SNP (Single Nucleotide Polymorphism) molecular marker closely linked with brassica napus gene as well as development method and application of SNP molecular marker

Abstract

The invention relates to the technical field of rape breeding, in particular to an SNP molecular marker closely linked with a brassica napus gene and a development method and application of the SNP molecular marker closely linked with the brassica napus gene, the SNP molecular marker closely linked with the brassica napus gene is named as Hu1, and the SNP molecular marker closely linked with the brassica napus gene is characterized in that the Hu1 is located at 35.34-39.55 M of a chromosome A03 of a brassica napus genome; the sequence of the fluorescent probe is F-TCTTCAACAACAGCCTTTAG, and the sequence of the fluorescent probe is R-GTAAGAAGTCGCTTCCTGAG. The identification method disclosed by the invention is simple, convenient, efficient and reliable, the use of the Shaanxi A series for measuring the restoring and maintaining relationship of unknown rape strains is omitted, the field test cost is saved, the identification efficiency of the restoring line is improved, and the breeding period is effectively shortened.

Description

Technical Field

[0001] The present invention relates to the technical field of rapeseed breeding, in particular to SNP molecular markers closely linked to genes of Brassica napus and their development methods and applications. Background Art

[0002] Rapeseed is the most important and most developmentally potential oil crop in China, with an annual planting area of about 100 million mu. The total national rapeseed output in 2023 was 16.317 million tons, accounting for 42.23% of the total oil production of domestic oil crops (Statistical Yearbook of the National Bureau of Statistics 2023). Currently, rapeseed oil accounts for more than 55% of the total domestic vegetable oil, while the self-sufficiency rate of edible vegetable oil in China is only about 35%, and the dependence on the international market is too high. Vigorously developing the rapeseed industry is of great strategic significance for maintaining the supply security of national edible oil.

[0003] Brassica napus is one of the three major cultivated types of rapeseed, with advantages such as high oil content, high yield, tolerance to barrenness, stress resistance, stable yield, and great potential for yield increase. It is widely cultivated, and the planting area of rapeseed hybrid varieties accounts for more than 70% of the total rapeseed planting area. The main goal of rapeseed breeding is to cultivate varieties with high seed purity and excellent products. During the rapeseed planting process, in addition to labor, chemical fertilizers, and pesticides, the seed cost is also the main source of expenditure in rapeseed production. To reduce the seed cost of rapeseed production, breeding units and seed production enterprises must try their best to reduce the seed cost during the cultivation and seed production processes. The main way to reduce the seed production cost is to use the three-line matching technology of the relatively simple cytoplasmic-nuclear interaction male sterile line of rapeseed, which can not only improve the purity and yield of hybrid seeds but also reduce the labor cost, thereby reducing the production cost of rapeseed seeds, increasing the rapeseed yield, and ultimately achieving the improvement of quality and efficiency in rapeseed planting. Compared with nuclear male sterility and chemical hybridizing agents, the biggest advantage of using cytoplasmic-nuclear interaction male sterile lines is the low production cost of hybrids and high seed purity.

[0004] The cytoplasmic-nuclear interaction male sterile line Shan 2A (Shan 2A CMS) of Brassica napus has been widely used in the breeding of three-line or two-line rapeseed hybrids. Currently, the first three-line hybrid rapeseed variety Qinyou 2, which has been widely promoted and applied in China, has been bred using the Shan 2A CMS sterile line in China; The female parent of the first double-low and high-quality rapeseed variety Qinyou 7, which has been widely promoted and applied in China, is also derived from Shan 2A through transformation. It can be seen that the high-yield and high-quality rapeseed varieties cultivated from the cytoplasmic-nuclear interaction male sterile line Shan 2A of Brassica napus have made great contributions to the increase in rapeseed yield and the guarantee of edible oil in China.

