Rice immune negative regulation gene OsPSKR10 and application thereof

Abstract

The invention relates to the technical field of plant genetic engineering and molecular biology, and provides a rice immune negative regulation gene OsPSKR10 and application. According to the OsPSKR10 gene knockout suspension cell line provided by the invention, after chitin is externally applied, immune responses such as active oxygen outbreak and PR defense gene expression in rice cells are activated. The OsPSKR10 gene knockout mutant plant can significantly improve the disease resistance to rice blast, bacterial leaf blight and sheath blight, can be applied to molecular breeding improvement and creation of new broad-spectrum disease-resistant varieties of rice, and has a wide application prospect.

Description

Technical Field

[0001] This application relates to the technical fields of plant genetic engineering and molecular biology, and particularly relates to a rice immune negative regulation gene OsPSKR10 and its application. Background Art

[0002] The yield and quality of rice are severely threatened by various diseases such as bacterial blight, rice blast, and sheath blight. Rice blast can cause a 10 - 35% reduction in rice yield, bacterial blight can cause a 20 - 30% reduction, and sheath blight can cause a 10 - 30% reduction. In severe cases, multiple diseases occur simultaneously, and it may even lead to a complete harvest failure of rice. With climate change and the rapid natural variation of pathogenic bacteria, many disease-resistant and high-quality varieties have gradually lost their resistance, and the trend of disease occurrence has become more serious. Therefore, cultivating highly resistant, broad-spectrum, and durable rice disease-resistant varieties has extremely high demand for agricultural production.

[0003] Phytosulfokine (PSK) is a plant peptide growth factor. PSK is a bisulfated pentapeptide with the structure Tyr(SO3H)-Ile-Tyr(SO3H)-Thr-Gln. The PSK precursor gene family is widely present in higher plants, and there are 7 homologous genes encoding PSK precursor proteins in the rice genome. The PSK precursor gene can encode a secreted precursor protein containing about 80 amino acids, and this precursor protein undergoes post-translational tyrosine sulfation modification by tyrosylprotein sulfotransferase (TPST) in the trans-Golgi apparatus, and then mature and active PSK peptides are generated through proteolytic cleavage in the apoplast. The presence of sulfate groups (SO3H) on the first and third tyrosine residues in the main chain of the mature pentapeptide is a unique feature of PSK, and it plays an important role in the biological activity of PSK. PSK has a promoting effect on multiple aspects of plant growth and development, including promoting the growth of cell cultures or callus, somatic embryogenesis, tracheary element differentiation, pollen germination, and adventitious root formation. In addition, PSK is also considered a damage-associated molecular pattern (DAMP) and plays a significant role in plant immune responses. PSK weakens the resistance of Arabidopsis thaliana to Pseudomonas syringae pv. tomato DC3000 (Pst DC3000) by inhibiting pathogen-associated molecular pattern (PAMP)-triggered immunity (PTI). In contrast, PSK can improve the resistance of plants to diseases caused by necrotrophic fungi, such as Botrytis cinerea of tomato and leaf spot of Arabidopsis thaliana.

[0004] The mature PSK peptide is recognized by the membrane-bound PSK receptor (PSKR) on the cell surface. PSKR belongs to the receptor-like kinase (RLK) family rich in leucine-rich repeats (LRR). PSKR consists of an N-terminal extracellular domain, a helical transmembrane domain, and an intracellular kinase domain. The N-terminal contains 21 LRRs, each composed of 24 amino acids. The 18th LRR is interrupted by an island domain that binds to PSK. PSKR regulates life processes such as plant growth and responses to biotic and abiotic stresses. AtPSKR1 is the main receptor for PSK in Arabidopsis thaliana, which can antagonistically regulate the infection of biotrophic bacteria and necrotrophic fungi on plants by inhibiting the salicylic acid signaling pathway and activating the jasmonic acid signaling pathway. The tomato PSK receptor SlPSKR1 promotes Ca 2+ influx and activates the auxin biosynthesis pathway by interacting with calmodulin, thereby enhancing the resistance of tomatoes to Botrytis cinerea. Recent studies have found that AtPSKR1 balances plant growth and immunity to avoid immune autoactivation caused by the growth-promoting Pseudomonas fluorescens in the plant rhizosphere microbiota. Fifteen homologous PSKR-encoding genes were identified in the rice genome, among which OsPSKR (i.e., OsPSKR12) regulates the process of converting defense signals into growth signals in cells during leaf damage, which is very important for the normal growth and development of rice and the inhibition of unnecessary immune responses.

