Nucleic acid constant temperature amplification and detection device and its use method

By designing a constant temperature amplification and detection device of nucleic acid and adopting a constant temperature control base and reagent reaction tube structure, the problems of limited reaction volume and pollution in the existing technology are solved, and the joint detection of multiple projects and efficient utilization of resources are achieved, and the uniformity and sensitivity of detection are improved.

CN120173724BActive Publication Date: 2025-09-02JIANGSU BIOPERFECTUS TECH CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202510653410.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-21
Publication Date
2025-09-02
Estimated Expiration
2045-05-21

AI Technical Summary

Technical Problem

The existing nucleic acid constant temperature amplification detection technology has problems such as limited reaction volume, inability to jointly test multiple projects, insufficient mixing of diluents and easy to be contaminated, and cannot effectively avoid aerosol pollution and resource waste.

Method used

A constant temperature amplification and detection device of nucleic acid is designed, adopting a constant temperature control base and reagent reaction tube structure, including a filter element, an interlaced overflow port and a sealing layer, ensuring uniform mixing of the diluent and amplified products, reducing contamination, and supporting multiple test strips to detect simultaneously, reducing costs with reusable lithium batteries.

Benefits of technology

The uniform mixing of the diluent and the amplified product is achieved, ensuring the uniformity of the reaction and amplification efficiency, reducing the risk of contamination, reducing the testing cost, and improving the sensitivity and reliability of the detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120173724B_ABST
    Figure CN120173724B_ABST
Patent Text Reader

Abstract

The present invention provides a nucleic acid constant temperature amplification and detection device and its use method, relates to the field of biological detection technology, including a constant temperature control base and a reagent reaction tube, the constant temperature control base is provided with a heating seat; the reagent reaction tube includes a reagent tube and a reagent cover, the reagent cover is provided with a silicone cover, a filter element and an annular circular hole sieve outlet; the middle part of the reagent tube is provided with a nucleic acid constant temperature amplification region, the circumference of the nucleic acid constant temperature amplification region is provided with a plurality of reagent strip slots, the nucleic acid constant temperature amplification region includes a conical protrusion and an annular constant temperature reaction pool, the constant temperature reaction pool is fitted with the heating seat, and the circumference of the constant temperature reaction pool is provided with a plurality of overflow channels, and the overflow channels are connected to the reagent strip slots in a one-to-one correspondence. The present invention slows down the speed of the diluent entering the constant temperature reaction pool by adopting a filter element and a circular hole sieve outlet; by adopting a conical protrusion, the uniformity of the reaction system is ensured; by adopting a staggered overflow port, the mixing of the amplified product and the diluent is achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biological detection technology, and in particular to a nucleic acid constant temperature amplification and detection device and a method for using the same. Background Art

[0002] Nucleic acid isothermal amplification detection technology eliminates the need for precision instrumentation to control heating and cooling cycles. It completes amplification in a short period of time at a constant temperature, producing results visible to the naked eye using pyrophosphatase precipitation or in combination with colloidal gold immunochromatography. Currently, this technology is being used for on-site detection of pathogen infections in agriculture, animal husbandry, and fishery, as well as pathogenic bacterial contamination in environmental water bodies.

[0003] The existing Chinese patent with publication number CN117025729A discloses a nucleic acid detection device and a nucleic acid detection method based on a nucleic acid test strip, including: a detection reagent receiving component, the detection reagent receiving component forms a sealed chamber, and the formed sealed chamber has a weak membrane; a detection card, the detection card includes a shell and a nucleic acid detection test strip; the shell is also provided with a test agent dripping port, the shell is provided with a joint; and also includes a thimble, the thimble can pierce the weak membrane.

[0004] Conventional nucleic acid constant-temperature amplification visualization detection technology adopts a method of combining nucleic acid constant-temperature amplification technology and chromatographic test strips. After the nucleic acid constant-temperature amplification is completed, the amplification product is released to the bottom of the chromatographic test strip by cutting, puncturing the amplification reagent tube, etc., and then reacted. The test strip is loaded in a conventional plastic cartridge, and the observation window is an open space or semi-open space, which can easily cause aerosol contamination and laboratory contamination.

[0005] The existing Chinese patent publication number CN113512490B discloses a self-driven microfluidic detection device and its use. The device includes: an upper cover, a bottom plate fixed under the upper cover, an interlayer arranged between the upper cover and the bottom plate, a sample loading hole arranged on the upper cover, a microfluidic guide component connected to the sample loading hole, a sample loading groove arranged on the interlayer and corresponding to the position of the microfluidic guide component, a functional chamber arranged on the interlayer and connected to the microfluidic guide component, and a chromatography test paper connected to the microfluidic guide component; the microfluidic guide component includes: a capillary guide channel, and an on-off connector connected to the capillary guide channel and controlling the connection and disconnection of the capillary guide channel.

[0006] In the existing technology, the reaction volume of the nucleic acid isothermal amplification system is generally 20-50 μL. Due to volume limitations, the product can only complete one test strip test, and multiple items cannot be tested together. If multiple test strips need to be tested at the same time, it is necessary to increase the diluent to flush the amplified product to the bottom of the test strip for chromatography reaction. Since the nucleic acid amplification volume is generally 20-50 μL, the amount of chromatography diluent used is generally 80-120 μL. Too much diluent may overflow the amplified product, making it impossible to mix evenly, or insufficiently mix, or cause a decrease in sensitivity.