[0005] The utilization of heterosis in rapeseed CMS requires excellent restorer lines to match it in order to show the strong potential of cytoplasmic CMS. However, the method of selecting restorer lines through conventional breeding technology is inefficient and has a long cycle. It often takes 4 to 6 years to select an excellent restorer line, and the breeding process is slow. With the development of molecular marker technology and the development of second-generation sequencing technology, the development of molecular markers closely linked to key sites of restorer lines or potential restorer genes can greatly improve the selection efficiency of restorer lines, shorten the breeding cycle, and accelerate the breeding process of three-line matching. In addition, molecular markers closely linked to restorer genes can be used to quickly and efficiently identify the purity of F1 hybrids, providing a convenient tool for hybrid quality detection. In short, the use of molecular markers to assist in the selection of excellent restorer germplasm resources is of great significance for the efficient utilization of CMS cytoplasmic male sterile lines, the cultivation of excellent varieties, and the purity identification of hybrids. Summary of the invention

[0006] The technical problem to be solved by the present invention is to provide SNP molecular markers tightly linked to Brassica napus genes and their development method and application. The identification method is simple, efficient and reliable, eliminating the need to use the Shaanxi A series to measure the restoration relationship of unknown rapeseed lines, saving field test costs, improving the identification efficiency of the restoration line, and effectively shortening the breeding cycle.

[0007] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0008] A SNP molecular marker closely linked to a gene of Brassica napus is named Hu1, and Hu1 is located at 35.34M to 39.55M of chromosome A03 of the Brassica napus genome;

[0009] Its sequence is F-TCTTCAACAACAGCCTTTAG, R-GTAAGAAGTCGCTTCCTGAG.

[0010] The method for developing a SNP molecular marker tightly linked to a gene of Brassica napus comprises the following steps:

[0011] S1, sample pretreatment, obtaining F2 generation segregating population, including fertile plant population [fertility genotype is S (RR) or S (Rr)] and sterile plant population [fertility genotype is S (rr)];

[0012] S2, sampling the young leaves of the fertile population and the sterile population obtained in step S1, mixing the samples in equal amounts, adding liquid nitrogen and grinding them using a plant tissue grinder, and extracting DNA from the mixed samples of the fertile plant lines and the sterile plant lines using a Kangwei Plant Total Genomic DNA Extraction Kit to construct a fertile / sterile DNA mixed pool;

[0013] S3. Resequence the fertile / sterile DNA pools in step S2, align and fit them with the reference genome sequence, and determine the significantly associated genomic regions.

[0014] S4. Develop molecular markers based on the base sequences of the significantly associated genomic regions and SNP locus differences in step S3. The specific operation is as follows: Focus on the significantly associated genomic regions obtained in S3, use the Editplus4.0 sequencing data reading software to align the SNP loci of the significantly associated genomic regions corresponding to the fertile population and the sterile population, analyze the SNP locus differences between the sterile line and the restorer line, and develop molecular markers for the base sequences of the significantly associated genomic regions and SNP locus differences.

[0015] S5. Use the known restorer lines of the cytoplasmic-nuclear interaction male sterile line in rapeseed to conduct a consistency test on the molecular markers developed in step S4, and detect the identification power of the developed SNP molecular markers for the corresponding restorer lines of the cytoplasmic male sterile line in rapeseed.

[0016] S6. Determine the accuracy and reliability of the molecular markers developed in step S4.

[0017] Preferably, the specific steps of sample pretreatment in step S1 include:

[0018] S11. Use the cytoplasmic-nuclear interaction male sterile line S(rr) of Brassica napus as the female parent for screening restorer lines, use the excellent materials in the rapeseed germplasm resource bank as the male parent, plant them in the experimental field, and obtain F1 generation seeds of different combinations through artificial hybridization during the flowering period of rapeseed.

[0019] S12. Sow the F1 generation seeds of S11 in the experimental field, identify the fertility of the stamens of the flower organs of different combinations of F1 generation plants during the flowering period, select the combinations with normal stamens of the flower organs of rapeseed for bagging self-crossing, and harvest the F1 generation self-crossing seeds S(RR), S(Rr), and S(rr) with good seed setting, that is, the F2 generation segregation population.

[0020] S13. Sow the F2 generation segregation population obtained in step S12 in the experimental field, also identify the fertility of the stamens of the flower organs of different combinations of the F2 generation segregation population during the flowering period, and divide the plant lines of the same combination into a fertile plant population S(RR), S(Rr), and a sterile plant population S(rr) according to the fertility of the stamens of the flower organs.

[0021] Preferably, the male parent in step S11 is a rapeseed line with unknown restorer-maintainer relationship and genotype.