[0005] However, the role of OsPSKR10 in rice disease resistance is not yet clear, and there is no report on how this protein participates in regulating the plant immune signaling pathway. Therefore, revealing the disease resistance function of rice OsPSKR10 and clarifying its mechanism of action have important scientific value for understanding the innate immune system of rice. Summary of the Invention

[0006] To solve the above problems, the present invention provides a rice immune negative regulatory gene OsPSKR10 and its application.

[0007] The present invention adopts the following technical solutions:

[0008] The present invention provides a rice immune negative regulatory protein OsPSKR10, and the amino acid sequence of the rice immune negative regulatory protein OsPSKR10 is shown as SEQ ID NO.4 (NO. is the serial number, the same below).

[0009] The present invention provides a rice immune negative regulatory gene OsPSKR10 encoding the rice immune negative regulatory protein OsPSKR10, and the cDNA sequence of the rice immune negative regulatory gene OsPSKR10 is shown as SEQ ID NO.2.

[0010] The present invention provides an application of a rice immune negative regulatory protein OsPSKR10 or a rice immune negative regulatory gene OsPSKR10, which is applied to improving the broad-spectrum disease resistance of rice or to cultivating rice varieties with high broad-spectrum disease resistance.

[0011] The present invention provides a knockout vector for a rice immune negative regulatory gene OsPSKR10. A gRNA sequence targeting the rice immune negative regulatory gene OsPSKR10 is ligated to the Bsa I site of the pYLgRNA-OsU6a vector. The pYLgRNA-OsU6a vector ligated with the gRNA sequence is assembled into the pYLCRISPR / Cas9Pubi-H vector by means of Bsa I digestion and Golden Gate cloning ligation method, cutting and ligating while assembling, so as to obtain a knockout vector for the rice immune negative regulatory gene OsPSKR10.

[0012] The present invention provides a method for improving the broad-spectrum disease resistance of rice. The knockout vector is transformed into recipient rice seeds to obtain rice plants with improved broad-spectrum disease resistance.

[0013] The present invention provides a mutant of a rice immune negative regulatory protein OsPSKR10, and the amino acid sequence of the mutant is as shown in SEQ ID NO.7 or SEQ ID NO.8.

[0014] The present invention provides an application of the mutant, which is applied to improving the broad-spectrum disease resistance of rice.

[0015] Optionally, the broad-spectrum disease resistance is to simultaneously resist rice blast caused by Magnaporthe oryzae, bacterial blight caused by Xanthomonas oryzae pv. oryzae, and sheath blight caused by Rhizoctonia solani.

[0016] The above at least one technical solution adopted by the present invention can achieve the following beneficial effects:

[0017] The OsPSKR12 gene knockout suspension cell line provided by the present invention activates immune responses such as the burst of reactive oxygen species and the expression of PR defense genes in rice cells after exogenous application of chitin. The OsPSKR12 gene knockout mutant plants can significantly improve the disease resistance of rice to rice blast, bacterial blight and sheath blight, and can be applied to molecular breeding improvement and the creation of new rice varieties with broad-spectrum disease resistance, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] The drawings described herein are used to provide a further understanding of the present application, and constitute a part of the present application. The illustrative embodiments of the present application and their descriptions are used to explain the present application and do not constitute an improper limitation of the present application. In the drawings:

[0019] Figure 1Electrophoresis result diagram of nucleic acid of gDNA PCR product of T0 generation transgenic positive strain in Example 3;

[0020] Figure 2 Sequence alignment diagram of sequencing results of ospskr10-1 and ospskr10-2 mutants in Example 3;

[0021] Figure 3 Schematic diagram of the disease incidence of OsPSKR10 gene knockout mutants and wild-type rice after spraying Magnaporthe oryzae in Example 4, where Figure (A) is a schematic diagram of the appearance of diseased rice leaves, Figure (B) is the statistical result of the number of lesions on rice leaves, and Figure (C) is the statistical result of the relative fungal biomass at the diseased part of rice leaves;

[0022] Figure 4 Schematic diagram of the disease incidence of OsPSKR10 gene knockout mutants and wild-type rice after punching and inoculating Magnaporthe oryzae in Example 5, where Figure (A) is a schematic diagram of the appearance of diseased rice leaves, Figure (B) is the statistical result of the lesion area on rice leaves, and Figure (C) is the statistical result of the relative fungal biomass at the diseased part of rice leaves;