[0007] Therefore, it is necessary to provide a sealed, multi-linked nucleic acid constant temperature amplification visualization detection device that can achieve mixing of diluent and amplification products, ensure the uniformity and amplification efficiency of nucleic acid constant temperature amplification, and reduce external contamination of nucleic acid constant temperature amplification and aerosol pollution of the environment caused by high-solubility amplification products generated by detection reagents. It can be reused, thereby reducing testing costs, avoiding waste of resources and output of electronic waste, and is relatively green and environmentally friendly. Summary of the Invention

[0008] In view of the defects in the prior art, the purpose of the present invention is to provide a nucleic acid constant temperature amplification and detection device and a method of using the same.

[0009] According to the present invention, a nucleic acid constant temperature amplification and detection device is provided, comprising: a constant temperature control base and a reagent reaction tube, wherein the constant temperature control base is provided with a heating seat, a constant temperature rod is installed on the top of the heating seat, and the heating seat is inserted into the reagent reaction tube;

[0010] The reagent reaction tube comprises: a reagent tube and a reagent cover, wherein the reagent cover is fastened to the top of the reagent tube, the reagent cover comprises an inwardly concave reagent cover, the middle portion of the reagent cover is provided with: a silica gel cover, a filter element and an annular circular hole sieve outlet in order from top to bottom, and a spherical protrusion is provided at the center of the circular hole sieve outlet;

[0011] A nucleic acid constant temperature amplification area is provided in the middle of the reagent tube, and a plurality of reagent strip slots are provided on the surrounding side of the nucleic acid constant temperature amplification area. The nucleic acid constant temperature amplification area includes a conical protrusion in the center and a ring-shaped constant temperature reaction pool. The circular hole sieve outlet is provided corresponding to the constant temperature reaction pool, and the constant temperature reaction pool is fitted with the heating seat. A plurality of overflow channels are provided on the surrounding side of the constant temperature reaction pool. The constant temperature reaction pool is connected to the plurality of overflow channels respectively through staggered overflow ports, and the overflow channels are connected to the reagent strip slots one by one.

[0012] Preferably, the constant temperature control base includes a shell, the shell includes a cylindrical heating seat arranged in the middle, and also includes a control area that does not contact the reagent reaction tube, the surface of the control area is provided with an LED display screen and one or more push switches, a battery and a circuit board are installed inside the shell, a buzzer reminder is installed on the shell, and the circuit board is electrically connected to the buzzer reminder, LED display screen, and push switch respectively.

[0013] Preferably, a heating tube is installed inside the thermostatic rod, the heating tube is electrically connected to the circuit board, and the heating tube is arranged corresponding to the conical protrusion.

[0014] Preferably, the reagent tube comprises a transparent cylindrical body, and the reagent tube and the reagent cover are connected by screw engagement or bonding.

[0015] Preferably, a sample addition port is formed in the middle of the reagent cover, the silicone cover is installed on the reagent cover and seals the sample addition port, and a sample addition hole with a cross opening or a triangular opening is provided in the middle of the silicone cover, and the sample addition hole is connected to the sample addition port.

[0016] Preferably, a sample adding cavity is formed between the filter element and the silica gel cover, a filtration cavity is formed between the filter element and the circular hole sieve outlet, and the filtration cavity is connected to the constant temperature reaction pool through the circular hole sieve outlet.

[0017] Preferably, a nucleic acid amplification freeze-dried powder reagent is placed in the constant temperature reaction tank, and the spherical protrusions and the conical protrusions are arranged correspondingly and their sizes match.

[0018] Preferably, the plurality of reagent strip slots are evenly arranged along the circumference of the reagent reaction tube, the overflow channels are arranged in one-to-one correspondence with the reagent strip slots, and the circumferential side of the constant temperature reaction pool is evenly provided with a plurality of staggered overflow ports, the staggered overflow ports include double-layer baffles, and the inner baffle of the staggered overflow port, the flow channel of the outer baffle, and the entrance of the overflow channel are arranged in one-to-one correspondence from the inside to the outside.

[0019] Preferably, a partition slot is provided at the end of the overflow channel, a partition is inserted inside the partition slot, the reagent strip slot is divided into two inner and outer layers connected at the bottom by the partition, the reagent strip is inserted on the outer side of the partition, and the overflow channel is connected to the inner side of the partition.

[0020] According to the present invention, a method for using a nucleic acid constant temperature amplification and detection device is provided, which uses the nucleic acid constant temperature amplification and detection device, comprising the following steps:

[0021] Step S1, turning on the power of the constant temperature control base and installing the reagent reaction tube on the constant temperature control base;

[0022] Step S2, collecting samples and eluting them in nucleic acid lysis buffer;

[0023] Step S3, taking the nucleic acid lysis solution and adding the nucleic acid lysis solution to be tested into the sample addition hole of the silica gel cover;

[0024] Step S4: Click the Start Test button, and the thermostatically controlled base performs constant temperature heating and incubation for a preset time;

[0025] Step S5: The countdown completes the constant temperature amplification of nucleic acid, and the buzzer reminds you to proceed to the next step, add diluent, perform test strip test, and observe the test strip chromatography results through the transparent window.