[0022] Preferably, the specific method for determining the significantly associated genomic regions with the restorer gene in step S3 includes the following steps:

[0023] S31. Mix the DNA pools of the fertile population and the sterile population constructed in S2, conduct quality detection by agarose gel electrophoresis and concentration determination using a Shanghai Jiapeng nanodrop nucleic acid detector. Subsequently, use the second-generation high-throughput sequencing technology to resequence the DNA pools of the rapeseed fertile population and the sterile population respectively to obtain the resequencing data of the fertile population and the sterile population;

[0024] S32. Compare the resequencing data results of the fertile population and the sterile population in S31 with the reference genome sequence of Brassica napus "Darmor-bzh" and annotate the SNP (single nucleotide polymorphism) results; at the same time, based on the sequencing results and the genotype frequency differences between the rapeseed fertile population and the sterile population DNA pools, using the sterile population resequencing data as a reference, use the SNP_index association algorithm to determine the genomic candidate regions significantly associated with the restoration trait;

[0025] S33. Fit the ΔSNP-index of the SNP markers on the same chromosome in S32 to determine the significant association threshold; the region with a ΔSNP-index value higher than the significance threshold is identified as the genomic region significantly associated with the restoration trait.

[0026] Preferably, the determination of the accuracy and reliability of step S6 specifically includes the following steps:

[0027] S61. Hybridize the rapeseed line with unknown restorability-maintainability relationship with the rapeseed cytoplasmic-nuclear interaction male sterile line to obtain the F1 generation of the hybrid combination. Plant the F1 generation in the experimental field, determine the fertility of the stamens of the flower organs of the F1 generation hybrid combination at the flowering stage, and screen out the male parent with normal fertility of the stamens of the flower organs of the F1 generation hybrid combination as the target line for identification;

[0028] S62. Take young leaf samples and extract DNA from the F1 generation hybrid combination with normal fertility of the stamens of the flower organs obtained in step S61, its male parent line, and the female cytoplasmic-nuclear interaction male sterile line respectively, conduct PCR amplification using the developed SNP molecular markers, and jointly identify the accuracy and reliability of the developed restoration markers in combination with the target line determined as the restorer line in the field.

[0029] Application of the primer combination for amplifying the SNP molecular marker Hu1 closely linked to the Brassica napus gene described in any one of the above in the restoration of Brassica napus cytoplasmic-nuclear interaction male sterility.

[0030] Preferably, the Brassica napus is the Shaan A series.

[0031] Preferably, the serial numbers of the SNP molecular marker combination are as follows:

[0032] Forward primer: TCTTCAACAACAGCCTTTAG;

[0033] Reverse primer: GTAAGAAGTCGCTTCCTGAG.

[0034] Preferably, the PCR amplification program is as follows: in the first step, pre-denaturation at 95 °C for 5 min, in the second step, denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, in the third step, extension at 72 °C for 30 s, 35 cycles from the second step to the third step, in the fourth step, extension at 72 °C for 5 min, and preservation at 10 °C for 1 h.

[0035] Advantages of the present invention:

[0036] The specific SNP molecular markers for restorer lines developed for the cytoplasmic-nuclear interaction male sterile line of Brassica napus, series of Shaan A sterile lines, have a simple, efficient and reliable identification method, eliminating the need to determine the restoration and maintenance relationships by crossing unknown Brassica napus lines with the Shaan A series, saving the cost of field trials, improving the identification efficiency of restorer lines, and effectively shortening the breeding cycle.

[0037] The identification of the restoration and maintenance relationships of unknown Brassica napus lines by the specific SNP molecular markers for restorer lines of the present invention is not affected by environmental conditions and can be carried out at any time, greatly improving the screening efficiency and accelerating the process of cultivating excellent varieties.

[0038] The specific SNP molecular markers for restorer lines of the present invention can also be used for the transfer and development of new types of male sterile lines of Shaan A male sterile lines, providing technical support for the screening of maintainer lines of Brassica napus male sterile lines and the transfer of new male sterile lines. Therefore, this marker is applicable to the efficient screening of Shaan A series restorer lines and maintainer lines and the cultivation of three-line hybrid varieties, and can be widely applied to the breeding of Brassica napus varieties on a large scale. Description of the drawings

[0039] Figure 1 Is the significant associated region of the restorer gene of the present invention with the Shaan 2A male sterile line;

[0040] Figure 2 Is the screening of restorer line markers based on the Shaan 2A male sterile line of the present invention;

[0041] Figure 3 Is the standard band of the Shaan 2A male sterile line, F1 hybrid and restorer line of the present invention;

[0042] Figure 4 Is the coincidence rate of the restorer line marker HU1 of the present invention for restorer line materials;

[0043] Figure 5 Is the pure line strain of Brassica napus restorer line germplasm created by microspore culture of the present invention;

[0044] Figure 6 Is the pure line strain of Brassica napus restorer line germplasm created by microspore culture technology of the present invention;

