Actinidia kolomikta AkWRKY41 gene and application thereof
By transferring the AkWRKY41 gene into plants, the impact of low-temperature frost damage on the kiwi fruit industry was solved, the cold resistance of the plants was significantly improved, and the growth and fruit quality of the fruit tree were improved.
Patent Information
- Application Number
- CN202510453439.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-11
- Publication Date
- 2025-06-20
AI Technical Summary
Low temperature frost damage and climate abnormalities have seriously limited the development of the kiwi fruit industry and affected the growth of fruit trees, fruit quality and yield.
By translocating the AkWRKY41 gene into plants, the anti-abiotic stress performance of the plants is enhanced, especially under low temperature conditions.
It significantly improves the resistance of plants to low temperatures, enhances cold resistance, and improves the growth and fruit quality of fruit trees.
Smart Images

Figure CN120173078A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of plant genetic engineering, and particularly relates to an AkWRKY41 gene of Actinidia kolomikta and its application. Background Art
[0002] Actinidia kolomikta, also known as dog date and deep mountain Akebia, is a perennial large deciduous vine of the genus Actinidia in the family Actinidiaceae. It has obvious cold tolerance characteristics and often grows in moist mountain mixed forests or miscellaneous wood forests. It is mainly distributed in the northeast, north, southwest and northwest regions of China, and also in Japan and other places. Its leaves are colorful and its flowers are fragrant, making it a highly ornamental garden plant. The fruit is sweet and sour, rich in nutrients, and can be used as a high-quality fruit tree resource; the active ingredients contained in the roots, stems, leaves, fruits, etc. are widely used in traditional medicine and modern drug research and development. The berries are rich in various bioactive substances such as vitamin C, amino acids, inositol and polyphenols, and show significant pharmacological activities in aspects such as antioxidant, anti-tumor and anti-inflammatory. Therefore, Actinidia kolomikta has broad application prospects in the fields of agriculture, horticulture, food and medicine industries.
[0003] WRKY is one of the largest transcription factor families in higher plants, named after having a highly conserved WRKY domain. The N-terminal of the WRKY conserved domain has a conserved sequence WRKYGQK, and the C-terminal contains a zinc finger motif (CX7CX23HXC or CX4-5CX22-23HXH). According to the structure of the zinc finger motif and the number of WRKY domains, WRKY transcription factors can be divided into three groups (I, II and III). Group I contains two WRKY domains and a C2H2-type zinc finger structure, Group II contains a single conserved domain and a C2H2-type zinc finger structure, and Group III contains a single WRKY domain and a C2HC-type zinc finger structure. WRKY transcription factors can activate or inhibit the expression of downstream genes by specifically binding to the W-box motif (TTGACC / T) in the promoter of the target gene.
[0004] Low temperature has a significant impact on the growth, development, yield, quality and geographical distribution of plants. Low temperature stress is one of the forms of abiotic stress, which causes different degrees of damage to plants during growth, leading to the disorder of the normal growth cycle of plants and affecting the physiological and metabolic processes of plants. Summary of the Invention
[0005] The inventors of the present application have many years of research experience in the field of kiwifruit. After years of attention and research, it has been found that low-temperature freeze injury in winter is one of the main environmental factors restricting the development of kiwifruit. Abnormal climate changes have severely restricted the development of the kiwifruit industry. Among them, low-temperature stress has become a key factor affecting the growth of kiwifruit trees, fruit quality and yield. Therefore, solving the impacts brought by low-temperature freeze injury and climate anomalies is the main goal of kiwifruit breeding.
[0006] The present invention provides a polypeptide, which is a polypeptide comprising the amino acid sequence shown in SEQ ID NO:1.
[0007] The present invention provides a polynucleotide molecule, which is a polynucleotide molecule encoding the above-mentioned polypeptide.
[0008] The cDNA sequence of the polynucleotide molecule is as shown in SEQ ID NO:2.
[0009] The present invention provides a recombinant vector, a recombinant bacterium, a recombinant plant cell or a recombinant plant organ containing the polynucleotide molecule.
[0010] The present invention provides a method for enhancing the abiotic stress resistance performance of plants. By transferring the polynucleotide molecule into plants, compared with plants into which the polynucleotide molecule has not been transferred, the abiotic stress resistance performance of the plants into which the polynucleotide molecule has been transferred is enhanced.
