cell damage and death.

Method used

Develop DKK1 inhibitors, including small molecule inhibitors and nucleotides such as siRNA or shRNA that target the DKK1 protein, for use in ophthalmic formulations such as eye drops and ointments, to downregulate DKK1 expression and protect retinal pigment epithelial cells.

Benefits of technology

In vitro experiments showed that DKK1 inhibitors can protect the morphology of retinal pigment epithelial cells and reduce mortality. In vivo experiments showed that they alleviated the patchy loss of retinal pigment epithelial cells, providing a new therapeutic target and strategy for dry AMD.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120158507B_ABST
    Figure CN120158507B_ABST
Patent Text Reader

Abstract

The application discloses application of a DKK1 inhibitor in preparation of a medicine for treating dry age-related macular degeneration. The application finds that DKK1 is obviously increased in expression in a sodium iodate (NaIO3)-induced dry AMD cell and animal model. In an in-vitro experiment, siRNA targeting DKK1 can protect the morphology of retinal pigment epithelial cells and reduce the mortality rate, and in an in-vivo experiment, shRNA targeting DKK1 can relieve patchy loss of retinal pigment epithelial cells and protect the retinal pigment epithelial cells. Therefore, the application provides a new treatment target and treatment strategy for dry AMD, and has important clinical application value.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to the application of DKK1 inhibitors in the preparation of drugs for the treatment of dry age-related macular degeneration. Background Technology

[0002] Age-related macular degeneration (AMD) is a serious eye disease characterized by progressive degeneration of the macula of the retina and is one of the leading causes of vision loss in the elderly. With the increasing aging of the global population, the incidence and related socioeconomic burden of AMD are rising significantly. In my country, there were approximately 30 million AMD patients in 2020, and this number is projected to exceed 50 million by 2040, making it one of the leading causes of blindness in China. Globally, there were approximately 196 million AMD patients in 2020, and this number is projected to rise to 300 million by 2040. The prevention and treatment of AMD has become a major challenge for global public health and is also a key task for my country to achieve its "Healthy China 2030" goals and improve the overall health of its population.

[0003] AMD is classified into two types: dry and wet. Approximately 90% of patients have dry AMD, characterized by dysfunction and progressive damage to retinal pigment epithelial (RPE) cells. RPE cells are crucial for maintaining retinal function and structural integrity; their damage and degeneration lead to retinal atrophy and ultimately irreversible vision loss. While there has been some progress in anti-vascular endothelial growth factor (VEGF) therapy for wet AMD, there is currently no effective treatment for the predominantly dry AMD.

[0004] The pathological mechanisms of dry AMD are complex, involving multiple factors such as oxidative stress, inflammatory response, and metabolic abnormalities. Studies have shown that activation of the WNT signaling pathway can alleviate oxidative stress levels and maintain cell survival, playing a protective role, while its inhibition accelerates cell damage and death. DKK1 (Dickkopf-related protein 1) is an important inhibitor of the classical WNT signaling pathway. As a member of the Dickkopf family, DKK1 blocks β-catenin-dependent classical WNT signaling by binding to the LRP6 co-receptor. Studies have shown that oxidative stress and inflammatory responses induce DKK1 expression, and overexpression of DKK1 significantly inhibits WNT signaling, leading to increased cellular sensitivity to oxidative stress, resulting in cell damage and death. This mechanism may play an important role in the pathology of dry AMD. Although research on DKK1 has made some progress in areas such as cancer and bone diseases, its mechanism of action in retinal degenerative diseases, especially dry AMD, has not been thoroughly reported. Currently, no ophthalmic drugs targeting DKK1 have entered the clinical research stage. Summary of the Invention

[0005] The purpose of this invention is to provide the use of DKK1 inhibitors in the preparation of drugs for the treatment of dry age-related macular degeneration.

[0006] Therefore, the first objective of this invention is to provide the use of DKK1 as a target in a medicament for protecting retinal pigment epithelial cells.

[0007] Preferably, the drug is, but is not limited to, a drug for the prevention and / or treatment of dry age-related macular degeneration.

[0008] Preferably, the drug is a drug that downregulates DKK1 expression.

[0009] A second objective of this invention is to provide the use of drugs that regulate DKK1 expression in the preparation of drugs that protect retinal pigment epithelial cells.