[0045] Figure 7 The pure line strain of the rapeseed restorer line material screened by the molecular marker Hu1 of the present invention;

[0046] Figure 8 The rapeseed restorer line with compact and short stalks (plant height below 1 m) assisted by molecular marker selection of the present invention;

[0047] Figure 9 The rapeseed line with super-large grains and a thousand-grain weight of more than 5 g of the rapeseed restorer line assisted by molecular marker selection of the present invention;

[0048] Figure 10 The high-yield and high-oil-content rapeseed hybrid combination of the present invention. Detailed implementation manners

[0049] For the convenience of understanding by those skilled in the art, the present invention will be further described below in conjunction with examples and drawings. The content mentioned in the implementation manners does not limit the present invention.

[0050] Example 1

[0051] Development of SNP molecular markers

[0052] 1. Using the rapeseed cytoplasmic-nuclear interaction male sterile line [fertility genotype S(rr)] as the female parent for screening the restorer line, and using the excellent materials in the rapeseed germplasm resource bank as the male parent (unknown its restorer-sterility relationship and genotype), plant them in the rapeseed experimental field, and obtain F1 generation seeds of different combinations through artificial hybridization during the rapeseed flowering period.

[0053] 2. Sow the F1 generation seeds in 1 in the experimental field, identify the fertility of the flower organs of different combinations of F1 generation plants (stamen differences) during the flowering period, select the combinations with normal stamens in rapeseed flowers [(the male parent is the restorer line, and the fertility genotype may be N(RR), N(Rr), and N(rr))] for bagging and self-crossing, and harvest the F1 generation self-crossing seeds with good seed setting [S(RR), S(Rr), and S(rr)].

[0054] 3. Sow the F1 generation self-crossing seeds in 2 (the F1 generation self-crossing seeds are self-crossed after sowing to obtain the F2 generation segregation population) in the experimental field, also identify the fertility of the stamens of the flower organs of different combinations of F2 generation segregation populations during the flowering period, and divide the plant lines of the same combination into fertile plant populations (fertility genotypes are S(RR) and S(Rr)) and sterile plant populations (fertility genotype is S(rr)) according to the stamen fertility.

[0055] 4. Samples of young leaves were taken from the fertile and sterile populations in step 3. For the F2 segregating population of each hybrid combination, at least 50 lines of fertile lines (fertility genotypes are S(RR) or S(Rr)) and sterile lines (sterility genotype is S(rr)) were collected. After mixing the samples equally, liquid nitrogen was added and ground using a plant tissue grinder. DNA was extracted from the mixed samples of fertile lines and sterile lines using the Kangwei Plant Genomic DNA Extraction Kit to construct fertile / sterile DNA pools.

[0056] 5. The DNA pools of the fertile population and the sterile population constructed in step 4 were subjected to quality detection by agarose gel electrophoresis and concentration determination using a Shanghai Jiapeng nanodrop nucleic acid detector. Subsequently, the DNA pools of the rapeseed fertile population and the sterile population were re-sequenced using the second-generation high-throughput sequencing technology to obtain the sequencing data of the fertile population and the sterile population.

[0057] 6. The results of the re-sequencing data in step 5 were aligned with the reference genome sequence of Brassica napus "Darmor-bzh" and SNP (single nucleotide polymorphism) results were annotated. At the same time, based on the sequencing results and the genotype frequency differences between the DNA extreme pools of the rapeseed fertile population and the sterile population, with the re-sequencing of the sterile population as a reference, the SNP_index association algorithm was used to determine the candidate genomic regions associated with the target trait.

[0058] 7. The ΔSNP-index of the SNP markers on the same chromosome in step 6 was fitted to determine the significant association threshold. The regions with ΔSNP-index values higher than the significance threshold were identified as the significant association genomic regions with the target trait.

[0059] 8. Focusing on the significant association genomic regions in step 7, the SNP sites in the significant association genomic regions corresponding to the fertile population and the sterile population were aligned using the Editplus4.0 sequencing data reading software, the SNP site differences between the sterile line and the restorer line were analyzed, and molecular markers were developed based on the base sequence and SNP site differences in the significant association genomic regions.

[0060] 9. The SNP molecular markers developed in step 8 were used to identify the consistency with the known restorer lines of the cytoplasmic-nuclear interaction male sterile line of rapeseed to detect the identification power of the developed SNP molecular markers for the restorer line corresponding to the cytoplasmic-nuclear interaction male sterile line of rapeseed.