[0023] Figure 5 Schematic diagram of the disease incidence of OsPSKR10 gene knockout mutants and wild-type rice after inoculating Xanthomonas oryzae pv. oryzae in Example 6, where Figure (A) is a schematic diagram of the appearance of diseased rice leaves, and Figure (B) is the statistical result of the relative lesion area on rice leaves;

[0024] Figure 6 Schematic diagram of the disease incidence of OsPSKR10 gene knockout mutants and wild-type rice after inoculating Rhizoctonia solani in Example 7, where Figure (A) is a schematic diagram of the appearance of diseased rice leaves, Figure (B) is the statistical result of the relative fungal biomass at the diseased part of rice leaves, and Figure (C) is a schematic diagram of the appearance of diseased rice leaf sheaths.

[0025] Figure 7 Schematic diagram of the analysis result of the expression level of defense-related genes in Example 9, where Figure (A) is the relative gene expression level of OsPAL1, Figure (B) is the relative gene expression level of OsPBZ1, Figure (C) is the relative gene expression level of OsChitinase1, and Figure (D) is the relative gene expression level of OsChitinase3.

[0026] Figure 8 Schematic diagram of the detection result of reactive oxygen species burst in Example 10, where Figure (A) is the statistical result of the dynamic content of reactive oxygen species in OsPSKR10 gene knockout mutants and wild-type rice, and Figure (B) is the statistical result of the total amount of reactive oxygen species in OsPSKR10 gene knockout mutants and wild-type rice at 61 minutes. Detailed implementation method

[0027] Exemplary embodiments of the present application will be described in more detail below. However, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments set forth herein. On the contrary, these embodiments are provided so that the present application can be more thoroughly understood and the scope of the present application can be fully conveyed to those skilled in the art.

[0028] The disclosure of the present invention provides many different embodiments or examples for implementing different structures of the present invention. To simplify the disclosure of the present invention, components and settings of specific examples are described in the present invention. Of course, they are merely examples and are not intended to limit the present invention. In addition, the present invention may repeat reference numerals and / or reference letters in different examples. This repetition is for the purpose of simplification and clarity and does not in itself indicate the relationship between the various embodiments and / or settings discussed. In addition, the present invention provides examples of various specific processes and materials, but those of ordinary skill in the art may be aware of the application of other processes and / or the use of other materials.

[0029] Generally, terms can be understood at least in part based on the usage of the present invention. For example, the term "one or more" used in the present invention can be understood at least in part based on the present invention and can be used to describe any component, structure or feature in the singular form, or can be used to describe a combination of components, structures or features in the plural form. Similarly, terms such as "a", "an" or "the" can also be understood at least in part based on the present invention to convey singular usage or convey plural usage. Additionally, the term "based on..." can be understood as not necessarily intended to convey a set of exclusive factors, but rather can alternatively, at least in part depending on the context, allow for the existence of additional factors that do not necessarily have to be explicitly described.

[0030] The present invention constructs a rice OsPSKR10 gene knockout mutant, and after inoculating Magnaporthe oryzae, Xanthomonas oryzae pv. oryzae and Rhizoctonia solani respectively and comparing with the wild type, it is found that the OsPSKR10 gene has a negative regulatory effect on the disease resistance of rice to various diseases and can be effectively applied to the molecular improvement breeding of rice disease resistance.

[0031] Example 1: Bioinformatics analysis of OsPSKR10 protein

[0032] OsPSKR10 protein is a rice protein of the LRR-RLK family and is located on chromosome 2 of rice. Its accession number in the Rice Annotation Project Database (RAP-DB), the Japanese rice annotation project, is Os02g0629400, and its accession number in The MSU Rice Genome Project Database (RGAP7), the US rice genome annotation project, is LOC_Os02g41890.

[0033] The amino acid sequence of OsPSKR10 protein is shown in SEQ ID No.4. The DNA sequence of the OsPSKR10 gene in the rice genome is shown in SEQ ID No.1, its cDNA sequence is shown in SEQ ID No.2, and its CDS sequence is shown in SEQ ID No.3.

[0034] Example 2: Construction of OsPSKR10 gene knockout lines

[0035] 1. Construction of the OsPSKR10 gene knockout vector.

