Application of dual-chamber probiotic intervention in chemotherapy of colon cancer and intestinal and genital tract flora
Through dual-cavity probiotic intervention, the combined use of Bifidobacterium longum subsp. longum NCU-05 and Lactobacillus curvature NCU-28 improved the intestinal and reproductive tract flora imbalance after chemotherapy, enhanced the effect of chemotherapy and alleviated side effects.
Patent Information
- Application Number
- CN202510273830.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-10
- Publication Date
- 2025-11-04
- Estimated Expiration
- 2045-03-10
AI Technical Summary
Chemotherapy drugs severely damage the intestinal mucosa, leading to intestinal flora imbalance and reproductive tract flora disorder, which affects the efficacy of chemotherapy and causes serious side effects.
A dual-cavity probiotic intervention was employed, consisting of Bifidobacterium longum subsp. longum NCU-05 administered via the intestine and Lactobacillus curvature NCU-28 administered via the vagina, in combination to improve intestinal and reproductive tract flora imbalance following chemotherapy for colon cancer.
It improves the imbalance of gut and reproductive tract flora after chemotherapy, enhances the effect of chemotherapy, and alleviates the gastrointestinal and reproductive tract side effects caused by chemotherapy.
Smart Images

Figure CN120173794B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of biological medicine, and particularly relates to application of double-cavity probiotic intervention in chemotherapy of colon cancer and intestinal and genital tract flora. BACKGROUND
[0002] Colon cancer refers to a malignant lesion of the colorectal mucosal epithelium or gland caused by various carcinogenic factors such as environment or heredity. Statistical data shows that colon cancer is one of the most common digestive tract malignant tumors in the world, and its incidence rate ranks third in the world, only next to gastric cancer and lung cancer. In China, with the improvement of national living standards, the change of dietary structure and habits, and the increasing food safety hazards, the incidence rate of colon cancer shows a trend of increasing year by year and younger age, and the median age of onset is ten years earlier than that in Europe and the United States. Colon cancer has insidious onset and often has no obvious early clinical manifestations. Most patients are in the middle and advanced stages when diagnosed clinically, and have distant metastasis, which seriously endangers the life and health of patients. The recognized method for treating colon cancer is a comprehensive treatment with surgery as the main method and supplemented by chemotherapy, immunotherapy, traditional Chinese medicine and other supportive treatments. Except for some early-stage patients, patients in the advanced stage and after surgical resection need to receive chemotherapy. Chemotherapy is an important treatment measure in the comprehensive treatment of colon cancer after surgical treatment. 5-fluorouracil is a clinically recognized effective first-line drug for colorectal cancer chemotherapy, which belongs to antimetabolites. Its main mechanism of action is to be converted into active metabolite deoxyribose fluorouracil nucleoside (FdUMP) in the body through the action of related metabolic enzymes, which reduces the free TS, so that deoxyguanosine acid (dUMP) cannot generate deoxythymidine acid (dTMP), resulting in reduced DNA synthesis.
[0003] Chemotherapy plays an irreplaceable important role in the comprehensive treatment of tumors. However, chemotherapy drugs kill not only tumor cells but also normal cells that divide rapidly, such as intestinal epithelial cells and immune cells, which are also destroyed in large quantities, causing intestinal mucosal damage, manifested as symptoms such as nausea, vomiting, abdominal pain and diarrhea, and even necrotizing enterocolitis, bloody stool, shock, electrolyte imbalance and other life-threatening conditions. The damage of chemotherapy drugs to the intestinal mucosa seriously limits their clinical application, which is mainly reflected in the destruction of intestinal barrier function. For example, 5-FU can directly kill normal bacteria in the intestinal lumen, significantly reducing the number of main probiotics bifidobacterium, and significantly increasing the number of enterobacter and enterococcus. This makes the number of facultative anaerobes in the large intestine increase, the number of normal flora decrease, the antagonistic ability of colonization weaken, and intestinal bacteria can be detected in the draining mesenteric lymph nodes. SUMMARY
[0004] The application aims to at least solve one of the technical problems in the prior art, and provides application of double-cavity probiotic intervention in chemotherapy of colon cancer and intestinal and reproductive tract flora.