[0061] Among them, the known restorer lines of the cytoplasmic-nuclear interaction male sterile line of rapeseed are derived from the male parent of the combination with good fertility screened through hybridization and field flowering performance of the cytoplasmic-nuclear interaction male sterile line of rapeseed, and the consistency between its cytoplasmic-nuclear interaction male sterile line and its restorer line is identified using SNP molecular markers.

[0062] 10. The SNP molecular markers developed in 8 are used to conduct hybridization combinations by using cytoplasmic-genetic male sterile lines of rapeseed and other normal-fertility restorer lines of rapeseed whose cytoplasmic-genetic male sterility of rapeseed is unknown. For the combinations with good fertility in the F1 generation during the flowering period, leaf sampling and DNA extraction are carried out. According to the field performance of the corresponding hybridization combinations and the SNP marker amplification results, the accuracy and reliability of the developed markers are jointly determined.

[0063] Among them, rapeseed lines with unknown restorer-maintainer relationships are hybridized with cytoplasmic-genetic male sterile lines of rapeseed to obtain the F1 generation of hybridization combinations. The F1 generation is planted in the field experimental plot. During the flowering period, the fertility of the stamens of the floral organs of the F1 generation hybridization combinations is determined, and the male parent with normal fertility of the stamens of the floral organs of the F1 generation hybridization combinations is screened out as the target line for identification.

[0064] In addition, for the F1 generation hybridization combinations with normal fertility of the stamens of the floral organs, their male parent lines and female cytoplasmic-genetic male sterile lines are respectively subjected to sampling of young leaves, DNA extraction, genome resequencing, determination of significantly associated loci for restoration traits, development of SNP molecular markers, and PCR amplification and gel electrophoresis (agarose gel / polyacrylamide gel) using the developed SNP molecular markers. Combining with the determination of the target line of the restorer line in the field, the accuracy and reliability of the developed restoration markers are jointly identified.

[0065] Example 2

[0066] Take the cytoplasmic-genetic male sterile Brassica napus line for the development of SNP molecular markers, specifically the Shaan 2A sterile line.

[0067] Refer to the operation steps of Example 1:

[0068] 1. Identification of the significantly associated region of the restorer gene on the rapeseed genome:

[0069] By conducting BSA sequencing on the DNA pooled samples of the fertile population and the DNA pooled samples of the sterile population, a fertile gene locus region was obtained in the region of 35.34M - 39.55M on chromosome A03, which is closely related to the restorer gene of the Shaan 2A sterile line ( Figure 1 ).

[0070] 2. Develop a large number of SNP molecular markers according to the sequence of the significantly associated region:

[0071] A large number of molecular markers were screened for the fertile / sterile DNA pools of hybrid combinations prepared with the sterile line Shaan 2A using the developed SNP molecular markers, and molecular markers that can distinguish between the fertile and sterile DNA pools were selected, especially molecular markers that can distinguish the fertile line of rapeseed (with restoration genes). By using the entire PCR amplification procedure, the first step is denaturation at 95 °C for 5 min, the second step is denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s, the third step is extension at 72 °C for 30 s, 35 cycles from the second step to the third step, the fourth step is extension at 72 °C for 5 min, and preservation at 10 °C for 1 h. As Figure 2 , among which there are 100 molecular markers that distinguish between the fertile DNA pool and the sterile DNA pool. However, there is only 1 molecular marker for identifying only the fertile DNA pool, and its SNP marker is named Hu1, and its sequence is F-TCTTCAACAACAGCCTTTAG, R-GTAAGAAGTCGCTTCCTGAG (as shown in Table 1).

[0072] Table 1 Primer sequences of the Hu1 marker

[0073] Hu1 Restorer Line Marker Marker Sequence Forward primer TCTTCAACAACAGCCTTTAG Reverse primer GTAAGAAGTCGCTTCCTGAG

[0074] 3. Using the Hu1 marker, the standard band of the amplified characteristic marker of the corresponding restorer line of the Shaan 2A sterile line was obtained by polyacrylamide gel( Figure 3 ).

[0075] 4. Using the Hu1 marker, the standard band of the amplified characteristic marker of the corresponding restorer line of the Shaan 2A sterile line was obtained by agarose amine gel( Figure 4 ).