[0011] The abiotic stress resistance is cold resistance.
[0012] The plant is a monocotyledonous plant or a dicotyledonous plant.
[0013] The plant is a plant of the genus Actinidia or a plant of the genus Nicotiana.
[0014] The plant is Actinidia kolomikta or Nicotiana tabacum.
[0015] The above-mentioned polypeptide should be understood to include not only the polypeptide with the amino acid sequence shown in SEQ ID NO:1, but also any polypeptide containing partial fragments of SEQ ID NO:1, where the partial fragments can be functional domains or structural domains in SEQ ID NO:1, or other fragments. Among them, the partial fragment can be the amino acids at positions 124-184 in SEQ ID NO:1. The polypeptide of the present invention also includes polypeptides with the same cold resistance function and having a WRKY domain derived from plants within the same species or genus, and also includes polypeptides after adding various tags or various leader peptides to the N-terminus or C-terminus of the polypeptide for purification, etc., and also includes polypeptides with unchanged cold resistance function after one or several amino acid mutations occur at non-functional sites. The non-functional sites can be the amino acids at positions 1-123 or 185-355 in SEQ ID NO:1.
[0016] The polynucleotide molecule of the present invention should be understood to be either genomic DNA, genomic RNA, cDNA or mRNA.
[0017] The polynucleotide molecule of the present invention should also be understood to include a polynucleotide molecule containing various regulatory elements connected.
[0018] The polynucleotide molecule of the present invention should also be understood to include a polynucleotide molecule changed according to codon degeneracy.
[0019] The polynucleotide molecule of the present invention should also be understood to include a polynucleotide molecule having a homologous sequence from within the same species or genus, and this polynucleotide molecule has basically the same cold resistance function. Generally, this polynucleotide molecule still has a WRKY domain.
[0020] The polynucleotide molecule of the present invention should also be understood to include a polynucleotide molecule obtained after one or several or multiple base mutations are made in the non-coding region of the domain, and this polynucleotide molecule still has the same cold resistance function.
[0021] The recombinant vector of the present invention should be understood to include any vector containing any of the above-mentioned polynucleotide molecules, such as plasmids, viruses, phages, etc.
[0022] The recombinant bacterium of the present invention should be understood to include any bacterium containing any of the above-mentioned polynucleotide molecules, such as recombinant Escherichia coli, recombinant Agrobacterium, etc. used in the process of plant transformation.
[0023] The recombinant plant cell of the present invention does not have the function of regenerating into a plant. The recombinant plant organ of the present invention does not have the function of regenerating into a plant.
[0024] Enhancing the abiotic stress resistance of plants can endow plants that originally do not have abiotic stress resistance with such ability, or further improve the abiotic stress resistance of plants that originally have such ability.
[0025] "Transfer in" can be achieved by introducing polynucleotide molecules into plants through existing methods, and the polynucleotide molecules may or may not be integrated into the plant genome in the plants.
[0026] After the polynucleotide molecules are transferred into plants, the above-mentioned polypeptides are expressed in the plants.
[0027] To explore the role of the AkWRKY41 gene in the cold resistance of Actinidia kolomikta, plant overexpression vectors and inhibitory expression vectors were constructed respectively, genetic transformation was carried out on tobacco and Actinidia kolomikta, and relevant physiological and biochemical analyses and cold resistance detections were carried out on transgenic tobacco lines and silenced Actinidia kolomikta lines. The results proved that AkWRKY41 has a positive regulatory effect on the cold resistance of plants. The present invention is of great significance for the breeding of kiwifruit. Brief Description of the Drawings
[0028] Figure 1 It is the prediction of the secondary structure of AkWRKY41. Blue: α-helix; Green: β-turn; Purple: Extended strand; Yellow: Random coil.
[0029] Figure 2 It is the prediction of the tertiary structure of the AkWRKY41 protein.
[0030] Figure 3 It is the growth condition of seedlings.
[0031] Figure 4 It is the measurement results of root length, plant height, fresh weight and dry weight of different tobacco seedlings. Different letters in the figure indicate significant differences (P<0.05).