[0010] Preferably, the drug is used in drugs for the prevention and / or treatment of dry age-related macular degeneration, including but not limited to those for the prevention and / or treatment of dry age-related macular degeneration.

[0011] Preferably, the drug is a DKK1 inhibitor.

[0012] Preferably, the drug comprises a pharmaceutically acceptable carrier and an effective amount of an active ingredient, wherein the active ingredient is an inhibitor of DKK1.

[0013] Preferably, the DKK1 inhibitor includes small molecule inhibitors that target the DKK1 protein and nucleotides that inhibit the expression of the DKK1 protein.

[0014] Preferably, the nucleotides that inhibit DKK1 protein expression include siRNA or shRNA.

[0015] Preferably, the siRNA is AUUGAGAACCGAGUUCAAGGU.

[0016] Preferably, the shRNA is CACCGCCAGCGGTGTGAAAGGAATACGAATATTCCTTTCA CACCGCTGGC (SEQ ID NO.1).

[0017] The present invention also provides a medicine for protecting retinal pigment epithelial cells, such as a medicine for treating dry age-related macular degeneration, the medicine comprising an inhibitor of DKK1 as an active ingredient.

[0018] Preferably, the formulation of the drug is an ophthalmic preparation. Preferably, the ophthalmic preparation includes, but is not limited to, eye drops, eye ointments, eye sprays, ophthalmic gels, eye patches, intraocular injections, ophthalmic microspheres, ophthalmic implants, periocular injections, and ophthalmic sustained-release preparations.

[0019] This invention reveals that DKK1 expression is significantly elevated in sodium iodate (NaIO3)-induced dry AMD cells and animal models. In vitro experiments using DKK1-targeting siRNA can protect the morphology of retinal pigment epithelial cells and reduce mortality. In in vivo experiments, using DKK1-targeting shRNA can alleviate patchy loss of retinal pigment epithelial cells and protect them. Therefore, this invention provides a novel therapeutic target and strategy for dry AMD, possessing significant clinical application value. Attached image description:

[0020] Figure 1 To detect DKK1 expression after establishing a stem AMD model in cells and mice using NaIO3, the following data were analyzed: A shows the results of differential gene expression analysis using RNA sequencing before and after NaIO3 (10 mM) treatment of HRPE cells, showing a significant upregulation of DKK1; B shows the results of qPCR validation of RNA sequencing (n=4); C shows the DKK1 protein content secreted into the culture medium by HRPE cells before and after NaIO3 (10 mM) treatment, as detected by Western blot; D shows the expression level of DKK1 in the choroid-RPE complex before and after NaIO3 (35 mg / kg) treatment, as detected by Western blot.

[0021] Figure 2To assess the survival of HRPE cells after DKK1 knockdown under NaIO3 stimulation, the following data were collected: A) qPCR verification of DKK1 knockdown efficiency in HRPE cells (n=4); B) morphological structure of HRPE cells in each group after 24 hours of NaIO3 (10mM) treatment; C) cell counting assay to detect the relative survival rate of HRPE cells with DKK1 knockdown after 24 hours of NaIO3 (10mM) stimulation (n=4); D) Hoechst 33342 / PI staining to detect the cell death patterns of HRPE cells in each group after 24 hours of NaIO3 (10mM) stimulation (scale bar = 100µm).

[0022] Figure 3 To detect the retinal morphology of DKK1 knocked down in mouse eyes under NaIO3 stimulation, A shows the knockdown efficiency of DKK1 in mouse RPE cells verified by qPCR (n=4); B shows the morphological structure of RPE cells after DKK1 knockdown in mouse eyes under NaIO3 (35 mg / kg) stimulation (arrows indicate detached RPE cells, scale bar = 50 μm) detected by H&E staining; C shows the expression level of RPE cells after DKK1 knockdown in mouse eyes under NaIO3 (35 mg / kg) stimulation (scale bar = 50 μm). Detailed Implementation

[0023] The following examples are further illustrations of the present invention, but not limitations thereof. Unless otherwise specified, the experimental methods used in the following examples are conventional methods, and the reagents and materials used are commercially available.

[0024] Human primary retinal pigment epithelial cells (HRPE): purchased from Cybio (Shanghai) Biotechnology Co., Ltd.