[0036] The OsPSKR10 gene knockout mutant plants were constructed by the CRISPR / Cas9 gene editing technology. First, the targetDesign function of the CRISPR-GE website (http: / / skl.scau.edu.cn) was used to determine the gRNA sequences targeting the OsPSKR10 gene. Among them, gRNA1 is shown in SEQ ID NO.5, and the sequence is: AACTCACCACCACATGGCCA; gRNA2 is shown in SEQ ID NO.6, and the sequence is: CAGTGCACTAGCATCACCA. Subsequently, the primerDesign function of the website was used to design the double-target knockout primers OsPSKR10-OsU6aT1F / R and OsPSKR10-OsU6aT2F / R, and the sequences are shown in Table 1. The gRNA1 and gRNA2 were respectively ligated to the Bsa I site of the intermediate vectors pYLgRNA-OsU6a and pYLgRNA-OsU6b by Overlapping PCR and enzymatic digestion ligation method, and then the pYLgRNA-OsU6a and pYLgRNA-OsU6b vectors ligated with the gRNA1 and gRNA2 sequences respectively were assembled into the pYLCRISPR / Cas9Pubi-H vector by Bsa I enzymatic digestion and "Golden Gate" cloning ligation method, "cutting and ligating while", so as to obtain the OsPSKR10 gene knockout vector.

[0037] Table 1:

[0038] Name Sequence (5’-3’) OsPSKR10-OsU6aT1F gccgAACTCACCACCACATGGCCA OsPSKR10-OsU6aT1R aaacTGGCCATGTGGTGGTGAGTT OsPSKR10-OsU6aT2F gttgCAGTGCACTAGCATCACCA OsPSKR10-OsU6aT2R aaacTGGTGATGCTAGTGCACTG

[0039] 2. Genetic transformation of transgenic rice

[0040] The gene knockout vector pYLCRISPR / Cas9Pubi-H-OsPSKR10-gRNA was transformed into Agrobacterium tumefaciens EHA105, and the callus of rice Nipponbare variety was used as the receptor for Agrobacterium transformation. The T0 generation transgenic plants were obtained through the processes of screening, differentiation, and regeneration.

[0041] Example 3: Screening and identification of OsPSKR10 gene knockout mutants

[0042] The T0 generation rice seedlings with sound roots were planted individually in the greenhouse. After 2 weeks of greenhouse cultivation, the leaves of each individual were taken to extract genomic DNA. Using the genomic DNA as a template, primers OsPSKR10-KO-F / R were designed upstream and downstream of the target site, and the sequences are shown in Table 2.

[0043] Table 2

[0044]

[0045] PCR amplification and agarose gel electrophoresis detection were carried out, and the results are as Figure 1 shown. In Figure 1 , ospskr10-1 to ospskr10-20 respectively represent different transgenic positive lines of the T0 generation.

[0046] The PCR products were subjected to first-generation sequencing analysis, and the sequencing results were aligned with the gDNA sequence of OsPSKR10 using Geneious software. Two homozygous knockout lines, ospskr10-1 and ospskr10-2, were obtained, and the results are as Figure 2 shown.

[0047] The amino acid sequence of the OsPSKR10 protein in the ospskr10-1 mutant line is shown in SEQ ID NO.7, and the sequence is: MVCSLMMQLTTTW*, where * represents the premature termination of the translated protein due to the deletion of nucleotides resulting in a frameshift. The amino acid sequence of the OsPSKR10 protein in the ospskr10-2 mutant line is shown in SEQ ID NO.8, and the sequence is: MVCSLMMQLTTTWTMAFLFLLVFP PAVPLPNQLLESKLL*; where * represents the premature termination of the translated protein due to the deletion of nucleotides resulting in a frameshift.

[0048] The T0 generation of homozygous plants was propagated to obtain the T1 generation of mutant rice. Genomic DNA was extracted from the leaves of the T1 generation of mutant plants, and they were screened and identified by PCR and sequencing techniques. The sequencing results were aligned using Geneious. The results were consistent with Figure 2 , and finally, two mutant lines, ospskr10-1 and ospskr10-2, that could be stably inherited were obtained.

[0049] Example 4. Incidence of Magnaporthe oryzae inoculated by spraying method on wild-type and OsPSKR10 gene knockout mutant rice

[0050] Rice seedlings grown for 18 days (at the three-leaf stage when the third leaf was fully expanded) were used for the spraying inoculation experiment with Magnaporthe oryzae spore suspension. 10 mL of a spore suspension of the Magnaporthe oryzae strain Guy11 with a concentration of 2×10 5 cfu / mL (containing 0.25% gelatin) was used to spray inoculate the leaves of ospskr10-1 mutant, ospskr10-2 mutant, and wild-type Nipponbare rice seedlings, respectively. After inoculation, the rice was placed in an incubator for continued cultivation waiting for the disease to occur. The humidity in the incubator was set above 90% and the temperature was 25°C; it was kept dark for 24 h after inoculation, and then the light and dark were alternated for 12 h each. The growth and disease status of the rice were observed every day after inoculation. Three days after inoculation, small disease spots were visible on the surface of the rice leaves, and the small disease spots gradually expanded. On the 7th day after inoculation, the diseased leaves were cut and used for disease resistance analysis.