[0032] Figure 5 It is the performance of different tobaccos after cold treatment.
[0033] Figure 6 It is the performance of different lines before and after cold treatment. Detailed Embodiments
[0034] The following are some specific embodiments of the present invention. The technical means or reagents used, unless otherwise specified, are all well-known conventional methods and reagents in the art.
[0035] The transformation bacteria used in the present invention are the well-known and commonly used Escherichia coli DH5α and Agrobacterium tumefaciens EHA105 in the art.
[0036] The vectors used in the present invention are also commonly used vectors in the art. The pHK-35S vector was purchased from Wuhan Boyuan Biotechnology Co., Ltd. The pTRV1 and pTRV2 vectors were both purchased from Miaoling Biology.
[0037] Example 1 Discovery and Characterization of Genes
[0038] A member of the WRKY family with a significantly up-regulated expression level was screened from the transcriptome database of Actinidia kolomikta under low temperature stress at 4°C. After sequence alignment, it was named AkWRKY41. To further explore the structure and function of AkWRKY41, the following experiments were carried out.
[0039] The physicochemical properties of the AkWRKY41 protein sequence of Actinidia kolomikta were analyzed using the ProtParam online software. The results showed that AkWRKY41 encodes 355 amino acids, with a molecular weight of 39.5 kD, a theoretical isoelectric point of 5.94, and the protein molecular formula is C1 736 H2 661 N 485 O 553 S 11 , and the total number of atoms contained is 5446. AkWRKY41 of Actinidia kolomikta contains a complete conserved domain and is a member of the WRKY gene family. Cell-PLoc 2.0 analysis showed that the subcellular localization is in the nucleus, which is in line with the characteristics of transcription factors acting in the nucleus.
[0040] The signal peptide of the AkWRKY41 protein was predicted using the SignalP-4.1 online tool, and the results showed that it does not have a signal peptide and is a non-secretory protein.
[0041] The transmembrane domain was predicted through the TMHMM 2.0 online website. The analysis results showed that the protein contains 355 amino acids, and all amino acids are located in the extracellular region on the cell surface, and no transmembrane region was detected.
[0042] The phosphorylation sites of AkWRKY41 were predicted using NetPhos-3.1. The results showed that phosphorylation mainly concentrated on serine, threonine, and tyrosine residues. Generally, a threshold higher than 0.5 is considered a positive result. Therefore, it was predicted that the protein has a total of 47 phosphorylation sites, including 30 serine phosphorylation sites, 13 threonine phosphorylation sites, and 4 tyrosine phosphorylation sites. Among them, serine phosphorylation is the main form of phosphorylation of this protein.
[0043] The hydrophilicity and hydrophobicity of the amino acid sequence of Actinidia kolomikta AkWRKY41 were analyzed by ProtScale. As a result, positive values indicate that the corresponding part is hydrophobic, and the higher the value, the more significant the hydrophobicity characteristics; negative values indicate that the region is hydrophilic, and the larger the absolute value of the value, the stronger the hydrophilicity. The prediction results show that it contains regions with both hydrophilic and hydrophobic properties, but the proportion of negative values in this amino acid sequence is relatively large and the scores are relatively high, so it is judged that this protein is a hydrophilic protein.
[0044] The O-glycosylation sites and N-glycosylation sites of the AkWRKY41 protein were predicted by YinOYang-1.2 and NetNGlyc-1.0. As a result, this protein contains 68 O-glycosylation sites and 5 N-glycosylation sites, at the 3rd, 97th, 239th, 274th, and 296th amino acids respectively.
[0045] The secondary structure of Actinidia kolomikta AkWRKY41 was predicted using the SOPMA website, and the results are as Figure 1 shown. This sequence mainly contains three types of structures: alpha helix, random coil, and extended strand. The proportions of the three components are in turn: random coil > alpha helix > extended strand. Among them, there are 270 amino acids in the random coil, accounting for 76.06%. The random coil can flexibly adjust the direction of the peptide chain, thus effectively connecting the two stable structures of alpha helix and beta sheet, which helps to form a complex and diverse protein spatial structure; there are 63 amino acids in the alpha helix, accounting for 17.75%, which helps to enhance the mechanical strength and elasticity of the protein; there are 22 amino acids in the extended strand, accounting for 6.20%.