[0025] Table 1 Information on antibodies and proteins

[0026]

[0027]

[0028] Table 2 siRNA sequence information

[0029] Sequence (5'-3') siCTRL UUCUCCGAACGUGUCACGUTT siDKK1 AUUGAGAACCGAGUUCAAGGU

[0030] Table 3 shRNA sequence information

[0031]

[0032] Table 4. qPCR primer sequence information

[0033] Sequence (5'-3') hu-DKK1-F GGTATTCCAGAAGAACCACCTTG hu-DKK1-R CTTGGACCAGAAGTGTCTAGCAC ms-DKK1-F ATCTGTCTGGCTTGCCGAAAGC ms-DKK1-R GAGGAAAATGGCTGTGGTCAGAG hrm-ACTIN-F GCCAACACAGTGCTGTCTGG hrm-ACTIN-R GGAGCAATGATCTTGATCTTC

[0034] Experimental Example 1: Sodium iodate stimulation was used to construct a dry AMD model, and DKK1 was significantly upregulated in both cell and mouse models. 1. Resuscitation and culture of human primary retinal pigment epithelial cells (HRPE)

[0035] 2) To prepare 10×PBS: 2.7g potassium dihydrogen phosphate (KH₂PO₄) + 14.2g disodium hydrogen phosphate (Na₂HPO₄) + 80g sodium chloride (NaCl) + 2.0g potassium chloride (KCl), add double-distilled water to a final volume of 1L, mix well, sterilize at high temperature, and store at room temperature. When using, dilute with sterile double-distilled water (ddH₂O) to prepare 1×PBS.

[0036] 3) Preheat 5 mL of primary epithelial cell culture medium (iCell, PriMed-iCell-001) or PBS in centrifuge tubes;

[0037] 4) Remove the human primary retinal pigment epithelial cell cryopreservation tube from the liquid nitrogen tank and place it in a 37°C constant temperature water bath for rapid thawing;

[0038] 5) Transfer the suspension to a centrifuge tube, centrifuge at 1000 rpm for 3 minutes, and aspirate the supernatant;

[0039] 6) Resuspend the cells in primary epithelial cell culture medium and transfer them to clean culture dishes, then incubate in a CO2 incubator. Once the cells have adhered, change the medium every two days.

[0040] 7) Under a microscope, when the cell clones grow to a density of 80%-90%, they can be passaged. After 2-3 passages, the cells can be used for experiments.

[0041] 2. Passaging of human primary retinal pigment epithelial cells (HRPE)

[0042] 1) Wash the cells twice with 1×PBS;

[0043] 2) Add 0.25% trypsin to digest the cells, incubate at 37°C for about 2 minutes, then gently shake the culture dish. Under a microscope, the cell clones are seen to be loose.

[0044] 3) Add culture medium to terminate digestion, at 0.5 x 10⁻⁶. 4 ~1.0x 10 4 cells / cm 2 After spreading the cells into a new culture dish and shaking the cell suspension well, place the culture dish back into a 37°C CO2 incubator for further culture.

[0045] 3. Sodium iodate-induced stem AMD models in cells and mice

[0046] 1) In cell experiments, 400 mM sodium iodate was diluted in HRPE medium to a working concentration of 10 mM. After treatment for 12 h, the cell pellet was collected for subsequent RNA sequencing, or after treatment for 24 h, the cell pellet and medium were collected for protein detection. This is the conditioned medium for sodium iodate treatment used in the following experiments.

[0047] 2) Adult C57BL / 6 mice were randomly divided into a normal control group and an experimental group. The experimental group was injected intraperitoneally with sodium iodate 35 mg / kg, while the normal control group was injected with the same dose of PBS. Eyeballs of the mice were collected 12 h or 72 h after intraperitoneal injection for subsequent experiments.

[0048] 4. RNA sequencing analysis

[0049] Collect HRPE cell lines before and after sodium iodate treatment, with no fewer than 10 cells collected from each sample. 6 The cells were pelleted, and 1 mL of Trizol lysis buffer was added. Three replicate samples were prepared for each group. The collected Trizol samples were sent to Pasenol for RNA sequencing analysis. The sequencing data were then used for bioinformatics analysis, including differential gene expression analysis.