[0051] Figure 3 The schematic diagram of the incidence of Magnaporthe oryzae inoculated by spraying on the OsPSKR10 gene knockout mutant and wild-type rice is shown. Figure 3 Figures (A) and (B) in

[0052] show that: compared with the wild type, the number of disease spots on the leaves of ospskr10-1 mutant and ospskr10-2 mutant was significantly reduced. [CT(OsUbq)-CT(MoPot2)] For each type, 10 diseased plants were selected, equal amounts of diseased leaves were cut from each plant, and their total DNA was extracted. qPCR analysis was performed using specific primers for the Magnaporthe oryzae MgPot2 gene and the rice OsUbq gene, and the primers MgPot2-qPCR-F / R and Ubq-qPCR-F / R were detected. The sequences are shown in Table 3. Then, according to formula 2 Figure 3 Figure (C) in

[0053] Table 3:

[0054]

[0055]

[0056] Example 5. Incidence of rice blast fungus inoculated by the punching method in wild-type and OsPSKR10 gene knockout mutant rice

[0057] Take one-and-a-half-month-old ospskr10-1 mutant, ospskr10-2 mutant and wild-type Nipponbare adult rice plants for leaf punching inoculation experiment with rice blast fungus. First, use a punching device to damage the rice leaves, and then use a sterilized punch with a diameter of 3 mm to take mycelial blocks of the rice blast fungus strain Guy11 containing spores, and fix the mycelial blocks on the leaf wounds with transparent tape. Each type was inoculated with at least 60 mycelial blocks in duplicate. After inoculation, the rice was placed in a greenhouse at a temperature of 25 °C, a photoperiod of 12L:12D, and a humidity of 80% to continue growing. The inoculated plants were sprayed with water for moisturizing once in the morning and once in the evening every day, and waited for them to get sick. On the 7th day after inoculation, cut the diseased leaves, carefully tear off the tape and mycelial blocks, take pictures, count the diseased area and detect the biomass of rice blast fungus in the diseased parts.

[0058] Figure 4 The schematic diagram shows the incidence of rice blast fungus inoculated by punching in the OsPSKR10 gene knockout mutant and wild-type rice. Figure 4 Figures (A) and (B) in it show that: compared with the wild type, the lesions on the leaves of ospskr10-1 mutant and ospskr10-2 mutant were significantly reduced. The ImageJ software was used to count the diseased area of all leaves, and the results were consistent with the phenotypes, that is, the diseased area of the wild type was significantly larger than that of the OsPSKR10 gene knockout mutant lines.

[0059] Select 10 diseased leaves of each type, cut equal amounts of leaves from the diseased parts, and extract their total DNA respectively. Use the qPCR detection method in Example 4 to analyze the pathogen biomass in the diseased parts. Figure 4 Figure (C) in it shows that the biomass of rice blast fungus in the leaves of ospskr10-1 mutant and ospskr10-2 mutant was significantly lower than that of the wild type, which once again proved that OsPSKR10 has a negative regulatory effect on the resistance of rice to rice blast.

[0060] Example 6. Incidence of wild-type and OsPSKR10 gene knockout mutant rice inoculated with Xanthomonas oryzae pv. oryzae

[0061] The Xanthomonas oryzae pv. oryzae race PXO99 stored at -80°C was activated and cultured on NB medium at 28°C for 3 days. Then, colonies were picked and inoculated into 20 ml of liquid NB medium, and cultured overnight at 28°C for 16 h. Subsequently, the bacteria were collected by centrifugation at 5000 rpm for 5 min, the cell pellet was resuspended in 5 mL of sterile water, the OD600 value of the bacterial suspension was measured using a spectrophotometer, and the OD600 value was adjusted to OD 1.0 with sterile water. At the booting stage of the ospskr10-1 mutant, ospskr10-2 mutant and wild-type Nipponbare rice, the Xanthomonas oryzae pv. oryzae was inoculated by the leaf-clipping method. After dipping a clean pair of scissors into the bacterial suspension, a 2-3 cm long segment at the tip of the flag leaf of the plant was cut off. Each time the scissors were dipped into the bacterial suspension, 2 flag leaves were cut, and more than 5 flag leaves were cut for each plant. Photos were taken 21 days after inoculation and the average lesion area was counted.