[0046] The tertiary structure of the AkWRKY41 protein was predicted using SWISS-MODEL, and the results show ( Figure 2 ) that the tertiary structure of the Actinidia kolomikta AkWRKY41 protein is mainly composed of random coils and alpha helices, which is consistent with the secondary structure prediction. AkWRKY41 is similar in structure to SWTLID:A0A2R6RFL2.1.A, with a homology of 97.18% and a GMQE value of 0.59. Its model confidence is relatively high, and the protein prediction result is credible.
[0047] Prediction of interacting proteins of AkWRKY41: The interacting proteins of AkWRKY41 were predicted through STRING. Using Actinidia chinensis as the reference species, it was found that proteins such as WRKY40 transcription factor (CEY00_Acc17926), WRKY transcription factor (CEY00_Acc22141), WRKY transcription factor (CEY00_Acc26893), WRKY40 transcription factor (CEY00_Acc29560), and DOF transcription factor (CEY00_Acc30723) interacted with AkWRKY41.
[0048] Prediction and analysis of cis - acting elements in the promoter of AkWRKY41 from Actinidia kolomikta: Cis - acting element analysis was performed on the 2000 - bp sequence upstream of the start codon ATG of AkWRKY41. A total of 74 cis - acting elements of 18 different types were identified. As a result, it contained 10 CAAT - boxes and 23 TATA - box basal elements, abscisic acid response elements (ABRE), cis - acting elements involved in methyl jasmonate response (CGTCA - motif), light response elements (ACE, ATC - motif, Box 4, GATA - motif, G - Box, GT1 - motif, LAMP - element, TCCC - motif, and TCT - motif); stress response elements included cis - regulatory elements necessary for anaerobic induction (ARE), cis - acting elements involved in cold response (LTR), and MYB binding sites involved in drought induction (MBS), etc., indicating that this gene might be related to stress response.
[0049] Agrobacterium - mediated infection of onion epidermal cells was used. The result showed that the fluorescence signal of the pBI121 - AkWRKY41 - GFP fusion protein was only in the nucleus, while in the control group, fluorescence signals appeared in both the nucleus and the cell membrane, indicating that AkWRKY41 was localized in the nucleus.
[0050] Example 2 Obtaining of AkWRKY41 - transgenic tobacco and analysis of cold resistance
[0051] Using Actinidia kolomikta leaf cDNA as a template, the AkWRKY41 gene was amplified by PCR with primers pHK-35S-AkWRKY41-F and pHK-35S-AkWRKY41-R. The amplified product and the pHK-35S vector were double digested, and the digested products were ligated with T4 ligase. The ligation product was transformed into Escherichia coli competent cells, and resistant colonies were picked for verification by colony PCR. The results showed that the target bands were of correct size, single, clear and bright, and the sequencing results were consistent with the expectations, indicating that the pHK-35S-AkWRKY41 expression vector was successfully constructed. The plasmid was transferred into Agrobacterium tumefaciens EHA105 competent cells by the freeze-thaw method. Resistant single colonies were picked, cultured and verified by colony PCR, and the positive bacterial solution was sequenced after colony PCR identification.
[0052] pHK-35S-AkWRKY41-F: CAGTGGTCTCACAACATGGAAAATTTCTCAGCAGATTGGG (SEQ ID NO: 3)
[0053] pHK-35S-AkWRKY41-R: CAGTGGTCTCATACACTAAAAGAACCGTGAGTTATCAAAGGTAAATG (SEQ ID NO: 4)
[0054] Tobacco transformation was carried out by the leaf disc method. Tobacco leaves were infected with recombinant Agrobacterium tumefaciens containing pHK-35S-AkWRKY41, followed by co-culture, screening, differentiation, rooting culture, and then PCR identification. A total of 6 overexpression lines were detected, and bands of 1068 bp in size were amplified in all of them, while no target bands were amplified in the blank control and wild-type tobacco, indicating that AkWRKY41 had been successfully transferred into tobacco. The 6 transgenic tobacco lines overexpressing AkWRKY41 were named OE1 - OE6 in sequence.