[0026] Compared with the prior art, the present invention has the following beneficial effects:

[0027] 1. The present invention adopts a filter element in the middle of the reagent cover and a circular hole sieve outlet at the bottom, which can slow down the speed of the diluent entering the constant temperature reaction tank and prevent the diluent from directly overflowing; by adopting a staggered overflow port structure, the liquid is intercepted by the raised part of the staggered overflow port and mixed with the liquid moving behind, thereby completing the mixing of the amplification product and the diluent, solving the problem of dilution and mixing of the amplification product due to the large volume of the diluent and the small volume of the amplification. The problem of repeated mixing cannot be caused.

[0028] 2. The present invention adopts a structure of spherical protrusions, a constant temperature reaction pool and a conical protrusion in the middle of the reaction pool to evenly disperse the nucleic acid lysate to be tested around, ensure the uniformity of the reaction system, and evenly distribute the reaction area around; by adopting a silicone cover, a filter element and a filter cavity to form a sealing layer, etc., it reduces external contamination of the constant temperature amplification of nucleic acids and aerosol pollution of the environment caused by high concentration of amplification products generated by the detection reagents; the structure of the annular constant temperature reaction pool can also avoid the influence of overheating of the center of the heating rod on the activity of the enzyme, thereby ensuring the uniformity and amplification efficiency of the constant temperature amplification of nucleic acids.

[0029] 3. The present invention divides the constant temperature amplification of nucleic acid into two parts: a constant temperature control base and a reagent reaction tube. The constant temperature control base is equipped with a rechargeable lithium battery, which can be reused, thereby reducing testing costs, avoiding waste of resources and output of electronic waste, and is relatively green and environmentally friendly; a temperature control module, a time control module and a buzzer module are added to the constant temperature control base to ensure that the reagents perform nucleic acid amplification within a constant temperature range and at a constant time, ensuring the amplification efficiency and consistency of the results between experiments, and can effectively remind the user of the reagent reaction process and timely interpret the results to avoid forgetting the ongoing test. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Other features, objects and advantages of the present invention will become more apparent upon reading the detailed description of non-limiting embodiments with reference to the following drawings:

[0031] Figure 1 This is a schematic diagram of the structure of the nucleic acid constant temperature amplification and detection device mainly embodied in the present invention;

[0032] Figure 2 This is a cross-sectional view of a nucleic acid constant temperature amplification and detection device mainly embodied in the present invention;

[0033] Figure 3 This is a structural diagram of a thermostatically controlled base that is mainly embodied in the present invention;

[0034] Figure 4 This is a cross-sectional view of a thermostatically controlled base that is primarily embodied in the present invention;

[0035] Figure 5 This is a top view of the thermostatic control base that mainly embodies the present invention;

[0036] Figure 6 This is a schematic diagram of the structure of the reagent reaction tube mainly embodied in the present invention;

[0037] Figure 7 This is a cross-sectional view of a reagent reaction tube that is mainly embodied in the present invention;

[0038] Figure 8 This is a top view of the nucleic acid constant temperature amplification area mainly embodied in the present invention.

[0039] As shown in the figure: constant temperature control base 1; outer shell 11; constant temperature rod 12; heating tube 13; battery 14; circuit board 15; heating seat 111; LED display screen 112; power switch button 113; reaction start button 114; reagent reaction tube 2; reagent tube 21; reagent cover 22; silicone cover 23; reagent strip 24; partition 25; constant temperature reaction pool 211; staggered overflow port 212; partition slot 213; conical protrusion 214; overflow channel 215; reagent strip slot 216; filter element 221; filter cavity 222; spherical protrusion 223; circular hole sieve outlet 224. DETAILED DESCRIPTION

[0040] The present invention will be described in detail below with reference to specific embodiments. The following examples will help those skilled in the art to further understand the present invention, but are not intended to limit the present invention in any form. It should be noted that, for those skilled in the art, several changes and improvements can be made without departing from the scope of the present invention. These all fall within the scope of protection of the present invention.