[0050] 5. Cell RNA extraction, reverse cDNA and qRT-PCR verification of sequencing results.

[0051] 1) Take cells that have grown to 80% density, discard the culture medium, wash once with PBS, add 600 μL of Trizol to lyse the cells, and transfer to a 1.5 mL centrifuge tube;

[0052] 2) Add 120 μL of chloroform, shake vigorously for 20 seconds, let stand for 3 minutes, and then centrifuge at 4°C for 10 minutes at 12000 rpm.

[0053] 3) Transfer the supernatant to a new centrifuge tube, being careful not to transfer it to the middle layer; add isopropanol to the supernatant in a 1:1 ratio, mix well, let stand at -20℃ for 20 minutes, then centrifuge at 4℃ for 10 minutes at 12000 rpm.

[0054] 4) Discard the supernatant and add 500 μL of pre-cooled 75% ethanol;

[0055] 5) Centrifuge at 4℃ for 5 min, discard the supernatant, add 500 μL of 95% pre-cooled ethanol, centrifuge at 4℃ for 5 min, discard the supernatant, invert the centrifuge tube onto clean absorbent paper, wait for the white precipitate at the bottom of the tube to turn transparent, add 20 μL of DEPC H2O, and store at -20℃.

[0056] 6) The total RNA obtained was used to synthesize cDNA using the FastKing RT kit with DNase (TIANGEN).

[0057] 7) Using the synthesized cDNA as a template, the gene expression level was detected on an ABI Quant Studio 6 Flex device (Life Technologies) PCR instrument, referring to the SYBR Green (ROCHE) kit;

[0058] 8) Using ACTIN as an internal reference gene, the expression of each gene was calculated using the delta-delta Ct method. The primer sequences for each gene were obtained from the Primerbank website, as shown in Table 4.

[0059] 6. Extraction of proteins from HRPE culture medium and mouse choroid-RPE complex proteins

[0060] 1) Collect the conditioned medium treated with sodium iodate, add it to an Amicon Ultra ultrafiltration tube (10K), centrifuge at 4℃ for 30 min, weigh 4000g, collect the supernatant, add 5×SDS loading buffer at a volume ratio of 4:1, incubate in a 100℃ metal bath for 10 min, and then store at -20℃ for subsequent detection.

[0061] 2) Twelve hours after intraperitoneal injection of sodium iodate into mice, the mice were sacrificed and the eyeballs were removed. The extrascleral connective tissue and muscle tissue were removed in ice-cold PBS, and the choroidal tissue was quickly dissected and separated. Protein was extracted using protein lysis buffer and then subjected to further analysis.

[0062] 7. Western blot experiment

[0063] 1) Preparing liquids:

[0064] ①10×Running buffer: Add 144g glycine, 10g SDS powder, and 30.3g Tris powder sequentially, and then add ddH2O to bring the volume to 1 liter. Before use, dilute with ddH2O to prepare a 1×Running buffer.

[0065] ②5×SDS loading buffer: Add 4g of SDS powder, 20mg of bromophenol blue, 3.085g of DTT, 10mL of Tris-HCl (1M pH 6.8), and 20mL of glycerol in sequence, and add ddH2O to make up to 40mL.

[0066] ③ 10× transfer buffer: Add 30.3g Tris powder and 144g glycine sequentially, and then add ddH2O to bring the volume to 1 liter. When using, dilute to 1× transfer buffer, i.e., 100mL 10× transfer buffer + 200mL methanol + 700mL distilled water.

[0067] 2) Preparation of separating gel and stacking gel

[0068] ① Prepare 10% separating gel (10 mL):

[0069] ②Prepare a 5% concentrate (5 mL):

[0070] 3) Protein gel electrophoresis: Remove the electrophoresis tank, assemble the protein gel electrophoresis apparatus, carefully remove the comb, add 1L of 1×SDS running buffer to the electrophoresis tank, and add protein markers and samples to the sample wells in sequence. Plug in the power supply, set the program to: constant voltage 90V, 2 hours, start electrophoresis, and stop electrophoresis when the bromophenol blue is close to the lower edge of the separating gel.

