KASP molecular marker related to grain weight of brassica napus, primer and application

Through genome-wide association analysis and KASP molecular marking technology, the problem of low molecular breeding efficiency of kale rapeseed grain-weight traits was solved, and the rapid and efficient screening of grain-weight traits was achieved, and the breeding efficiency was improved.

CN120158542APending Publication Date: 2025-06-17NORTHWEST A & F UNIV

Patent Information

Application Number
CN202510224380.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-27
Publication Date
2025-06-17

AI Technical Summary

Technical Problem

The prior art is difficult to effectively explore genes and quantitative trait sites related to the particle weight of cabbage rapeseed, resulting in low molecular breeding efficiency of particle weight traits.

Method used

Through genome-wide association analysis (GWAS) to mine SNP sites related to the weight of cabbage-type rapeseed grains, and develop KASP molecular markers and corresponding primers to achieve high-throughput detection and screening.

Benefits of technology

The rapid, efficient and low-cost identification and screening of the weight traits of cabbage-type rapeseed has been achieved, which has improved breeding efficiency and helped increase production and income.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005289708110000071
    Figure BDA0005289708110000071
  • Figure HDA0005289708130000011
    Figure HDA0005289708130000011
  • Figure HDA0005289708130000012
    Figure HDA0005289708130000012
Patent Text Reader

Abstract

The invention discloses a KASP molecular marker related to the grain weight of brassica napus, a primer and application. The nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1, and A / G mutation exists at the 51st basic group. A KASP primer for detecting the molecular marker comprises nucleotide sequences as shown in SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO. 4. The KASP molecular marker developed by the invention can accurately distinguish large-grain varieties and small-grain varieties of the brassica napus, provides a convenient and reliable-result molecular marker for detecting the brassica napus with high thousand grain weight, can realize screening of materials with different grain weights of the brassica napus in the early stage, has good application value, and can be used for detecting the brassica napus with high thousand grain weight. The method can be widely applied to the field of brassica napus breeding and shortens the breeding process.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of molecular genetic breeding, and particularly relates to a KASP molecular marker, a primer and an application related to the seed weight of Brassica napus L. Background Art

[0002] Brassica napus L. is one of the important oil crops in China and even the world. It is not only an important source of plant edible oil in China, but also can be used as high-quality livestock protein feed and bioenergy raw material. However, the self-sufficiency rate of edible vegetable oil in China is less than 40%, and the contradiction between supply and demand is prominent. Therefore, increasing the yield of rapeseed is of great significance for alleviating the shortage of edible vegetable oil and ensuring grain and oil security.

[0003] Thousand-seed weight is one of the three key factors affecting the yield per plant of Brassica napus L. (the number of effective pods per plant, the number of seeds per pod and the thousand-seed weight), and is significantly positively correlated with the yield. Increasing the seed weight can effectively improve the yield per plant, thereby increasing the total yield. However, similar to other yield-related traits, the seed weight is a complex quantitative trait co-regulated by multiple genes and is greatly affected by the environment. Due to the low accuracy and efficiency of phenotype-based selection, mining genes and quantitative trait loci (QTL) related to the seed weight and developing closely linked molecular markers are the premise and key for carrying out molecular breeding of the seed weight trait. Research shows that Raboanatahiry et al. detected 972 QTL related to seed yield and related traits in rapeseed and identified 147 potential candidate genes that may affect multiple traits. Huang Jixiang et al. conducted multi-year and multi-environment yield trait identification on 282 Brassica napus L. varieties or lines, and detected 7 QTL controlling the seed weight trait, providing an important basis for further analyzing the genetic basis of the seed weight.