[0041] Example 1

[0042] like Figure 1-8As shown, a nucleic acid constant temperature amplification and detection device provided by the present invention includes: a constant temperature control base 1 and a reagent reaction tube 2, the constant temperature control base 1 is used to control the reaction and constant temperature heating, and the reagent reaction tube 2 is used for constant temperature amplification of nucleic acid and combined with immunochromatographic test strip detection. A heating seat 111 is provided on the constant temperature control base 1, and a constant temperature rod 12 is installed on the top of the heating seat 111. The heating seat 111 is inserted into the inside of the reagent reaction tube 2; the reagent reaction tube 2 includes: a reagent tube 21 and a reagent cover 22, the reagent cover 22 is fastened to the top of the reagent tube 21, and the reagent cover 22 includes an inward concave reagent cover. The middle part of the reagent cover 22 is sequentially provided with: a silicone cover 23, a filter element 221 and an annular circular hole sieve outlet 224, and a spherical protrusion 223 is provided at the center of the circular hole sieve outlet 224; the middle part of the reagent tube 21 is provided with a nucleic acid constant temperature amplification area, and a plurality of reagent strip slots 216 are provided on the circumference of the nucleic acid constant temperature amplification area, which serves as the reaction area of ​​the reagent strip 24. The nucleic acid constant temperature amplification area includes a conical protrusion 214 in the center and a ring-shaped constant temperature reaction pool 211. The circular hole sieve outlet 224 is arranged corresponding to the constant temperature reaction pool 211. The constant temperature reaction pool 211 is fitted with the heating seat 111. Multiple overflow channels 215 are arranged on the surrounding side of the constant temperature reaction pool 211. The constant temperature reaction pool 211 is connected to the multiple overflow channels 215 through staggered overflow ports 212, and the overflow channels 215 are connected one-to-one with the reagent strip slots 216.

[0043] The constant temperature control base 1 includes a shell 11, and the shell 11 includes a cylindrical heating seat 111 arranged in the middle. The cylindrical raised heating seat 111 is used to support the reagent reaction tube 2. The constant temperature control base 1 also includes a control area that does not contact the reagent reaction tube 2, which is generally a platform part. The surface of the control area is provided with an LED display screen 112 and one or more key switches. The LED display screen 112 is used to display the reaction time and temperature. The key switch includes a power switch button 113 and / or a reaction start button 114. A battery 14 and a circuit board 15 are installed inside the shell 11. The battery 14 serves as an energy source. The circuit board 15 is used to control the constant temperature heating temperature and the constant temperature heating time. A buzzer reminder is installed on the shell 11, and a buzzer reminder is sounded after the reaction is completed. The circuit board 15 is electrically connected to the buzzer reminder, the LED display screen 112, and the key switch respectively.

[0044] The constant temperature control base 1 of the present application is reusable, avoiding waste of resources and electronic components and reducing electronic waste in the environment; the constant temperature control base 1 has a timed heating function, which is used to provide the constant temperature required for constant temperature amplification of nucleic acids; it has an LED display screen 112 and a buzzer reminder, which can remind the user to proceed to the next step to prevent forgetting.

[0045] The thermostat rod 12 is used for constant heat conduction for constant-temperature nucleic acid amplification in the constant-temperature reaction pool 211. A metal heating tube 13 is installed within the thermostat rod 12, electrically connected to the circuit board 15 and corresponding to the conical protrusion 214. The thermostat rod 12 fits snugly within the constant-temperature reaction pool 211, maintaining a constant temperature of 37°C to 65°C for constant-temperature nucleic acid amplification. The annular constant-temperature reaction pool 211 fits snugly within the heater block 111, ensuring a more uniform temperature around the perimeter of the ring. This prevents overheating in the center of the heater tube 13, which could affect enzyme activity and amplification efficiency.

[0046] The reagent tube 21 comprises a transparent cylindrical body with a hollow bottom, the hollow portion of which is engaged with the heating base 111. The reagent tube 21 and the reagent cover 22 are connected by a screw thread or a polymer adhesive. The cylindrical design of the reagent tube 21 allows for the simultaneous testing of multiple test strips 24 through multiple reagent strip slots 216, thereby achieving the combined detection of multiple pathogens or multiple targets.

[0047] A sample loading port is formed in the middle of the reagent cover 22. A silicone cap 23 is mounted on the reagent cover 22 and seals the sample loading port. The silicone cap 23 engages with the recessed portion of the reagent cover 22. A sample loading hole with a cross or triangular opening is provided in the middle of the silicone cap 23 for adding the sample to be tested and the diluent. The sample loading hole is connected to the sample loading port. The reagent tube 21 of the present application is sealed by the silicone plug 23, and the narrow opening portion can effectively prevent external contamination during the nucleic acid amplification process and leakage of the nucleic acid amplification product generated by the test, which may cause aerosol contamination.

[0048] A sample loading chamber is formed between the filter element 221 and the silicone cover 23, and a filtration chamber 222 is formed between the filter element 221 and the circular sieve outlet 224. The filtration chamber 222 is connected to the constant temperature reaction pool 211 through the circular sieve outlet 224. The circular sieve outlet 224 has circular sieve holes that can evenly disperse the test solution that has passed through the filter element 221 into the constant temperature reaction pool 211 for the next constant temperature amplification reaction. The filter element 221 is installed in the reagent cover 22 to filter impurities or large, difficult-to-decompose particulate matter from the sample, thereby increasing reaction efficiency. In addition, the filter chamber 222 further prevents aerosol contamination formed by high-concentration amplification products during the constant temperature nucleic acid amplification process.

[0049] A nucleic acid amplification lyophilized powder reagent is placed within the constant-temperature reaction tank 211. Spherical protrusions 223 and conical protrusions 214 are positioned in a corresponding manner, and their sizes match. The spherical protrusion 223 at the bottom center of the reagent cover 22 evenly disperses the filtered nucleic acid lysate to be tested. The spherical protrusion 223 then drips into the annular constant-temperature reaction tank 211 through the circular sieve outlet 224, fully re-dissolving the lyophilized nucleic acid reagent surrounding the conical protrusion 214.