[0062] Figure 5 Schematic diagram of the disease incidence of the OsPSKR10 gene knockout mutant and wild-type rice after inoculation with Xanthomonas oryzae pv. oryzae. Figure 5 Figure (A) in [reference] shows that compared with the wild type, the lesions on the leaves of the ospskr10-1 mutant and ospskr10-2 mutant were significantly reduced.

[0063] Measure the length of the dead leaves (lesion length) and the length of the entire flag leaf, and calculate the relative lesion area [(lesion length / whole leaf length) × 100%]. Figure 5 Figure (B) in [reference] shows that the relative lesion areas of the ospskr10-1 mutant and ospskr10-2 mutant knockout lines were significantly lower than those of the wild type, indicating that OsPSKR10 negatively regulates the resistance of rice to Xanthomonas oryzae pv. oryzae.

[0064] Example 7. Disease incidence of wild-type and OsPSKR10 gene knockout mutant rice after inoculation with Rhizoctonia solani

[0065] 1. Activation of Rhizoctonia solani

[0066] The Rhizoctonia solani strain YN-7 stored in the laboratory was inoculated onto PDA medium and cultured in the dark at 28°C for 2-3 days. Then, a mycelial block was taken and inoculated onto PDA medium again, and cultured in the dark at 28°C for 2-3 days to activate it.

[0067] 2. Inoculation of detached leaves with Rhizoctonia solani

[0068] Take one-and-a-half-month-old ospskr10-1 mutants, ospskr10-2 mutants and wild-type Nipponbare rice plants. Cut 10 leaves of the same state and size from each rice line, lay them flat on the moist filter paper in a tray, and cover the cut ends of the leaves with a moist gauze to keep them moist. Use a sterilized sampler with a diameter of 4 mm to cut out fungal blocks of the same size from the activated Rhizoctonia solani culture medium, and invert and stick them on the central surface of the rice leaves. Cover the tray with plastic wrap to keep it moist. After placing the inoculated leaves in an incubator at 28 °C, a photoperiod of 16L:8D, and a humidity of 90% for 2-3 days, take pictures and analyze the disease incidence of the leaves.

[0069] Figure 6 Schematic diagram of the disease incidence after inoculating Rhizoctonia solani on OsPSKR10 gene knockout mutants and wild-type rice. Figure 6 Figure (A) in [reference] shows that compared with the wild type, the disease incidence on the leaves of ospskr10-1 mutants and ospskr10-2 mutants is significantly lighter.

[0070] Select 5 diseased leaves from each material, cut equal amounts of diseased leaf parts, and extract their total DNA respectively. Then use specific primers of the Rhizoctonia solani RsGAPDH gene and the rice OsUbq gene for qPCR analysis. The detection primers are RsGAPDH-qPCR-F / R, and the sequences are shown in Table 4. Finally, according to formula 2 [CT(OsUbq)-CT(RsGAPDH)] Calculate the relative growth of Rhizoctonia solani in rice leaves.

[0071] Table 4:

[0072]

[0073]

[0074] Figure 6 Figure (B) in [reference] shows that the fungal biomass in the diseased parts of the leaves of ospskr10-1 mutants and ospskr10-2 mutants is significantly lower than that in the leaves of wild-type plants, indicating that OsPSKR10 negatively regulates the resistance of rice to sheath blight.

[0075] 3. Inoculation by the method of embedding living leaf sheaths with Rhizoctonia solani

[0076] Wood chips with a thickness of 0.8 mm and a size of 2 mm × 10 mm were evenly spread in a glass petri dish with a diameter of 9 cm and sterilized under high temperature and high pressure. 6 mL of PDB culture medium was added to the sterilized petri dish to submerge the wood chips. A fungal block with a diameter of 8 mm after activation was picked and placed in the center of the liquid surface of the glass petri dish, and cultured in the dark at 28 °C for 3 days. When the surface of the wood chips was covered with hyphae, it could be used as an inoculum. The ospskr10-1 mutant, ospskr10-2 mutant and wild-type Nipponbare were inoculated with the wood chips inoculated with Rhizoctonia solani by the embedding method before the late tillering stage of rice. The wood chip inoculum was embedded into the inner side of the leaf sheath (the sheath of the third leaf from the top) 1 cm below the leaf axil of the third leaf from the top of the main stem of rice with forceps. At this time, the sheath of the second leaf from the top no longer elongated, and the wood chip inoculum could be fixed here. Three main tillers of each rice plant were inoculated, and 5 seedlings of each material were inoculated. After inoculation, the humidity was maintained above 90% to cause disease. The disease symptoms could be seen 24 h - 48 h after inoculation, and there were hyphae at the diseased site, and the disease situation was analyzed by photographing.