[0055] Semi-quantitative detection was performed on the 6 transgenic lines, with the tobacco internal reference gene NtActin as a control. The results showed that the expression levels of AkWRKY41 in different transgenic lines were different, among which, the expression levels of OE1, OE2 and OE4 were relatively high.
[0056] Seedling growth status: WT, OE1, OE2 and OE4 seedlings were treated at 16 °C for 2 weeks. The test results showed ( Figure 3 and Figure 4) At room temperature, the growth of transgenic tobacco and wild-type tobacco is relatively consistent, and the difference is not significant. After 2 weeks of low-temperature treatment at 16°C, the growth of WT, OE1, OE2, and OE4 is inhibited, and the degree of inhibition of WT is more obvious than that of the OE lines. The plant heights of OE1, OE2, and OE4 are 6.68 times, 6.51 times, and 6.75 times that of WT, respectively, and the root lengths are 4.17 times, 5.14 times, and 5.2 times that of WT, respectively. The fresh weights are 8.5 times, 9.21 times, and 11.5 times that of WT, respectively. This shows that transgenic tobacco seedlings have certain growth advantages under low temperature.
[0057] Plant phenotype: WT, OE1, OE2, and OE4 plants with consistent growth were subjected to low-temperature treatment at 4°C for 24 h. The results showed ( Figure 5 ) that there was no significant difference in the growth of WT and the three overexpression lines at room temperature. After low-temperature treatment, the leaves of each tobacco line showed slight chlorophyll loss and wilting, but the degree of wilting of WT leaves was more obvious than that of the three overexpression lines, indicating that transgenic plants have better cold tolerance.
[0058] Results of stomatal aperture measurement: The results showed that at 25°C, there was no significant difference in the stomatal aperture between WT and the three overexpression lines. After low-temperature treatment at 4°C, the stomata of WT and the three overexpression lines closed to varying degrees. The stomatal aperture of the three overexpression lines was smaller than that of WT. The stomatal opening of WT decreased by 27.1%, while the opening rates of OE1, OE2, and OE4 decreased by 47.9%, 46.5%, and 48.9%, respectively. Compared with WT, the stomatal aperture of the OE lines decreased significantly.
[0059] Determination of soluble sugar content: The results showed that there was no significant difference in the soluble sugar content between WT and transgenic lines at room temperature, and the contents were 12.45 ± 0.55 mg / g, 12.83 ± 0.67 mg / g, 12.17 ± 0.42 mg / g, and 12.27 ± 0.97 mg / g, respectively. After low-temperature treatment at 4°C, the soluble sugar contents of WT and overexpression lines increased. OE1, OE2, and OE4 were 1.33, 1.34, and 1.34 times that of WT, respectively. The soluble sugar contents of the three overexpression lines were significantly higher than that of WT.
[0060] Determination of soluble protein content: The results showed that there was no significant difference in the soluble protein content between WT and overexpression lines at room temperature, and the contents were 6.67 ± 0.25 mg / g, 6.92 ± 0.34 mg / g, 6.93 ± 0.39 mg / g, and 6.69 ± 0.22 mg / g, respectively. After low-temperature treatment at 4°C, the soluble protein contents of WT and overexpression lines increased significantly. OE1, OE2, and OE4 were 1.47, 1.47, and 1.41 times that of WT, respectively. The soluble protein contents of the three overexpression lines were significantly higher than that of WT.
[0061] Determination of proline content: The results showed that there was no significant difference in the content of soluble protein between WT and overexpression lines at room temperature, and the contents were 10.70±0.14 μg / g, 10.78±0.12 μg / g, 10.93±0.49 μg / g and 11.09±0.58 μg / g respectively. After treatment at 4°C, the content of soluble protein in WT and overexpression lines increased significantly. OE1, OE2 and OE4 were 1.15, 1.15 and 1.156 times that of WT respectively, and the PRO content of the three overexpression lines was significantly higher than that of WT.
[0062] Determination of superoxide dismutase activity: The results showed that there was no significant difference in the SOD activity between WT and overexpression lines at room temperature, and the contents were 2.20±0.039 U / g, 2.20±0.033 U / g, 2.20±0.056 U / g and 2.28±0.029 U / g respectively. After treatment at 4°C, the SOD activity of WT and overexpression lines increased significantly. OE1, OE2 and OE4 were 1.47, 1.55 and 1.50 times that of WT respectively, and the SOD activity of the three overexpression lines was significantly higher than that of WT.