[0050] Multiple reagent strip slots 216 are evenly arranged along the circumference of the reagent reaction tube 2, and the overflow channels 215 are arranged one-to-one corresponding to the reagent strip slots 216. Generally, six reagent strip slots 216 are provided, which can support 1-6 reagent strips 24 for reaction.

[0051] Multiple staggered overflow ports 212 are evenly distributed around the perimeter of the constant-temperature reaction pool 211. These ports 212 comprise a double layer of baffles, with the inner baffles, the flow channels of the outer baffles, and the entrances of the overflow channels 215 corresponding to each other from the inside out. The overflow channels 215 connect the constant-temperature reaction pool 211 to the bottom of multiple reagent strip slots 216. After the reaction is complete, the products are mixed by the vortex of the staggered overflow ports 212 and then flow through the overflow channels 215 into the bottom of the reagent strip 24 for chromatography.

[0052] A partition slot 213 is provided at the end of overflow channel 215. A partition 25 is inserted within partition slot 213 to prevent liquid in overflow channel 215 from contaminating a test strip 24 in test strip slot 216. Reagent strip slot 216 is divided into two layers, inner and outer, connected at the bottom, by partition 25. Reagent strip 24 is inserted on the outer side of partition 25, and overflow channel 215 communicates with the inner side of partition 25.

[0053] The filter element 221 in the middle of the reagent cover 22 and the circular hole sieve outlet 224 at the bottom can slow down the speed of the diluent entering the constant temperature reaction pool 211, and prevent the excessive diluent from overflowing directly without passing through the constant temperature reaction pool 211 and directly entering the overflow channel 215 for chromatography reaction. After the diluent enters the constant temperature reaction pool 211, it slowly flows along the circular hole sieve outlet 224 to mix with the nucleic acid amplification product. When the liquid exceeds the reaction pool, a small amount of the liquid overflows through the opening part of the staggered overflow port 212 and enters the overflow channel 215. The other part of the liquid is intercepted by the raised part of the staggered overflow port 212 and mixed with the liquid moving behind, thereby completing the mixing of the amplification product and the diluent. After accumulating to a certain volume and forming pressure, the liquid flows along the opening part or directly into the overflow channel 215 to reach the bottom end of the reagent strip 24 for reaction.

[0054] The present application adopts the filter element 221 in the middle of the reagent cover 22 and the circular hole sieve outlet 224 at the bottom, which can slow down the speed of the diluent entering the constant temperature reaction tank 211 and avoid the direct overflow of the diluent; by adopting the structure of the staggered overflow port 212, the liquid is intercepted by the raised part of the staggered overflow port 212 and mixed with the liquid moving behind, thereby completing the mixing of the amplification product and the diluent, solving the problem of dilution and mixing of the amplification product due to the large volume of the diluent and the small volume of the amplification. The problem of repeated mixing cannot be caused.

[0055] The present application adopts a structure of a spherical protrusion 223, a constant temperature reaction pool 211 and a conical protrusion 214 in the middle of the reaction pool to evenly disperse the nucleic acid lysate to be tested around, ensure the uniformity of the reaction system, and evenly distribute the reaction area around; the structure of the annular constant temperature reaction pool 211 can also avoid the effect of overheating in the center of the heating rod on the activity of the enzyme, thereby ensuring the uniformity and amplification efficiency of the nucleic acid constant temperature amplification.

[0056] The present application forms a sealing layer by using a silicone cover 23, a filter element 221 and a filter cavity 222, thereby reducing external contamination of the constant temperature amplification of nucleic acids and aerosol contamination caused by high-concentration amplification products generated by the detection reagents.

[0057] The present application adds a temperature control module, a time control module, and a buzzer module to the constant temperature control base 1, thereby ensuring that the reagents perform nucleic acid amplification within a constant temperature range and at a constant time, thereby ensuring amplification efficiency and consistency of results between experiments. By adding a buzzer module to the constant temperature control base 1, the user can be effectively reminded of the reagent reaction process and the result interpretation in a timely manner, avoiding forgetting the ongoing test.

[0058] The present application divides the constant temperature amplification of nucleic acid into two parts: a constant temperature control base 1 and a reagent reaction tube 2. The constant temperature control base is equipped with a rechargeable lithium battery that can be reused, thereby reducing testing costs, avoiding waste of resources and output of electronic waste, and is relatively green and environmentally friendly.

[0059] Example 2

[0060] Based on Example 1, a method for using a nucleic acid isothermal amplification and detection device provided by the present invention includes the following steps:

[0061] Step S1, turning on the power of the constant temperature control base 1, and installing the reagent reaction tube 2 on the constant temperature control base 1;

[0062] Step S2, collecting samples and eluting them in nucleic acid lysis buffer;

[0063] Step S3, taking the nucleic acid lysate, and adding the nucleic acid lysate to be tested into the sample addition hole of the silica gel cover 23;

[0064] Step S4, click the start test button, and the thermostatically controlled base 1 performs constant temperature heating and incubation for a preset time;

[0065] Step S5, countdown to complete the constant temperature amplification of nucleic acid, the buzzer reminds to proceed to the next step, add diluent, perform test strip 24 test, and observe the test strip chromatography results through the transparent window.