[0076] 5. Using the Hu1 marker, the affinity identification was carried out on the male parent materials of 158 fertile combinations (through a large number of crosses with the Shaan 2A series of sterile lines, created, and finally 158 fertile combinations with good performance were screened out. That is, the male parents of these combinations are the restorer lines of the Shaan 2A sterile line, and have been determined as restorer lines through field phenotypic identification). Through this molecular marker identification, the coincidence rate reached more than 90%( Figure 5 ).

[0077] 6. Identification of the coincidence rate of the restorer line of Qinyou 2 using the Hu1 marker:

[0078] A total of 324 plants were selected from the female parent Shan 2A, male parent, and F1 hybrid of Qinyou No. 2 variety, and each plant line was tagged in the field and young leaves were sampled. DNA was extracted from the 324 samples of known sterile lines, restorer lines, and hybrids collected in the laboratory, and the Hu1 SNP marker was amplified. Through gel electrophoresis band identification, 306 plant lines were consistent with the fertility phenotypes in the field. The remaining 18 plants included sterile plants turning fertile, fertile plants turning sterile, and 4 other types. The coincidence rate between the Hu1 molecular marker identification results in the laboratory and the field identification results reached 94.44% (Table 2).

[0079] Table 2 Coincidence rate identification of the male parent and hybrid F1 generation plant lines of Qinyou No. 2 variety using the Hu1 marker

[0080]

[0081] 7. Coincidence rate identification of the restorer lines of Qinyou No. 7 using the Hu1 marker:

[0082] The female parent Shan 3A sterile line of Qinyou No. 7 variety was obtained through multiple generations of backcrossing from the cytoplasmic-nuclear interaction type male sterile line of Shan 2A. Therefore, it has the same sterile type as the Shan 2A sterile line and also has similar restorer genes for cytoplasmic male sterility nuclear-cytoplasmic interaction through the screening of male parent restorer lines. Therefore, the coincidence rate was determined for the female parent Shan 3A sterile line of Qinyou No. 7 variety, its restorer line K407, and the F1 hybrid.

[0083] DNA was extracted from the 460 samples of known sterile lines, restorer lines, and F1 hybrids collected in the laboratory, and the bands of the Hu1 SNP molecular marker were amplified. Through gel electrophoresis band identification, 423 plant lines were consistent with the fertility phenotypes in the field. The remaining 37 plants included 28 sterile plants turning fertile, 7 fertile plants turning sterile, and 2 other types. The coincidence rate between the Hu1 molecular marker identification results in the laboratory and the field identification results reached 91.96% (Table 3).

[0084] Table 3 Coincidence rate identification of the male parent and hybrid F1 generation plant lines of Qinyou No. 7 variety using the Hu1 marker

[0085]

[0086] 8. Coincidence rate identification of the restorer lines of hybrid combinations transferred from the cytoplasmic-nuclear interaction type male sterile line of Shan 2A using the Hu1 marker:

[0087] Our laboratory has also created a new sterile line (named Kang 1A) by using the cytoplasmic male sterile line of Shaan 2. At present, the three-line matching of rapeseed sterile line Kang 1A has been achieved (sterile line, maintainer line Kang 1B, and restorer line Kang 1C). DNA extraction and band amplification of Hu1 SNP molecular markers were carried out on 320 samples of the known sterile line, restorer line, and hybrid of the Kangyou 1 rapeseed line (this variety is still in the experimental stage and has not been registered). Through polyacrylamide gel electrophoresis band identification, 289 strains were consistent with the fertility phenotypes in the field. The remaining 31 strains included 16 sterile plants converted into fertile plants, 10 fertile plants converted into sterile plants, and 5 other types. The coincidence rate between the Hu1 marker identification results in the laboratory and the field identification results reached 90.31% (Table 4)

[0088] Table 4 Coincidence rate identification of the male parent of Kangyou 1 variety and the F1 hybrid lines using Hu1 molecular marker

[0089]

[0090] Example 3

[0091] For the existing restorer line materials of the current Shaan 2A series of rapeseed sterile lines, rapeseed lines with high yield, high oil content, moderate plant height, good lodging resistance, and disease resistance were selected. Through biotechnology such as gene polymerization, quality detection, microspore culture, and chromosome doubling among different materials, more than 500 DH pure line materials were obtained( Figure 6 ).

[0092] Using the developed restorer line marker HU1, the restorer line strains of the DH pure line materials created by microspore culture technology were screened. Through PCR amplification detection of this restorer line marker, it was found that the restorer line strains of the created DH pure line materials could be efficiently detected( Figure 5 ). Therefore, the development of this restorer line molecular marker Hu1 can provide an efficient and reliable rapid screening tool for the molecular marker-assisted breeding of the restorer line materials of the Shaan 2A cytoplasmic male sterile line series in Brassica napus L..