[0063] Determination of peroxidase activity: The results showed that there was no significant difference in the SOD activity between WT and overexpression lines at room temperature, and the contents were 5.20±1.09 U / g, 6.64±1.20 U / g, 5.87±1.54 U / g and 5.42±1.66 U / g respectively. After treatment at 4°C, the POD activity of WT and overexpression lines increased significantly. OE1, OE2 and OE4 were 1.24, 1.27 and 1.23 times that of WT respectively, and the SOD activity of the three overexpression lines was significantly higher than that of WT.
[0064] Determination of malondialdehyde content: The results showed that there was no significant difference in the MDA content between WT and overexpression lines at room temperature, and the contents were 5.01±0.031 μmol / g, 5.36±0.304 μmol / g, 5.47±0.502 μmol / g and 5.47±0.066 μmol / g respectively. After treatment at 4°C, the MDA content of WT and overexpression lines increased significantly. OE1, OE2 and OE4 were 0.72, 0.67 and 0.72 times that of WT respectively, and the SOD activity of the three overexpression lines was significantly lower than that of WT.
[0065] Determination of relative conductivity: The results showed that at room temperature, there was no significant difference in relative conductivity between WT and overexpression strains, which were 23.09±0.83%, 24.03±1.14%, 23.77±0.72% and 25.05±0.12%, respectively. After low-temperature treatment at 4°C, the relative conductivity of WT and overexpression strains increased significantly, which were 0.76, 0.76 and 0.75 times that of WT, respectively. The relative conductivity of the three overexpression strains were significantly lower than that of WT.
[0066] DAB staining: The results showed that there was no significant difference in leaf color between WT and overexpression strains at room temperature. After low-temperature treatment at 4°C and staining for 24 hours, the leaf colors of each plant were different. The color of the leaves of the overexpression strain was significantly lighter than that of the WT leaves, indicating that the content of H2O2 in the leaves of the overexpression strains was significantly lower than that of the WT.
[0067] NBT staining: The results showed that there was no significant difference between WT and overexpression strains at room temperature. After low-temperature treatment at 4°C and staining for 24 hours, the color of the leaves of the overexpression strains was significantly lighter than that of the WT leaves, indicating that the accumulation of reactive oxygen in the transgenic strains was less than that in the WT. Under low-temperature stress, the NBT staining in the tissue cells of cold-resistant plants was lighter, that is, the accumulation of superoxide anion free radicals was lower. This is because they have a more efficient antioxidant defense system that can promptly remove the superoxide anion free radicals induced by low temperature, thus showing stronger cold resistance.
[0068] Evans blue staining: Results showed that at room temperature, the blue color on the leaves of each strain was lighter and the difference was not large, indicating that the intracellular damage was lighter. After low-temperature treatment at 4°C, the WT and overexpression strains produced more blue precipitates than at room temperature, and the WT had the most blue precipitates than the transgenic strains, indicating that the degree of damage to the leaves of the overexpression plants was lower than that of the wild type.
[0069] Analysis of expression of key genes in the CBF pathway: The CBF signaling pathway is the most clearly studied plant cold response pathway. To further explore whether AkWRKY41 regulates tobacco cold resistance through the CBF pathway, we quantitatively analyzed the key genes in the tobacco CBF pathway, NtCBF1, NtCBF2, NtCBF3, NtCOR47, and NtICE1. The results showed that at room temperature, there was no significant difference in the expression of CBF pathway-related genes in WT and overexpression strains. After low temperature treatment at 4°C, the expression level of CBF pathway-related genes in the overexpression strain was significantly higher than that in WT. This indicates that AkWRKY41 may improve tobacco cold resistance by affecting the expression of genes related to the CBF pathway.
[0070] Example 3 Analysis of cold resistance of Actinidia chinensis plants with AkWRKY41 gene silencing induced by VIGS
[0071] Wild-type Actinidia kolomikta clone, cultured at 25 °C, light / dark: 16 / 8 h, light intensity: 1500 Lx, and used for subsequent experiments when growing to the 6-7 leaf stage.