[0066] More specifically, the following steps are included:

[0067] Step S1, turning on the power of the constant temperature control base 1, and placing the reagent reaction tube 2 on the constant temperature control base 1;

[0068] Step S2, collecting a nasal swab sample and eluting it in a nucleic acid lysis buffer;

[0069] Step S3: Take an appropriate amount of nucleic acid lysis solution, such as 80-200 μL, and add the nucleic acid lysis solution to be tested to the sample injection port of the silica gel cover 23;

[0070] Step S4, click the start test button, and the constant temperature control base 1 performs constant temperature heating incubation for 15 minutes to 30 minutes;

[0071] Step S5: Countdown to complete constant temperature amplification of nucleic acid, and the buzzer prompts to proceed to the next step; add diluent and perform test strip test. The test strip chromatography results can be viewed through the transparent window in 3min~15min, and the infection of a certain pathogen or pathogens can be judged by whether the C line and T line are colored.

[0072] This application further illustrates the preparation and validation of a rapid nucleic acid test kit for multiple respiratory pathogens. The device of this application was used to test respiratory pathogen-positive samples: influenza A (H3N2), influenza B (BV), and respiratory syncytial virus (RSV)-positive and negative samples.

[0073] With the deepening of research, nucleic acid isothermal amplification technology has developed rapidly. The main isothermal amplification technologies currently used include loop-mediated isothermal amplification (LAMP), recombinase polymerase amplification (RPA), nucleic acid sequence-dependent amplification (NASBA), rolling circle amplification (RCA), and helicase-dependent amplification (HDA). This embodiment uses recombinase polymerase amplification (RPA) combined with a test strip. This invented device detects common respiratory pathogens, influenza A virus, influenza B virus, and respiratory syncytial virus.

[0074] The first step is to prepare reagents for nucleic acid isothermal amplification:

[0075] 1. Primer design;

[0076] Influenza A virus primer design:

[0077] Primer SEQ1: biotin-5'-CATGGAATGGCTAAAGACA-3'; SEQ ID No.1

[0078] Primer SEQ2: FITC-5'-GCGTGAACACAAATCCTA-3'; SEQ ID No. 2

[0079] Influenza B virus primer design:

[0080] Primer SEQ3: biotin-5'-TGGTCTCAGCTATGAACAC-3'; SEQ ID No. 3

[0081] Primer SEQ4: TAMAR-5'-GTTGCTTTGCAGCTCTTC-3'; SEQ ID No. 4

[0082] Respiratory syncytial virus primer design:

[0083] Primer SEQ5: biotin-5'- GATCAACTTCTGTCATCCAGCAAA -3'; SEQ ID No.5

[0084] Primer SEQ6: Digoxin-5'- TGTGTTTCTGCACATCATAATTAGGA -3'; SEQ ID No.6

[0085] 2. Add 50ul of RPA reaction system, including enzyme (Thermo Fisher Lyo-ready RPA Kit cat: A72127) and primer mixture, to the constant temperature reaction pool 211 and freeze-dry for storage.

[0086] Step 2: Preparation of test strips:

[0087] 1. Preparation of gold bonding pads;

[0088] 5 mg of biotin antibody (Zhuhai Bomei, Cat: 6C6) that can bind to and capture biotin-labeled probe was added to 1000 mL of 0.1‰ (w / v) colloidal gold solution and stirred uniformly at room temperature; 2 mL of 0.2 M K2CO3 solution was immediately added and continued to stir uniformly for 60 min; 20 mL of 10% (w / v) BSA solution was added and stirred uniformly at room temperature for 60 min; after completion, the solution was centrifuged at 8000 rpm for 30 min, the supernatant was removed, 1 mL of colloidal gold diluent was added to recover the labeled colloidal gold, and the solution was stored at 2-8°C for use and the concentration OD value of the colloidal gold was tested using a UV spectrophotometer. Colloidal gold prepared with colloidal gold diluent (50 mM Tris-HCl, 2% (w / v) sucrose, 2% (w / v) BSA, 0.5% (v / v) Tween-20) was diluted to 4 OD. 30 mL of the mixed colloidal gold solution was used to evenly soak one 8950 (255 mm * 300 mm) (Ahlstrom, Cat: 8950) glass fiber. The solution was dried in a 37°C oven and sealed for later use.