[0071] 4) Transfer: Remove the PVDF membrane and filter paper, and soak the PVDF membrane in methanol for 30 seconds. Disassemble the electrophoresis apparatus, remove the gel, and assemble the transfer clamps (i.e., the "sandwich" structure) in sequence, taking care to remove air bubbles during assembly. Assemble the transfer apparatus, add the transfer buffer, and set the transfer program: constant current 250mA, 2 hours, and begin the transfer.

[0072] 5) Blocking: After the transfer is complete, remove the PVDF membrane and place it in the prepared blocking solution, and block it on a shaker at room temperature for 1 hour;

[0073] 6) Incubation of primary antibody: Wash the membrane several times with 1×TBST until it is clean with milk. Prepare the primary antibody with blocking buffer and place it in the PVDF membrane. Place the incubation box on a shaker in a 4℃ cold storage overnight for incubation.

[0074] 7) Wash the membrane three times with 1×TBST, 10 min each time;

[0075] 8) Prepare the secondary antibody with blocking solution at a ratio of 1:5000, place it in a PVDF membrane, put the incubation box on a shaker, and incubate at room temperature for 1 hour;

[0076] 9) Clean the PVDF membrane using the same steps as above;

[0077] 10) Development and Exposure: In a dark environment, prepare the chemical developing solution and place the PVDF membrane in the solution, face up, and incubate for 1-3 minutes. Place the PVDF membrane in the protein gel exposure system, face up, and add a few drops of luminescent solution (to prevent the membrane from drying out). Expose, take a picture, record, and save the results.

[0078] 8. Experimental Results

[0079] like Figure 1As shown, we performed RNA transcriptome sequencing on HRPE cells after sodium iodate treatment. Differential gene analysis revealed upregulated DKK1 gene expression, which was validated by qPCR. Since DKK1 is a secreted protein, we collected culture media from HRPE cells before and after sodium iodate stimulation, and detected a significant increase in DKK1 protein secretion. Furthermore, in a mouse model, we examined DKK1 expression 12 hours after sodium iodate modeling. Western blot results showed that DKK1 expression was significantly upregulated in the dry AMD model compared to the control group.

[0080] Experimental Example 2: HRPE knockdown of DKK1 can effectively maintain cell morphology, improve cell survival rate under sodium iodate treatment, and inhibit apoptosis and necrosis.

[0081] 1. siRNA transfection

[0082] 1) siRNA dissolution: Centrifuge the siRNA lyophilized powder to allow the siRNA on the wall to reach the bottom of the EP tube. Add 250 μL of RNase-free H2O to 5 nmol of siRNA lyophilized powder per tube to dissolve it, preparing a stock solution with a final concentration of 20 μM. Aliquot the solution into 20 μL / tube and store at -20℃.

[0083] 2) When the cells reach 80% confluence, prepare the siRNA-iMAX mixture by mixing the DKK1-targeting siRNA (siDKK1 in Table 2) or the control siRNA (siCTRL in Table 2) with the transfection reagent RNAiMAX (Thermo Fisher Scientific, catalog number 13778150) according to the ratio in Table 4 below. Mix the iMAX and siRNA and gently stir, avoiding shaking, and let it stand at room temperature for at least 5 minutes. Add the above mixture dropwise to the cell culture dish, gently shake the dish to mix, and knock out the expression of DKK1.

[0084] Table 4

[0085] petri dish siRNA (μL) Opti-MEM(μL) iMAX(μL) 24-hole plate 0.25 50 1.5 12-hole plate 0.5 100 3 6-hole plate 1 200 5 6cm 2 400 10

[0086] 3) Cell samples were collected 48 hours after siRNA transfection and qPCR was performed to verify the knockdown efficiency.

[0087] 2. Cell viability detection and morphological observation

[0088] HRPE cells were seeded at 8000 cells per well in 96-well plates. After adhesion, siDKK1 was transfected for 24 hours (see section 1. siRNA transfection for details). The culture medium was aspirated, and PBS or sodium iodate (10 mM) was added. After 24 hours of treatment, the medium was replaced with 100 μL of CCK8-ECM (ECM:CCK8 volume ratio = 9:1 v / v) and cultured for another 4 hours. The absorbance was measured at 450 nm using a BioTek EL×800 absorbance microplate reader, and the images were taken using an inverted microscope.