[0005] The first aspect of the application provides application of double-cavity probiotic intervention in chemotherapy of colon cancer and intestinal and reproductive tract flora, wherein the double-cavity probiotic comprises Bifidobacterium longum subsp. Bifidobacterium longum subsp . longum NCU-05 and Lactobacillus crispatus (L. Lactobacillus crispatus ) NCU-28; wherein the Bifidobacterium longum subsp. NCU-05 has been preserved in the China General Microbiological Culture Collection Center on January 18, 2023, with a preservation number of CGMCC NO. 26492; and the Lactobacillus crispatus NCU-28 has been preserved in the China General Microbiological Culture Collection Center on July 22, 2024, with a preservation number of CGMCC NO. 31387.
[0006] The second aspect of the application provides the above-mentioned application of double-cavity probiotic intervention in chemotherapy of colon cancer and intestinal and reproductive tract flora, wherein the Bifidobacterium longum subsp. NCU-05 is administered through the intestinal tract, and the Lactobacillus crispatus NCU-28 is administered through the vagina. Preferably, the application comprises preparing a combination drug for improving intestinal and reproductive tract flora imbalance after chemotherapy of colon cancer by taking the Bifidobacterium longum subsp.
[0007] NCU-05 and the Lactobacillus crispatus NCU-28 as active ingredients. The third aspect of the application provides a biological agent, comprising a biological agent A and a biological agent B, wherein the active ingredient of the biological agent A comprises the Bifidobacterium longum subsp.
[0008] NCU-05, and the active ingredient of the biological agent B comprises the Lactobacillus crispatus NCU-28. The biological agent A is administered through the intestinal tract, and the biological agent B is administered through the vagina. The fourth aspect of the application provides an auxiliary drug for treatment of colon cancer, comprising an auxiliary drug A and an auxiliary drug B, wherein the active ingredient of the auxiliary drug A comprises the Bifidobacterium longum subsp.
[0009] NCU-05, and the active ingredient of the auxiliary drug B comprises the Lactobacillus crispatus NCU-28. The auxiliary drug further comprises a drug carrier and / or a pharmaceutical excipient; the drug carrier and / or the pharmaceutical excipient is at least one of water, lactose, sodium chloride and glucose; and the dosage form of the auxiliary drug is powder, granules, capsules or tablets.The present application has at least one of the following beneficial effects: the present application provides a double-cavity probiotic bacteria, including Bifidobacterium longum subsp. longum NCU-05 and Lactobacillus crispatus NCU-28, which can improve intestinal and reproductive tract flora imbalance after chemotherapy of colon cancer, and the present application also provides a combination of Bifidobacterium longum subsp. longum and Lactobacillus crispatus for use in the preparation of biological agents and adjuvant drugs for improving intestinal and reproductive tract flora imbalance after chemotherapy of colon cancer, according to the experimental data of the present application, Bifidobacterium longum subsp. longum and Lactobacillus crispatus can effectively improve intestinal and reproductive tract flora imbalance after chemotherapy of colon cancer through "intestinal-vaginal microbial population bidirectional crosstalk" cavity administration. BRIEF DESCRIPTION OF DRAWINGS
[0010] Figure 1 For in vitro probiotic property determination, (A) growth curve of NCU-05; (B) antioxidant capacity evaluation of NCU-05; (C, D) acid tolerance of NCU-05; (E, F) bile salt tolerance of NCU-05; (G) cell adhesion experiment of NCU-05 (1000x); (H, I) inhibitory effect of NCU-05 on intestinal pathogenic bacteria; (J) growth curve of NCU-28; (K) antioxidant capacity of NCU-28; (L, M) acid tolerance of NCU-28; (N) cell adhesion experiment of NCU-28 (1000x); (O) inhibitory effect of NCU-28 on vaginal pathogenic bacteria;
[0011] Figure 2 Oral NCU-05 enhances the anti-cancer effect of 5-FU. (A) Schematic diagram of animal experiment process (B) Change of mouse body weight during experiment process (C) Representative morphology of mouse colon (D) Colon tumor count (E) Representative histological image of mouse colon tissue by H&E staining (200x) (F) Protein expression related to p53-induced apoptosis signaling pathway in tumor tissue (G-I) Relative expression of p-p53, Bax, Bcl-2 and Cleaved Caspase-3;