[0004] In recent years, with the release of high-quality rapeseed genomes and the rapid development of sequencing technologies, resequencing technologies have been able to efficiently obtain high-quality SNP genotype data for different germplasms. Combining these data with phenotypic data to conduct genome-wide association studies (GWAS) can identify key genes or QTLs controlling target trait genetic variations. Single nucleotide polymorphism (SNP) markers have become the main molecular markers in rapeseed genetic research due to their high genetic stability, large quantity, and wide distribution. In recent years, the application of Kompetitive Allele-Specific PCR (KASP) technology has enabled more flexible and efficient screening and utilization of a large number of SNP markers in crop molecular breeding research. Therefore, rapidly identifying genes / QTLs controlling rapeseed seed weight through GWAS and developing KASP markers based on this for assisted breeding will help accelerate the molecular improvement process of rapeseed yield traits. Summary of the Invention

[0005] The object of the present invention is to provide a KASP molecular marker, primer, and application related to rapeseed (Brassica napus L.) seed weight. Using the molecular marker and its primer provided by the present invention, high-throughput detection related to seed weight varieties can be achieved in a short time, saving manpower and material resources.

[0006] To achieve the above object, the technical solutions adopted by the present invention include:

[0007] A KASP molecular marker related to rapeseed (Brassica napus L.) seed weight, the nucleotide sequence of the KASP molecular marker is at the SNP locus at position 28,182,807 on chromosome A09 of rapeseed (Brassica napus L.), and the SNP mutation site is A / G.

[0008] Optionally, the nucleotide sequence of the KASP molecular marker is as shown in SEQ ID NO.1, and there is an A / G mutation at the 51st base.

[0009] A KASP molecular marker primer related to rapeseed (Brassica napus L.) seed weight, a molecular marker for identifying rapeseed (Brassica napus L.) seed weight traits, and the sequences 50 bp upstream and downstream of the base at position 28,182,807 on chromosome A09 of the Darmor V4.1 reference genome of rapeseed (Brassica napus L.) are extracted for primer design;

[0010] The molecular marker for identifying rapeseed (Brassica napus L.) seed weight traits is the KASP molecular marker primer related to rapeseed (Brassica napus L.) seed weight described in the present invention.

[0011] Specifically, the primer includes:

[0012] The upstream primer F1 shown in SEQ ID NO.2, the upstream primer F2 with the nucleotide sequence shown in SEQ ID NO.3, and the downstream primer R with the nucleotide sequence shown in SEQ ID NO.4.

[0013] Application of the KASP molecular marker primer related to the seed weight of Brassica napus in screening high-seed-weight varieties or lines of Brassica napus.

[0014] Optionally, the method for screening high-seed-weight varieties or lines of Brassica napus specifically includes:

[0015] (1) Extract the genomic DNA of the Brassica napus to be tested;

[0016] (2) Using the extracted genomic DNA of Brassica napus as a template, perform fluorescence quantitative PCR amplification on the template with the KASP molecular marker primer related to the seed weight of Brassica napus. After the amplification is completed, read and analyze the fluorescence signal to identify the genotype.

[0017] If the genomic DNA of the Brassica napus plant shows the fluorescence group signal carried by F1, it is judged that the sample carries the large-seed genotype GG; if the genomic DNA of the Brassica napus plant shows the fluorescence group signal carried by F2, it is judged that the sample carries the small-seed genotype AA; if the genomic DNA of the Brassica napus plant carries the fluorescence group signals carried by F1 and F2 at the same time, it is judged that the sample carries the heterozygous genotype AG.

[0018] Optionally, the program of the fluorescence quantitative PCR amplification is as follows: the first step is 95°C for 15 min; the second step is denaturation at 95°C for 20 sec, annealing at 61 - 55°C for 60 sec, with a decrease of 0.6°C for each cycle, for 10 cycles; the third step is denaturation at 95°C for 20 sec, annealing at 55°C for 60 sec, for 30 cycles.

[0019] Optionally, the system of the fluorescence quantitative PCR amplification is as follows: 1.2 μl of a 50 ng / μl DNA template; 2 μl of 2×KASP Master mix;

[0020] 0.28 μl of KASP mixed primer; among them, 0.06 μl of upstream primer F1, 0.06 μl of upstream primer F2, 0.16 μl of downstream primer R, and 0.52 μl of ddH2O.

[0021] A detection kit for molecular markers, characterized in that the detection kit contains the KASP molecular marker primer related to the seed weight of Brassica napus described in the present invention.