[0093] During the mature period of the DH pure line materials, multiple traits such as lodging resistance, disease resistance, and yield traits were investigated and screened, and many excellent lines with moderate plant height, compact plant type, many siliques, and good lodging resistance were obtained( Figure 7 ).

[0094] The quality traits of the seeds of the obtained restorer line pure line materials were analyzed using a near-infrared detection system and a nuclear magnetic resonance system( Figure 8), rapeseed lines with double-low (erucic acid content < 3%; glucosinolate < 3 μmol / g meal) quality were selected as candidate excellent restorer lines. At the same time, we investigated the seed traits of the obtained restorer line materials and obtained 9 excellent lines with extremely large 1000-seed weight, and their 1000-seed weight exceeded 5 g( Figure 9 ). The acquisition of these excellent lines provides important restorer line germplasms for the next step of selecting rapeseed hybrid combinations of the cytoplasmic-nuclear interaction male sterile line series of Shan 2A.

[0095] Select excellent restorer lines such as high-yield, high-oil, lodging resistance and lodging resistance among the screened restorer lines to conduct multiple hybrid combinations with the cytoplasmic-nuclear interaction male sterile line series of rapeseed Shan 2A, and found that 12 combinations have excellent traits such as early maturity, high yield, high oil content, and lodging resistance( Figure 10 ), indicating that the combining ability of these restorer lines and the cytoplasmic-nuclear interaction male sterile line series of rapeseed Shan 2A is good and suitable for the next step of combination selection. In the next step, the stability of their excellent traits will continue to be investigated to provide excellent lines for the regional trials of this combination and the registration of rapeseed varieties.

[0096] All technical features in this embodiment can be modified in appearance according to actual needs.

[0097] The above embodiments are the preferred implementation schemes of the present invention. In addition, the present invention can also be implemented in other ways. Any obvious replacement without departing from the concept of the technical solution of the present invention is within the protection scope of the present invention.

Claims

1. A SNP molecular marker closely linked to the Brassica napus gene, named Hu1, is characterized by: The Hu1 is located at 35.34M to 39.55M of chromosome A03 of the Brassica napus genome; Its sequence is F-TCTTCAACAACAGCCTTTAG, R-GTAAGAAGTCGCTTCCTGAG.

2. The method for developing a SNP molecular marker tightly linked to a Brassica napus gene according to claim 1, characterized in that: The following steps are involved: S1, sample pretreatment, obtaining F2 generation segregating population, including fertile plant population [fertility genotype is S (RR) or S (Rr)] and sterile plant population [fertility genotype is S (rr)]; S2, sampling the young leaves of the fertile population and the sterile population obtained in step S1, mixing the samples in equal amounts, adding liquid nitrogen and grinding them using a plant tissue grinder, and extracting DNA from the mixed samples of the fertile plant lines and the sterile plant lines using a Kangwei Plant Total Genomic DNA Extraction Kit to construct a fertile / sterile DNA mixed pool; S3, resequencing the fertile / sterile DNA pool in step S2, and aligning and fitting with the reference genome sequence to determine the significantly associated genomic regions; S4, developing molecular markers according to the base sequence and SNP site differences of the significantly associated genomic regions in step S3; the specific operations are: focusing on the significantly associated genomic regions obtained in S3, using Editplus4.0 sequencing data reading software to compare the SNP sites of the significantly associated genomic regions corresponding to the fertile population and the sterile population, analyzing the SNP site differences between the sterile line and the restorer line, and developing molecular markers for the base sequence and SNP site differences of the significantly associated genomic regions; S5, using the known restorer lines of the rapeseed cytoplasmic nuclear interaction male sterility type to perform a consistency test on the molecular markers developed in step S4, to detect the identification strength of the developed SNP molecular markers for the restorer lines corresponding to the rapeseed cytoplasmic male sterility lines; S6, determining the accuracy and reliability of the molecular markers developed in step S4.