[0077] Figure 6 Figure (C) in [reference] shows that compared with the wild type, the lesions on the leaf sheaths of the ospskr10-1 mutant and ospskr10-2 mutant were smaller, which once again proved the negative regulatory role of OsPSKR10 in the resistance of rice sheath blight.

[0078] Example 8. Cultivation of wild-type and OsPSKR10 gene knockout mutant rice suspension cell lines

[0079] 1. Induction of rice callus

[0080] The seeds of wild-type Nipponbare and the identified ospskr10-1 homozygous mutant and ospskr10-2 homozygous mutant were dehulled and placed in a 50 mL centrifuge tube, washed once with distilled water, and the waste liquid was poured out; 75% ethanol was added for washing for 1 min, and the waste liquid was poured out; 10% sodium hypochlorite solution was added and sterilized at room temperature on a four-dimensional rotary instrument for 1 h. Then the waste liquid was poured out on the ultra-clean bench, and the seeds were washed 5 times with sterile water. Subsequently, the seeds were transferred to a 2N6P induction medium and cultured in the dark at 30 °C for one month.

[0081] 2. Cultivation of rice suspension cell lines

[0082] Callus in good condition was selected and transferred to a 100 mL sterile conical flask, 25 mL of R2S culture medium was added, and it was cultured under light on a shaker at 30 °C and a rotation speed of 110 rpm. Subsequently, the culture medium was changed once a week, and the larger cell clusters were discarded, and attention was paid to maintaining aseptic subculture.

[0083] Example 9. Detection of PR gene expression in wild-type Nipponbare and OsPSKR10 gene knockout rice suspension cell lines treated with Chitin

[0084] Take the subcultured wild-type Nipponbare, the ospskr10-1 gene knockout suspension cell line, and the ospskr10-2 gene knockout suspension cell line, and aspirate the culture medium. Weigh 2 portions of 0.05 g of cells for each cell line at each time point and place them into a 12-well cell culture plate pre-added with 1 mL of R2S culture medium. Then discard the culture medium of one portion of the cells and replace it with 1 mL of culture medium containing 5 μg / mL Chitin as the treatment group; the cells treated with pure culture medium in the other portion serve as the control group. Collect the cells after Chitin treatment for 0 h, 1 h, 3 h, 6 h, and 9 h respectively, and extract the total RNA of the samples. Using qRT-PCR and taking OsUbq as the internal reference gene, quantitatively detect the relative expression levels of the PR genes OsPAL1, OsPBZ1, OsChitinase1, and OsChitinase3 in rice cells. The primer sequences for detecting PR genes, OsPAL1-qPCR-F / R, OsPBZ1-qPCR-F / R, OsChitinase1-qPCR-F / R, and OsChitinase3-qPCR-F / R, are shown in Table 5.

[0085] Table 5:

[0086] Name Sequence (5’-3’) OsPAL1-qPCR-F TGAATAACAGTGGAGTGTGGAG OsPAL1-qPCR-R AACCTGCCACTCGTACCAAG OsPBZ1-qPCR-F GGTGTGGGAAGCACATACAA OsPBZ1-qPCR-R GTCTCCGTCGAGTGTGACTTG OsChitinase1-qPCR-F GCACTGATAACCACTGATCGG OsChitinase1-qPCR-R TGTGGGCATTACTGATGATTG OsChitinase3-qPCR-F GCGATAACCTGGATTGCTACAACC OsChitinase3-qPCR-R GTATTTTATTCGTCTGCTCGG

[0087] Figure 7 It is a schematic diagram of the analysis results of the expression levels of defense-related genes. After treating rice cells with Chitin, the relative expression level of OsPAL1 in wild-type Nipponbare and the OsPSKR10 gene knockout rice suspension cell line reaches a peak at 1 h, and then gradually decreases over time. The relative expression levels of OsPBZ1, OsChitinase1, and OsChitinase3 all reach a peak at 3 h and then start to decrease. The expression levels of PR genes in the ospskr10-1 gene knockout suspension cell line and the ospskr10-2 gene knockout suspension cell line are significantly higher than those in wild-type Nipponbare cells. The above results indicate that OsPSKR10 inhibits the expression of genes related to plant defense responses as an immune negative regulator.