[0022] The beneficial effects of the present invention are as follows:

[0023] The present invention provides an SNP locus closely linked to the seed weight gene of Brassica napus, develops it into a KASP marker for verification, and provides corresponding KASP primers. Using this marker, the genotype of the target rapeseed material can be detected, and the favorable allelic variation of its seed weight can be judged accordingly. Using the molecular marker and its primers provided by the present invention, high-throughput detection can be achieved in a short time, saving manpower and material resources, and providing rich marker resources for the genetic diversity analysis, gene mapping and future molecular breeding of Brassica napus. Compared with the traditional phenotypic selection method, this strategy has higher accuracy and is not interfered by measurement tools or human factors, so as to realize the early and rapid screening of large-seed excellent varieties or lines of Brassica napus, and help increase production and income. In addition, combined with the precise breeding method of KASP markers, the breeding efficiency is greatly improved and the breeding process is accelerated. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 are the Manhattan plot and Q-Q plot (Quantile-Quantile plot) of the genome-wide association analysis results of the seed weight trait of Brassica napus in Example 1 of the present invention; wherein Figure 1 A is the Manhattan plot; Figure 1 B is the Q-Q plot;

[0025] Figure 2 is the LD block map construction and GWAS association site analysis of the interval chrA09:28152807-28202807 of Brassica napus obtained by GWAS in Example 1 of the present invention;

[0026] Figure 3 is the KASP marker genotyping map of the related genes at the chrA09:28182807 marker locus in 115 materials;

[0027] Figure 4 is the allelic variation difference map of the genotype identified by the KASP molecular marker of chrA09:28182807 and the seed weight. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0028] To facilitate the understanding of the present invention, the following will describe the present invention more comprehensively and meticulously in conjunction with the accompanying drawings of the specification and preferred embodiments, but the protection scope of the present invention is not limited to the following specific embodiments.

[0029] Unless otherwise defined, all professional terms used hereinafter have the same meaning as commonly understood by those skilled in the art. The professional terms used herein are only for the purpose of describing specific embodiments, and are not intended to limit the protection scope of the present invention. Unless otherwise specifically stated, various raw materials, reagents, instruments and equipment used in the present invention can be obtained through the market or can be prepared by existing methods.

[0030] Through genome-wide association analysis, the present invention mines quantitative trait nucleotides (QTNs) or genomic regions significantly associated with the seed weight of Brassica napus. Then, for the SNP loci tightly linked to genes, relevant KASP markers are designed. The markers are used to amplify the materials to be identified, and the favorable allelic variations of the seed weight of the samples are judged according to their genotypes, so as to quickly and accurately identify the genotypes related to the seed weight in Brassica napus.

[0031] The advantages of the present invention are that by developing KASP markers tightly linked to the QTN of the seed weight of Brassica napus, rapid, efficient, and low-cost identification and screening of this trait are achieved, providing important support for the precision breeding of rapeseed yield traits.

[0032] The implementation method of the present invention has a broad application prospect and can be used for the genetic improvement and variety selection of rapeseed seed weight traits, helping to increase rapeseed yield and optimize quality.

[0033] A molecular marker for identifying the seed weight trait of Brassica napus, the nucleotide sequence of the molecular marker is at the SNP locus at position 28,182,807 on chromosome A09 of Brassica napus, and the variant site of the SNP is A / G. Specifically, for the molecular marker for identifying the seed weight trait of Brassica napus, sequences of 50 bp upstream and downstream of the base at position 28,182,807 on chromosome A09 of the DarmorV4.1 reference genome of rapeseed are extracted for primer design, and the nucleotide sequence is as shown in SEQ ID NO.1: CCTAGAGAGTGTCCGCTGAACCGAAGAAAAGCACGGTTCTTGCCACGAGA[A / G]TTGAGGTGAGCGTGAACTTCAGGTAACATCTGTTCGTAGATTCCTTTCGC. The SNP variant site is A / G, and there is an A / G mutation at the 51st base.

[0034] The KASP molecular marker primers include the upstream primer F1 shown in SEQ ID NO.2, the upstream primer F2 shown in SEQ ID NO.3, and the downstream primer R shown in SEQ ID NO.4.