[0072] Based on the pTRV2 vector sequence, the Actinidia kolomikta pTRV2-AkWRKY41 expression vector was constructed. Two restriction enzyme sites, BamH I (CGATCC) and Xma I (CCCGGG), were selected to construct the plant expression vector. Forward and reverse primers (pTRV2-AkWRKY41-F and pTRV2-AkWRKY41-R) containing restriction enzyme sites and protection bases were designed. Using Actinidia kolomikta leaf cDNA as a template, the target fragment of AkWRKY41 with homologous arms was amplified by PCR. The amplified product was recovered and purified by gel extraction. By homologous recombination, the target fragment of AkWRKY41 was ligated to the pTRV2 vector digested with double enzymes (BamH I and Xma I). The recombinant plasmid was transformed into Escherichia coli competent cells, and single colonies were picked on the resistant plate for PCR verification. The experimental results showed that the band size was consistent with the expectation, indicating that the connection between AkWRKY41 and the pTRV2 vector was successful. The sequenced positive plasmid was transferred into EHA105 Agrobacterium competent cells by the freeze-thaw method, and resistant single colonies were picked for colony PCR verification. The electrophoresis results showed that the target bands were all of the correct size, single, and clear and bright, indicating that the recombinant plasmid was successfully transferred into Agrobacterium competent cells.
[0073] pTRV2-AkWRKY41-F: AGAAGGCCTCCATGGGGATCCGTTCTACTTCCCTTCCACATCACTC (SEQ ID NO:5)
[0074] pTRV2-AkWRKY41-R: TGTCTTCGGGACATGCCCGGGTCAAACTGGTCATCCAAACCG (SEQ ID NO:6)
[0075] Take Agrobacterium containing the pTRV1 plasmid vector, pTRV2 empty vector, and pTRV2-AkWRKY41 recombinant vector. Use a 1 mL sterile syringe to aspirate the mixed bacterial solution and gently inject it from the back of the leaf near the vein so that the bacterial solution penetrates into the leaf tissue. There are 6 injection points on each leaf. After dark incubation at 16 °C for 1 day, take it out and continue light incubation at 25 °C. There are 30 plants in each of the control group, empty vector group, and experimental group.
[0076] Determination of the efficiency of inhibitory expression silencing: After the end of dark incubation, take the leaves to measure the expression level. The experimental results showed that compared with the water group (CK) and the empty vector group (TRV), the expression level of the pTRV2-AkWRKY41 silencing experimental group was significantly reduced.
[0077] To determine the time with the highest silencing efficiency of the pTRV2 system in Actinidia kolomikta, the silenced Actinidia kolomikta lines were cultured at room temperature, and the expression levels of the AkWRKY41 gene in Actinidia kolomikta were measured on the 0th, 1st, 2nd, 4th, 6th, 8th, and 10th days respectively. The experimental results showed that the expression levels of the AkWRKY41 gene in the silenced plants were different at different treatment times, showing an overall trend of first increasing and then decreasing. The expression level increased on the 1st day, which was 2.2 times that on the 0th day, and the lowest on the 6th day, which was 0.17 times that on the 0th day. Therefore, the 6th day was selected as the sampling time for subsequent experiments.
[0078] Phenotypic changes of the inhibited expression lines after low-temperature treatment: Plants of the water control group (CK), empty vector group (TRV), and silenced group (pTRV2-AkWRKY41) with consistent growth vigor were inoculated and then treated at 0 °C for 6 days and recovered for 2 days, and the phenotypic changes of the plants before and after the low-temperature treatment were compared. As shown in the experimental results ( Figure 6 ), when cultured at 25 °C, the three types of plants could all grow normally with little difference. After the low-temperature treatment, the leaves of the water group and the empty vector group were slightly wilted, while the leaves of the silenced group were severely wilted. After 48 h of recovery treatment, the water group and the empty vector group gradually recovered normal growth, while the leaves of the silenced plants were damaged more severely, indicating that the silenced plants had weaker adaptability to low temperature.