[0088] Example 10: Detect the ROS accumulation in wild-type Nipponbare and the OsPSKR10 gene knockout rice suspension cell line after Chitin treatment

[0089] Take the subcultured wild-type Nipponbare, the ospskr10-1 gene knockout suspension cell line, and the ospskr10-2 gene knockout suspension cell line, and aspirate the culture medium. Use a white 96-well microplate, add 100 μl of R2S culture medium to each well, weigh 6.4 mg of cells and put them into the microplate. For each material, 8 replicates are weighed for both the control group and the treatment group as biological replicates. The weighed cells are placed in the dark at 30 °C for 16 h, and then all the culture medium is aspirated with a multi-channel pipette. Add 100 μl of R2S culture medium containing 0.5 mM L-012, 20 μg / mL horseradish peroxidase, and 5 μg / mL chitin to the cells in the treatment group, while add 100 μl of R2S culture medium containing 0.5 mM L-012 and 20 μg / mL horseradish peroxidase to the cells in the control group. Immediately place them in a BioTek Synergy 2 instrument for ROS measurement. Use the kinetic detection function to measure once every 1 min for 61 consecutive minutes.

[0090] Figure 8 It is the experimental result of the schematic diagram of the reactive oxygen species burst detection result. Compared with the wild-type Nipponbare cells, the ROS accumulation in the ospskr10-1 gene knockout suspension cell line and the ospskr10-2 gene knockout suspension cell line increased significantly, indicating that OsPSKR10 negatively regulates the innate immune response of rice by inhibiting the burst of reactive oxygen species.

[0091] As described above, it is only the specific implementation manner of this application. Under the above teaching of this application, those skilled in the art can make other improvements or deformations on the basis of the above embodiments. Those skilled in the art should understand that the above specific description is only a better explanation of the purpose of this application, and the protection scope of this application should be subject to the protection scope of the claims.

[0092] In addition, those skilled in the art can understand that although some of the embodiments described herein include some features included in other embodiments rather than other features, the combination of the features of different embodiments means that it is within the scope of this application and forms different embodiments. For example, in the following claims, any one of the claimed embodiments can be used in any combination.

Claims

1. A rice immune negative regulatory protein OsPSKR10, characterized in that: The amino acid sequence of the rice immune negative regulatory protein OsPSKR10 is shown in SEQ ID NO.

4.

2. A rice negative immune regulatory gene OsPSKR10 encoding the rice negative immune regulatory protein OsPSKR10 according to claim 1, characterized in that: The cDNA sequence of the rice immune negative regulatory gene OsPSKR10 is shown in SEQ ID NO.

2.

3. A use of the rice negative immune regulatory protein OsPSKR10 according to claim 1 or the rice negative immune regulatory gene OsPSKR10 according to claim 2, characterized in that: It is used to improve the broad-spectrum disease resistance of rice, or to cultivate rice varieties with high broad-spectrum disease resistance.

4. A gene knockout vector of rice immune negative regulatory gene OsPSKR10, characterized in that: The gRNA sequence targeting the rice immune negative regulatory gene OsPSKR10 according to claim 2 is connected to the Bsa I site of the pYLgRNA-OsU6a vector, and the pYLgRNA-OsU6a vector connected with the gRNA sequence is assembled into the pYLCRISPR / Cas9Pubi-H vector by Bsa I restriction digestion and Golden Gate cloning connection method, thereby obtaining a gene knockout vector for the rice immune negative regulatory gene OsPSKR10.

5. A method for improving the broad-spectrum disease resistance of rice, characterized in that: The gene knockout vector according to claim 4 is transformed into a recipient rice variety to obtain a rice plant with improved broad-spectrum disease resistance.

6. A mutant of the rice negative immune regulatory protein OsPSKR10 according to claim 1, characterized in that: The amino acid sequence of the mutant is shown in SEQ ID NO.7 or SEQ ID NO.

8.

7. A use of the mutant according to claim 6, characterized in that: Used to improve the broad-spectrum disease resistance of rice.

8. The use according to claim 3 or claim 7, characterized in that: The broad-spectrum disease resistance is resistance to rice blast caused by rice blast fungus, bacterial leaf blight caused by bacterial leaf blight fungus, and sheath blight caused by sheath blight fungus.

Images