[0035] The present invention also provides a detection kit for molecular markers, which contains KASP molecular marker primers.

[0036] A method for breeding Brassica napus with different thousand-seed weights by using KASP markers tightly linked to the Brassica napus seed weight gene, the method specifically includes the following steps:

[0037] (1) Extract the genomic DNA of the Brassica napus to be tested

[0038] (2) Using the genomic DNA of the rapeseed (Brassica napus) provided as a template, perform fluorescence quantitative PCR amplification on the template using KASP molecular markers or detection kits. After the amplification is completed, read and analyze the fluorescence signals to identify the genotypes. If the genomic DNA of the rapeseed (Brassica napus) plant shows the fluorescence group signal carried by F1, it is determined that the sample carries the large grain genotype GG; if the genomic DNA of the rapeseed (Brassica napus) plant shows the fluorescence group signal carried by F2, it is determined that the sample carries the small grain genotype AA; if the genomic DNA of the rapeseed (Brassica napus) plant carries the fluorescence group signals carried by F1 and F2 at the same time, it is determined that the sample carries the heterozygous genotype AG.

[0039] (3) Further, the PCR program is as follows: the first step is at 95 °C for 15 min; the second step is denaturation at 95 °C for 20 sec, annealing at 61 - 55 °C for 60 sec, with a decrease of 0.6 °C for each cycle, for 10 cycles; the third step is denaturation at 95 °C for 20 sec, annealing at 55 °C for 60 sec, for 30 cycles.

[0040] (4) Further, the system for fluorescence quantitative PCR amplification is as follows: 1.2 μl of a 50 ng / μl DNA template; 2 μl of 2×KASP Master mix; 0.28 μl of KASP mixed primers (0.06 μl of upstream primer F1, 0.06 μl of upstream primer F2, 0.16 μl of downstream primer R), and 0.52 μl of ddH2O.

[0041] The present invention also provides the application of KASP molecular markers or the detection kits described above in screening high - grain - weight varieties or lines of rapeseed (Brassica napus).

[0042] Example 1 Screening of SNP Loci Related to Rapeseed (Brassica napus) Grain Weight

[0043] Materials: A natural population composed of 200 core germplasms of rapeseed (Brassica napus) is used in the present invention.

[0044] Phenotypic identification: After the seeds are mature, measure their grain weight phenotypes to obtain the phenotypic data of the 1000 - grain weight of 200 rapeseed (Brassica napus) samples.

[0045] Screening of high - quality SNP loci: Perform whole - genome re - sequencing on 200 core germplasms of rapeseed (Brassica napus) on the Illumina HiSeq 4000 platform to construct a rapeseed (Brassica napus) germplasm resource database.

[0046] GWAS analysis: Genome-wide association analysis was performed on genomic data and phenotypic data using six ML-GWAS methods, including mrMLM, FASTmrMLM, FASTmrEMMA, pLARmEB, pKWmEB, and ISIS EM-BLASSO, and SNP loci related to the target trait were finally obtained. All six MLGWAS methods were implemented in the R package "mrMLM" (https: / / cran.r-project.org / web / packages / mrMLM / index.html). All parameters were set to default values, and the logarithm of odds threshold (LOD ≥ 3 or P ≤ 0.0002) was selected to examine the association between markers and grain weight-related traits. Principal component analysis and kinship matrix were used in all methods. The Manhattan plot and QQ plot of GWAS were visualized using the R package CMplot (https: / / github.com / yinliLin / R-CMplot) Figure 1 ) Figure 1 A is the Manhattan plot of the genome-wide association analysis of 1000-grain weight of 200 materials, showing significant association signals in the GWAS results; Figure 1 B is the Q-Q plot of 1000-grain weight of 200 materials, which can be used to evaluate the systematic error of the GWAS results.

[0047] Using the GEMMA software, three regions significantly related to 1000-grain weight were identified genome-wide, and one high-quality SNP locus (the 28,182,807th base on chromosome A09 of Brassica napus) was obtained. The SNP was extracted and approximately 50 bp of its flanking sequences before and after were obtained.