[0089] 2. Preparation of NC membrane for multiple respiratory virus detection;

[0090] 2.1 NC membrane for influenza A nucleic acid detection;

[0091] Quality control line C: can capture goat anti-mouse labeled with biotin monoclonal antibody (Phipeng), 0.8-1 mg / mL, spray volume 0.8 μl / cm;

[0092] Test line T: coated with anti-FITC monoclonal antibody (Boya, Cat: MFITC-101), 0.8-1 mg / mL, spray volume 0.8 ul / cm; can capture FITC on the influenza A-specific upstream primer;

[0093] 2.2 NC membrane for influenza B nucleic acid detection;

[0094] Quality control line C: can capture goat anti-mouse labeled with biotin monoclonal antibody (Phipeng), 0.8-1 mg / mL, spray volume 0.8 μl / cm;

[0095] Test line T: coated with anti-TAMAR monoclonal antibody (Biomei, Cat: 1A3), 0.8-1 mg / mL, spray volume 0.8 μl / cm; can capture TAMAR on the influenza B-specific upstream primer;

[0096] 2.3 Respiratory syncytial nucleic acid detection NC membrane;

[0097] Quality control line C: can capture goat anti-mouse labeled with biotin monoclonal antibody (Phipeng), 0.8-1 mg / mL, spray volume 0.8 μl / cm;

[0098] Test line T: coated with anti-Digoxin monoclonal antibody (Bomei Cat: HH10), 0.8-1 mg / mL, spray volume 0.8 ul / cm; can capture Digoxin on the respiratory syncytial virus-specific upstream primer;

[0099] Use a gold spray film scratcher to evenly spray the corresponding positions of the NC film (Sartorius, Cat: 1UN14) according to the above spray amount. After completion, place it in a 45°C oven for 16-24 hours and dry it away from light for use.

[0100] 3. Assembly of test strips;

[0101] Cut absorbent paper (Shanghai Hengyuan, Cat: CHK-17), a gold conjugation pad (5mm x 30mm), a coated NC membrane (20mm x 30mm), and a sample pad (Ahlstrom, Cat: 8964) were sequentially attached to a PVC baseboard (600mm x 300mm) (Ruijian, Hangzhou). Self-adhesive tape (Fuai Packaging) was applied to the junctions between the absorbent paper and NC membrane, and between the NC membrane, gold conjugation pad, and absorbent paper, according to the specific test item. The assembled baseboard was cut into 3mm test strips for influenza A, influenza B, and respiratory syncytial virus testing.

[0102] The three test strips are loaded into the corresponding test strip slots 216 of the detection device of the present application respectively.

[0103] The third step is to use the device of the present application to detect respiratory pathogens such as influenza A virus, influenza B virus, respiratory syncytial virus, and Mycoplasma pneumoniae. The reaction process is as follows:

[0104] Step S1, turning on the power of the constant temperature control base 1, and placing the reagent reaction tube 2 on the constant temperature control base 1;

[0105] Step S2, collecting a nasal swab sample and eluting it in a nucleic acid lysis buffer;

[0106] Step S3: Take 100 μL of nucleic acid lysate and add the sample to be tested to the sample injection port of the silica gel cover 23. The lysate passes through the filter element 221 to filter out impurities in the sample lysate, enters the filter chamber 222, and is dispersed at the circular hole sieve outlet 224 under the action of the spherical protrusion 223. The test solution is evenly dispersed in the constant temperature reaction pool 211.

[0107] Step S4, click the start test button, and the thermostatically controlled base 1 performs a 30-min constant temperature heating incubation at 40°C;

[0108] Step S5: Countdown to complete constant-temperature nucleic acid amplification, and the buzzer prompts the next step; 200 μL of diluent is added through the sample port of the silicone cover 23. The diluent passes through the filter element 221 and the filter cavity 222, and enters the constant-temperature reaction cell 211 through the circular hole sieve outlet 224. The liquid is mixed under the action of the staggered overflow port 212, and then flows along the overflow channel 215 into the bottom of the reagent cartridge to the bottom of the reagent strip 24. Lateral flow chromatography testing of the test strip 24 is performed. The test strip chromatography results can be viewed through the transparent window in 3-15 minutes. Whether the C line and T line are colored determines whether the infection is influenza A virus, influenza B virus, or respiratory syncytial virus.

[0109] In the description of this application, it should be understood that the terms "up", "down", "front", "back", "left", "right", "vertical", "horizontal", "top", "bottom", "inside", "outside", etc., indicating the orientation or position relationship, are based on the orientation or position relationship shown in the accompanying drawings, and are only for the convenience of describing this application and simplifying the description, and do not indicate or imply that the device or element referred to must have a specific orientation, be constructed and operated in a specific orientation, and therefore cannot be understood as a limitation on this application.

[0110] The above describes specific embodiments of the present invention. It should be understood that the present invention is not limited to the specific embodiments described above, and those skilled in the art may make various changes or modifications within the scope of the claims, which do not affect the essence of the present invention. The embodiments of this application and the features in the embodiments may be combined with each other in any manner unless there is a conflict.