[0089] 3. Hoechst 33342 and PI staining experiments

[0090] HRPE cells were seeded at 50,000 cells per well in 24-well plates. After adhesion, siDKK1 was transfected for 24 hours (see section 1. siRNA transfection for details). The culture medium was aspirated, and PBS or sodium iodate (10 mM) was added. After 24 hours of treatment, the cells were washed with HBSS buffer. Hoechst 33342 and Propidium Iodide (PI) were diluted in HBSS buffer according to the manufacturer's instructions to prepare working solutions. 300 μL of the working solution was added to each well of the 24-well plate, and the cells were stained at 37°C for 30 minutes. The stained cells were observed and photographed using an upright microscope.

[0091] 4. Experimental Results

[0092] like Figure 2 As shown, we designed a siRNA targeting DKK1 and knocked it out in human primary retinal pigment epithelial cells (HRPE). Cells were then treated with sodium iodate (10 mM) for 24 hours, and cell morphology was observed. Cell viability was assessed using the CCK8 cell proliferation assay. Changes in the cell nucleus were observed using Hoechst 33342 and PI dyes to analyze cell death pathways. Results showed that sodium iodate treatment significantly increased the incidence of apoptosis (Hoechst 33342) and necrosis (PI), while knocking down DKK1 effectively reduced the incidence of late apoptosis and necrosis in HRPE cells.

[0093] Example 3: Intraocular knockdown of DKK1 in mice can reduce RPE loss and improve RPE survival rate in dry AMD model.

[0094] 1. Plasmid construction

[0095] The shRNA targeting DKK1 was designed using pLKO.1 as a vector via the Sigma website. The designed sequence was synthesized by Tsingke Biotechnology and ligated to the pLKO.1 vector using T4 DNA ligase. All plasmids were transformed with DH5α and extracted using a plasmid extraction kit (TIANGEN, DP117TA).

[0096] 2. Construction of mouse RPE knockdown of DKK1 and dry AMD model

[0097] 1) Inject the PEI complex containing plasmids shDKK1 (shDKK1 in Table 3) or shCTRL (shCTRL in Table 3) into the vitreous cavity of mice. One day later, sacrifice the mice, collect the eyeballs, isolate the choroid-RPE complex, and perform qPCR to verify the knockdown efficiency.

[0098] 2) 24 hours after intravitreal injection of shDKK1 or shCTRL plasmid-PEI complex, mice were injected intraperitoneally with 35 mg / kg sodium iodate or the same dose of PBS. Three days later, the mice were sacrificed and their eyeballs were collected for further analysis.

[0099] 3. Paraffin sections and hematoxylin and eosin staining (H&E staining)

[0100] 1) Eyeball collection and fixation. After euthanizing the mice, the eyeballs were removed, and the surrounding connective and muscle tissues were trimmed away, preserving a small segment of the optic nerve. The eyeballs were then immersed in a fixative solution and fixed at 4°C for 24 hours.

[0101] 2) Dehydration. Immerse the fixed eyeballs in 50%, 60%, 75%, 95%, and 100% ethanol sequentially for 1 hour each, replacing with anhydrous ethanol once.

[0102] 3) Clearing. Transfer the completely dehydrated tissue to xylene for 2 hours to clear it.

[0103] 4) Embedding. The already transparent eyeball is immersed in molten paraffin for 2 hours and then embedded.

[0104] 5) Sectioning. After the embedded blocks cooled, they were sectioned using a paraffin microtome to a thickness of 6 μm.

[0105] 6) Mounting. Spread the slide in water at 45℃. Place a clean glass slide under the slide in the water and slowly move it upwards to allow the slide to adhere to the slide. Then bake the slide at 60℃ until the slide is firmly attached.

[0106] 7) Dewaxing the sections. Immerse the sections in xylene I for 20 min, xylene II for 20 min, and xylene III for 20 min.

[0107] 8) Rehydration. Immerse the slide in anhydrous ethanol I for 5 minutes, anhydrous ethanol II for 5 minutes, 75% ethanol for 5 minutes, and water for 5 minutes.

[0108] 9) Hematoxylin-eosin staining. Immerse the slide in hematoxylin solution for 10 min, then stain with ammonia for 3 s, rinse with running water for 10 min, differentiate with 0.7% hydrochloric acid and ethanol for 5-10 s, rinse with running water for 15 min until the slide turns blue. Then stain with 95% ethanol for 30 s, followed by eosin staining for 30 s.