[0048] LD-Block plot drawing: The LDBlockShow software was used to perform linkage disequilibrium analysis on the target region and draw the LD-block plot. First, the genotype data were processed using VCFtools to extract SNP information in the region chrA09:28152807:28202807 of the VCF file of 200 Brassica napus materials. Subsequently, combined with the genomic annotation file and the P-value file of the GWAS analysis results, LD calculation and visualization analysis were performed on this region Figure 2 ) Figure 2 Zoom in on the local region of the selected SNP locus to identify candidate SNPs and determine the LD-block and candidate regions.

[0049] Example 2 Development of specific primers for KASP markers

[0050] The SNP sites and their flanking sequences obtained according to Example 1, based on the Brassica napus reference genome Darmor-bzh, were used to design KASP primers using the online website Polymarker (http: / / www.polymarker.info / ). The primers were synthesized by Beijing Tsingke Biotechnology Co., Ltd. The upstream primer F1 (SEQ ID NO.2), upstream primer F2 (SEQ ID NO.3), and downstream primer R (SEQ ID NO.4) were designed for the marker, where F1 and F2 contain FAM and HEX fluorescent linker sequences (underlined) respectively, and the sequences are as follows:

[0051] SEQ ID NO.2 5’- GAAGGTGACCAAGTTCATGCT ACGGTTCTTGCCACGAGAA-3’;

[0052] SEQ ID NO.3 5’- GAAGGTCGGAGTCAACGGATT ACGGTTCTTGCCACGAGAG-3’;

[0053] SEQ ID NO.4 5’-AGATGTTACCTGAAGTTCACGCT-3’。

[0054] Example 3 Verification of the KASP molecular marker in Example 2

[0055] The KASP markers developed according to Example 2 were used to genotype various Brassica napus materials, and statistical analysis was performed in combination with phenotypic data (Table 1). The specific steps are as follows:

[0056] (1) Extract the genomic DNA of the Brassica napus material to be tested using the CTAB method

[0057] (2) Using the DNA extracted in step (1) as a template, perform PCR amplification with the KASP molecular marker developed in Example 2. The PCR amplification was carried out in a PCR instrument (ThermoFisher, VeritiPro TM Thermal Cycler).

[0058] The PCR amplification system was a 4 μl system: 1.2 μl of 50 ng / μl DNA template; 2 μl of 2×KASP Master mix; 0.28 μl of KASP mixed primers (0.06 μl of upstream primer F1, 0.06 μl of upstream primer F2, 0.16 μl of downstream primer R), and 0.52 μl of ddH2O.

[0059] The KASP reaction procedure is as follows: the first step is at 95°C for 15 minutes; the second step is denaturation at 95°C for 20 seconds, annealing at 61 - 55°C for 60 seconds, with a decrease of 0.6°C for each cycle, for 10 cycles; the third step is denaturation at 95°C for 20 seconds, annealing at 55°C for 60 seconds, for 30 cycles.

[0060] After the reaction is completed, the PCR results are scanned and analyzed by a KASP fluorescence analyzer (LGC, Pherastar). The results are as Figure 3 .

[0061] The phenotypic data and genomic data of 115 Brassica napus materials are shown in Table 1, and statistical analysis is performed using SPSS 27.0. A t-test was performed on the phenotypic data, indicating that the phenotypic difference between the high seed weight genotype GG and the low seed weight genotype AA reached an extremely significant level ( Figure 4 ). The phenotype and genotype are highly consistent. Therefore, the size of the thousand-seed weight of Brassica napus materials can be identified by the KASP molecular marker developed in Example 2. Therefore, this molecular marker can be selected for marker-assisted selection breeding. (GG: high seed weight genotype, AA: low seed weight genotype, AG: relatively high seed weight genotype)

[0062] Table 1 Phenotypes and Genotyping of Some Brassica napus Materials

[0063]

[0064] The above are only the preferred embodiments of the present invention and are not used to limit the present invention. Those skilled in the art can make various modifications, equivalent replacements, or improvements within the spirit and principle of the present invention. Any change that conforms to the core idea of the present invention should be covered within the protection scope of the present invention.