Claims

1. A nucleic acid constant temperature amplification and detection device, characterized in that: include: A constant temperature control base (1) and a reagent reaction tube (2), wherein a heating base (111) is provided on the constant temperature control base (1), a constant temperature rod (12) is installed at the top of the heating base (111), a heating tube (13) is installed inside the constant temperature rod (12), and the heating base (111) is inserted into the reagent reaction tube (2); The reagent reaction tube (2) comprises: a reagent tube (21) and a reagent cover (22), wherein the reagent cover (22) is fixedly mounted on the top of the reagent tube (21), and the reagent cover (22) comprises an inward-concave reagent cover, wherein the middle portion of the reagent cover (22) is provided with: a silica gel cover (23), a filter element (221) and an annular circular hole sieve outlet (224) in sequence from top to bottom, and a spherical protrusion (223) is provided at the center of the circular hole sieve outlet (224); A nucleic acid constant temperature amplification region is provided in the middle of the reagent tube (21), and a plurality of reagent strip slots (216) are provided on the peripheral side of the nucleic acid constant temperature amplification region. The nucleic acid constant temperature amplification region includes a conical protrusion (214) in the center and a ring-shaped constant temperature reaction pool (211). The constant temperature reaction pool (211) is fitted with the heating seat (111), the heating tube (13) is provided corresponding to the conical protrusion (214), the circular hole sieve outlet (224) is provided corresponding to the constant temperature reaction pool (211), and a nucleic acid amplification freeze-dried powder reagent is placed in the constant temperature reaction pool (211). The spherical protrusion (223) is provided corresponding to the conical protrusion (214), and the sizes of the two are matched. The constant temperature reaction pool (211) is fitted with the heating seat (111), and a plurality of overflow channels (215) are arranged around the constant temperature reaction pool (211). The constant temperature reaction pool (211) is connected to the plurality of overflow channels (215) through staggered overflow ports (212), and the overflow channels (215) are connected to the reagent strip slots (216) in a one-to-one correspondence. The plurality of reagent strip slots (216) are evenly arranged along the circumference of the reagent reaction tube (2), and the overflow channels (215) are arranged in a one-to-one correspondence with the reagent strip slots (216). The constant temperature reaction pool (211) is evenly provided with a plurality of staggered overflow ports (212) around the circumference, and the staggered overflow ports (212) include double-layer baffles. The inner baffle of the staggered overflow port (212), the outer baffle flow channel, and the entrance of the overflow channel (215) are arranged in a one-to-one correspondence from the inside to the outside.

2. The nucleic acid isothermal amplification and detection device according to claim 1, wherein: The constant temperature control base (1) includes a shell (11), the shell (11) includes a cylindrical heating seat (111) arranged in the middle, and also includes a control area that does not contact the reagent reaction tube (2), the surface of the control area is provided with an LED display screen (112) and one or more key switches, a battery (14) and a circuit board (15) are installed inside the shell (11), the heating tube (13) is electrically connected to the circuit board (15), a buzzer reminder is installed on the shell (11), and the circuit board (15) is electrically connected to the buzzer reminder, the LED display screen (112), and the key switch respectively.

3. The nucleic acid isothermal amplification and detection device according to claim 1, wherein: The reagent tube (21) comprises a transparent cylindrical body, and the reagent tube (21) and the reagent cover (22) are connected by screw engagement or bonding.

4. The nucleic acid isothermal amplification and detection device according to claim 1, wherein: A sample addition port is formed in the middle of the reagent cover (22), the silicone cover (23) is mounted on the reagent cover (22) and seals the sample addition port, and a sample addition hole with a cross opening or a triangular opening is provided in the middle of the silicone cover (23), and the sample addition hole is communicated with the sample addition port.

5. The nucleic acid isothermal amplification and detection device according to claim 1, wherein: A sample addition cavity is formed between the filter element (221) and the silica gel cover (23), a filtration cavity (222) is formed between the filter element (221) and the circular hole sieve outlet (224), and the filtration cavity (222) is connected to the constant temperature reaction pool (211) through the circular hole sieve outlet (224).

6. The nucleic acid isothermal amplification and detection device according to claim 1, wherein: A partition slot (213) is provided at the end of the overflow channel (215), a partition (25) is inserted into the interior of the partition slot (213), the reagent strip slot (216) is divided into two layers, an inner layer and an outer layer, which are connected at the bottom by the partition (25), the reagent strip (24) is inserted on the outer side of the partition (25), and the overflow channel (215) is connected to the inner side of the partition (25).

7. A method for using a nucleic acid isothermal amplification and detection device for purposes other than disease diagnosis and / or treatment, characterized in that: The nucleic acid isothermal amplification and detection device according to any one of claims 1 to 6 comprises the following steps: Step S1, turning on the power of the constant temperature control base (1), and installing the reagent reaction tube (2) on the constant temperature control base (1); Step S2, collecting samples and eluting them in nucleic acid lysis buffer; Step S3, taking the nucleic acid lysis solution and adding the nucleic acid lysis solution to be tested to the sample addition hole of the silica gel cover (23); Step S4, click the start test button, and the thermostatically controlled base (1) performs constant temperature heating and incubation for a preset time; Step S5: The countdown completes the constant temperature amplification of nucleic acid, and the buzzer reminds you to proceed to the next step, add diluent, perform test strip test, and observe the test strip chromatography results through the transparent window.

Citation Information

Patent Citations

  • A self-driven microfluidic detection device and its application

    CN113512490B

  • Nucleic acid detection device and nucleic acid detection method based on nucleic acid test strip

    CN117025729A

  • Sample tester including independent starter and method

    CN114206226A

  • Colloidal gold detection device for nucleic acid isothermal amplification

    CN218596406U

  • Device for fecal occult blood test

    US20120083028A1