3. The method for developing a SNP molecular marker tightly linked to a Brassica napus gene according to claim 2, characterized in that: The specific steps of sample pre-processing in step S1 include: S11, using the Brassica napus cytoplasmic nuclear interaction type sterile male sterile line S(rr) as the female parent for screening the restorer line, and using the materials with excellent performance in the rapeseed germplasm resource bank as the male parent, planted in the experimental field, and obtained F1 seeds of different combinations through artificial hybridization during the flowering period of rapeseed; S12, sowing the F1 generation seeds of S11 in the experimental field, identifying the fertility of the floral organ stamens of the F1 generation plants of different combinations during the flowering period, selecting the combinations with normal floral organ stamens of rapeseed for bagging and self-pollination, and harvesting the F1 generation self-pollination seeds S(RR), S(Rr) and S(rr) with good fruit set, i.e., the F2 generation segregating population; S13, sowing the F2 generation segregation population obtained in step S12 in the experimental field, and identifying the fertility of the floral organ stamens of the F2 generation segregation populations of different combinations during the flowering period, and dividing the strains of the same combination into fertile plant groups S(RR), S(Rr) and sterile plant group S(rr) according to the fertility of the floral organ stamens.

4. The method for developing a SNP molecular marker tightly linked to a Brassica napus gene according to claim 3, characterized in that: The male parent in step S11 is a rapeseed line with unknown restoration relationship and genotype.

5. The SNP molecular marker tightly linked to the Brassica napus gene and the development method and application thereof according to claim 2, characterized in that: The specific method for determining the genomic region significantly associated with the restored gene in step S3 comprises the following steps: S31, the fertile population DNA pool and the sterile population DNA pool constructed in S2 are subjected to agarose gel electrophoresis quality detection and Shanghai Jiapeng nanodrop nucleic acid analyzer concentration determination, and then the rapeseed fertile population DNA pool and sterile population DNA pool are resequenced using the second-generation high-throughput sequencing technology to obtain the fertile population and sterile population resequencing data; S32, the resequencing data results of the fertile population and the sterile population in S31 are compared with the reference genome sequence of Brassica napus "Darmor-bzh" and the SNP (single nucleotide polymorphism) results are annotated; at the same time, based on the sequencing results and the genotype frequency differences between the fertile and sterile population DNA pools of rapeseed, the sterile population resequencing data is used as a reference, and the SNP_index association algorithm is used to determine the candidate genomic regions significantly associated with the restoration trait; S33, fit the ΔSNP-index of the SNP markers on the same chromosome in S32 to determine the significant association threshold; the regions with ΔSNP-index values ​​above the significance threshold are identified as genomic regions significantly associated with the restoring trait.

6. The method for developing a SNP molecular marker tightly linked to a Brassica napus gene according to claim 2, characterized in that: The determination of accuracy and reliability in step S6 specifically includes the following steps: S61, hybridizing a rapeseed line with an unknown restoration relationship with a rapeseed cytoplasmic nuclear interaction male sterile line to obtain a hybrid combination F1 generation, planting the F1 generation in an experimental field, determining the fertility of the flower organ stamens of the F1 generation hybrid combination during the flowering period, and selecting the male parent with normal fertility of the flower organ stamens of the F1 generation hybrid combination as the target line for identification; S62, sampling young leaves of the F1 hybrid combination with normal fertility of floral organ stamens obtained in step S61 and its paternal line and maternal cytoplasmic nuclear interaction male sterile line, DNA extraction, PCR amplification using the developed SNP molecular markers, and jointly identifying the accuracy and reliability of the developed restoration markers in combination with the target line that has been determined as the restoration line in the field.

7. Use of a primer combination for amplifying the SNP molecular marker Hu1 tightly linked to a gene of Brassica napus according to any one of claims 1 to 6 in restoring male sterility by cytoplasmic nuclear interaction in Brassica napus.

8. The use of the SNP molecular marker tightly linked to the Brassica napus gene according to claim 7, characterized in that: The Brassica napus variety is of the Shaanxi A series.

9. The use of the SNP molecular marker tightly linked to the Brassica napus gene according to claim 7, characterized in that: The sequence numbers of the SNP molecular marker combinations are as follows: Forward primer: TCTTCAACAACAGCCTTTAG; Reverse primer: GTAAGAAGTCGCTTCCTGAG.

10. The use of the SNP molecular marker tightly linked to the Brassica napus gene according to claim 7, characterized in that: The PCR amplification program was as follows: the first step was denaturation at 95°C for 5 min, the second step was denaturation at 95°C for 30 s, annealing at 58°C for 30 s, the third step was extension at 72°C for 30 s, 35 cycles from the second step to the third step, the fourth step was extension at 72°C for 5 min, and storage at 10°C for 1 h.

Images