Claims

1. A KASP molecular marker associated with Brassica napus seed weight, characterized in that: The nucleotide sequence of the KASP molecular marker is at the SNP site at position 28182807 of the A09 chromosome of Brassica napus, and the variation site of the SNP is A / G.

2. The KASP molecular marker associated with Brassica napus grain weight according to claim 1, characterized in that: The nucleotide sequence of the KASP molecular marker is shown in SEQ ID NO.1, and there is an A / G mutation at the 51st base.

3. A KASP molecular marker primer related to Brassica napus grain weight, characterized in that: Molecular markers for identification of grain weight traits of Brassica napus were used to design primers by extracting 50 bp sequences upstream and downstream of base 28182807 of chromosome A09 of the Darmor V4.1 reference genome of rapeseed. The molecular marker used for identifying the grain weight trait of Brassica napus is the KASP molecular marker primer related to the grain weight of Brassica napus as described in claim 1 or 2.

4. The KASP molecular marker primers related to Brassica napus grain weight according to claim 3, characterized in that: The primers include: The upstream primer F1 is shown in SEQ ID NO.2, the upstream primer F2 has a nucleotide sequence shown in SEQ ID NO.3 and the downstream primer R has a nucleotide sequence shown in SEQ ID NO.

4.

5. Use of the KASP molecular marker primers related to Brassica napus grain weight according to claim 3 or 4 in screening Brassica napus varieties or lines with high grain weight.

6. The use according to claim 5, characterized in that: The method for screening Brassica napus varieties or strains with high grain weight specifically comprises: (1) extracting genomic DNA of Brassica napus to be tested; (2) Using the proposed Brassica napus genomic DNA as a template, the template was amplified by fluorescence quantitative PCR using KASP molecular marker primers related to Brassica napus grain weight. After the amplification, the fluorescence signal was read and analyzed to identify the genotype; If the genomic DNA of the Brassica napus plant shows the fluorescent group signal carried by F1, it is judged that the sample carries the large-grain genotype GG; if the genomic DNA of the Brassica napus plant shows the fluorescent group signal carried by F2, it is judged that the sample carries the small-grain genotype AA; if the genomic DNA of the Brassica napus plant carries the fluorescent group signals carried by both F1 and F2, it is judged that the sample carries the heterozygous genotype AG.

7. The use according to claim 6, characterized in that: The procedure of the fluorescent quantitative PCR amplification is as follows: the first step is 95°C for 15 min; the second step is denaturation at 95°C for 20 sec, annealing at 61-55°C for 60 sec, reducing 0.6°C in each cycle, 10 cycles; the third step is denaturation at 95°C for 20 sec, annealing at 55°C for 60 sec, 30 cycles.

8. The use according to claim 6, characterized in that: The fluorescent quantitative PCR amplification system is: 1.2 μl of 50 ng / μl DNA template; 2 μl of 2×KASP Master mix; KASP mixed primer 0.28 μl; including upstream primer F1 0.06 μl, upstream primer F2 0.06 μl, downstream primer R 0.16 μl, ddH2O 0.52 μl.

9. A molecular marker detection kit, characterized in that: The detection kit comprises the KASP molecular marker primers related to the grain weight of Brassica napus according to claim 3 or 4.

Citation Information

Patent Citations

  • Major QTL (quantitative trait loci) of thousand seed weight trait of Brassica napus L., and SNP molecular markers and application thereof

    CN108754011A

  • Molecular marker SNPA9-5 related to oilseed rape thousand seed weight and application

    CN110157829A

  • SNP (Single Nucleotide Polymorphism) molecular marker closely linked with pod length and grain weight gene BnARF18 of brassica napus and application of SNP molecular marker

    CN117512176A

  • Molecular marker related to thousand seed weight character of brassica napus and application of molecular marker

    CN118813864A

Cited By

  • Specific gene structure variation combination remarkably related to thousand seed weight of brassica napus, primer and application of specific gene structure variation combination

    CN121896394A