[0079] Determination of soluble sugar content: The results showed that there were no significant differences in the soluble sugar contents of the water group, negative control, and silenced plants at room temperature, with the contents being 1.04 ± 0.22 mg / g, 0.96 ± 0.19 mg / g, and 1.11 ± 0.21 mg / g respectively. After the 0 °C low-temperature treatment, the soluble sugar contents all increased, but the soluble sugar content of the silenced plants was significantly lower than that of the water group and the empty vector group, with the contents being 2.32 ± 0.04 mg / g, 2.31 ± 0.04 mg / g, and 1.68 ± 0.11 mg / g respectively.
[0080] Determination of soluble protein content: The results showed that there were no significant differences in the soluble protein contents of the water group, negative control, and silenced plants at room temperature, with the contents being 17.6 ± 1.28 mg / g, 19.36 ± 0.26 mg / g, and 17.99 ± 0.95 mg / g respectively. After the 0 °C low-temperature treatment, the soluble protein contents all increased, but the soluble protein content of the silenced plants was significantly lower than that of the water group and the empty vector group, with the contents being 62.76 ± 1.09 mg / g, 62.33 ± 1.11 mg / g, and 48.47 ± 0.83 mg / g respectively.
[0081] Determination of proline content: The results showed that at room temperature, there was no significant difference in the PRO content among the water group, negative control and silenced plants, with the contents being 34.5±3.59 μg / g, 39.28±5.56 μg / g and 40.74±8.18 μg / g respectively. After treatment at 0°C, the PRO content increased in all groups, but the PRO content of the silenced plants was significantly lower than that of the water group and the empty vector group, with the contents being 77.34±7.02 μg / g, 75.9±2.65 μg / g and 59.84±4.23 μg / g respectively.
[0082] Determination of superoxide dismutase: The results showed that at room temperature, there was no significant difference in the SOD activity among the water group, negative control and silenced plants, with the contents being 27±5.08 U / g, 25.52±2.33 U / g and 24.66±3.05 U / g respectively. After treatment at 0°C, the SOD activity increased in all groups, but the SOD activity of the silenced plants was significantly lower than that of the water group and the empty vector group, with the contents being 1066.4±237.39 U / g, 1112.77±181.83 U / g and 343.22±14.65 U / g respectively.
[0083] Determination of malondialdehyde content: The results showed that at room temperature, there was no significant difference in the MDA content among the water group, negative control and silenced plants, with the contents being 20.65±1.55 nmol / g, 20.26±0.40 nmol / g and 20.57±1.18 nmol / g respectively. After treatment at 0°C, the MDA content increased in all groups, but the MDA content of the water group and the empty vector group was significantly higher than that of the silenced plants, with the contents being 42.03±1.36 nmol / g, 42.41±1.04 nmol / g and 112.19±7.92 nmol / g respectively.
[0084] Determination of relative conductivity: The results showed that at room temperature, there was no significant difference in the relative conductivity among the water group, negative control and silenced plants, with the contents being 20.32±0.19%, 19.62±0.49% and 22.02±0.25% respectively. After treatment at 0°C, the relative conductivity increased in all groups, but the relative conductivity of the water group and the empty vector group was significantly higher than that of the silenced plants, being 48.51±11.11%, 44.16±2.83% and 83.83±2.07% respectively.
Claims
A polypeptide comprising the amino acid sequence shown in SEQ ID NO:
1.
2. A polynucleotide molecule encoding the polypeptide according to claim 1.
3. The polynucleotide molecule according to claim 2, characterized in that The cDNA sequence of the polynucleotide molecule is shown in SEQ ID NO:
2.
4. A recombinant vector, recombinant bacteria, recombinant plant cell or recombinant plant organ containing the polynucleotide molecule according to claim 2 or 3.
5. A method for enhancing the resistance of plants to abiotic stress, comprising transferring the polynucleotide molecule according to claim 2 or 3 into a plant, wherein the resistance of the plant to abiotic stress is enhanced compared with a plant not transferred with the polynucleotide molecule.
6. The method according to claim 5, characterized in that: The resistance to abiotic stress is cold resistance.
7. The method according to claim 5 or 6, characterized in that: The plant is a monocotyledon or a dicotyledon.
8. The method according to any one of claims 5 to 7, characterized in that: The plant is an Actinidia plant or a Nicotiana plant.
9. The method according to claim 8, characterized in that: The plant is Actinidia kolomiti (Actinidiakolomikta) or Nicotiana tabacum.