[0109] 10) Dehydration. The stained sections were placed in 95% ethanol twice for 5 minutes each time, in anhydrous ethanol twice for 5 minutes each time, and in xylene twice for 5 minutes each time.

[0110] 11) Mounting. Mount with neutral resin, air dry in a fume hood, photograph under a microscope upright, or store permanently in a slide box.

[0111] 4. Frozen sections and immunofluorescence staining

[0112] 1) Sample collection. After the mice were euthanized, their eyeballs were removed, and the muscles and connective tissue around the eyeballs were removed under a microscope.

[0113] 2) Fixation. A 30G puncture syringe needle is used to puncture the apex of the cornea. After removing part of the corneal tissue, the eyeball is fixed in 4% paraformaldehyde for 2 hours.

[0114] 3) Dehydration. The fixed eyeballs were transferred to 10%-30% sucrose solutions for 60 minutes at each concentration, dehydrating from low to high concentration.

[0115] 4) Embedding. The eyeball is removed from the sucrose container and transferred to an embedding cassette containing OCT. The optic nerve is then positioned posteriorly using forceps. The embedding cassette is frozen at -20°C and then sectioned, or transferred to -80°C for long-term storage.

[0116] 5) Frozen Sections. Set the microtome chamber temperature to -20℃ and the freezing head to -16℃. Remove the frozen block from the embedding cassette and fix it onto the freezing head. After adjusting the blade position and eyeball orientation, section to a thickness of 10μm. Adhere the sections to a glass slide, mark them, and air dry at room temperature for 30 minutes. Then proceed with subsequent staining or place them in a sectioning cassette and transfer them to a -80℃ freezer for storage.

[0117] 6) Punching. Place the slides in 0.3% Tritium X-100 / PBS punching buffer and punch for 15 min. Wash with PBS 3 times, 10 min each time.

[0118] 7) Blocking. Block with punching buffer containing 5% goat serum at room temperature for 1 hour, wash with PBS, 10 min x 3.

[0119] 8) Primary antibody incubation. Place the slides in a humidified chamber and incubate with primary antibody RPE65 at 4°C overnight.

[0120] 9) Secondary antibody incubation. Incubate the slides at room temperature for 30 min, wash with PBS, 10 min x 3. Incubate with secondary antibody in a humidified chamber at room temperature for 1 h, wash with PBS, 10 min x 3.

[0121] 10) DAPI staining of the nucleus. Stain with 0.5 μg / mL DAPI for 10 min. Wash with PBS for 5 min x 3.

[0122] 11) Mounting. Apply an anti-fluorescence quenching mounting medium to the slide, and carefully mount the slide with tweezers to prevent air bubbles. Finally, fix the coverslip with wax or nail polish.

[0123] 12) Observe and photograph under an upright microscope.

[0124] 5. Experimental Results

[0125] like Figure 3 As shown, we designed and injected DKK1-targeting shRNA into the vitreous cavity of mice. One day later, sodium iodate stimulation was used to establish the model, and eyeballs were harvested three days later. Histopathological observation of the retinal structure and RPE layer was performed using paraffin sections and H&E staining. Simultaneously, frozen sections and immunofluorescence staining were performed on the eyeballs to detect the expression of the RPE functional protein RPE65. The results showed that DKK1 knockdown had no significant effect on RPE morphology, but effectively alleviated sodium iodate-induced retinal structural disorder, RPE loss, and reduced RPE functional protein levels, indicating that DKK1 knockdown is beneficial for protecting the RPE and improving its survival rate in the dry AMD model.

[0126] The above are merely preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be regarded as deviations from the present invention.

[0127] The scope of protection of this invention should be determined by the scope defined in the claims. For those skilled in the art, various improvements and modifications can be made without departing from the spirit and scope of this invention, and these improvements and modifications should also be considered within the scope of protection of this invention.

Claims

1. The application of DKK1 inhibitors in the preparation of drugs for treating dry age-related macular degeneration, wherein the DKK1 inhibitor is a nucleotide that inhibits the expression of DKK1 protein, the nucleotide that inhibits the expression of DKK1 protein is siRNA, and the siRNA is AUUGAGAACCGAGUUCAAGGU.