[0012] Figure 3To evaluate the effect of NCU-05 on 5-FU-induced CINV and CIM in mice. (A) The amount of kaolin intake in each group of mice (B) Representative immunohistochemical staining of Fos protein in the AP region of the brain of mice (400x), (C, D) The expression of 5-HT and SP in the colon tissue was detected by ELISA (E, F) The expression of 5-HT and SP in the brain tissue was detected by ELISA (G, H) The expression of 5-HT3R and NK-1R in the brain tissue was detected by RT-qPCR (I) The length of the colon of mice (J) The disease activity index score (K-M) The expression of TNF-α, IL-1β and IL-4 in the colon tissue was detected by ELISA (N) The protein expression of NF-κB signaling pathway in the intestinal tissue was detected by WB (O-Q) The relative expression of TLR4, MyD88, p-p65 and p65 (R) The expression of MUC-2 and ZO-1 protein was detected by immunohistochemistry (200x);
[0013] Figure 4 To evaluate the effect of NCU-05 on 5-FU-induced intestinal flora imbalance. (A) Simpson index, (B) Pielou_e analysis, (C) Chao 1 index, (D) PCoA analysis chart, (E) Venn diagram, (F) Tenericutes. (G) Bacteroidetes. (H) Actinobacteria. (I) Oscillospira . (J) Ruminnococcus . (K) Turicibacter ;
[0014] Figure 5 To evaluate the effect of NCU-05 on 5-FU-induced intestinal flora imbalance. (A) Simpson index, (B) Pielou_e analysis, (C) Chao 1 index, (D) PCoA analysis chart, (E) Venn diagram, (F) Tenericutes. (G) Bacteroidetes. (H) Actinobacteria. (I) Aggregatibacter (K) Corynebacterium (L) Lactobacillus (M) Adlercreutzia (N) HE staining of the vaginal tissue of mice and observation of the expression of Cleaved-Caspase 3 by immunohistochemistry (200x);
[0015] Figure 6The "entero-vaginal" probiotic administration synergizes with 5-FU to exert anticancer effects. (A) Schematic diagram of animal experiment. (B) The body weight of mice over time. (C) Representative morphology of mouse colon. (D) The number of colon tumors in mice. (E) Representative images of H&E-stained colon histology (200x). (F) Expression of proteins related to p53-induced apoptosis signaling pathway in tumor tissue. (G-I) Relative expression of p-p53, Bax, Bcl-2, Cleaved Caspase-3;
[0016] Figure 7 The "entero-vaginal" probiotic administration effectively alleviates chemotherapy-induced gastrointestinal side effects. (A) The amount of kaolin ingested by mice (B) Representative immunohistochemical staining of Fos protein in the AP region of the mouse brain (400x) (C, D) 5-HT expression in colon and brain tissues was detected by ELISA (E) RT-qPCR was used to detect the expression of 5-HT3R in brain tissue (F) Colon length (G) Disease activity index score of mice in each group (H, I) TNF-a and IL-4 expression in colon tissue was detected by ELISA (J) WB was used to detect the protein expression of NF-kB signaling pathway in intestinal tissue (K) Expression of MUC-2 and ZO-1 proteins was observed by immunohistochemistry (200x) (L-P) Lactobacillus , Clostridium , Bacteroides , Enterococcus and Enterobacter relative abundance;
[0017] Figure 8 The "entero-vaginal" probiotic administration effectively alleviates chemotherapy-induced vaginal side effects. (A) HE staining of mouse vaginal tissue (200x) (B-D) Expression of TNF-a, IL-1b, and IL-4 in vaginal tissue was detected by ELISA (E-H) WB analysis of TLR4, MyD88, p-p65, and p65 in vaginal tissue (I, J) WB analysis of Bax and Bcl-2 in vaginal tissue (K) Immunohistochemical analysis of Cleaved Caspase-3
[0018] Figure 9 The "entero-vaginal" probiotic administration has a synergistic effect on improving 5-FU-induced vaginal flora disorder. (A) Shannon index (B) Pielou_e index (C) PCoA analysis (D) Venn diagram (E) Relative abundance of bacteria at the phylum level (F) Proteobacteria (G) Firmicutes (H) Relative abundance of bacteria at the genus level (I) Aggregatibacter . (J) Acinetobacter(K) Enhydrobacter (L) Methyloversatilis ;
[0019] Figure 10 is a schematic diagram of the mechanism;
[0020] Figure 11 is the abundance of Bifidobacterium at different time points during the intervention. (A) The abundance of Bifidobacterium the day before the intervention. (B) The abundance of Bifidobacterium on the 11th day of the intervention. (C) The abundance of Bifidobacterium after the intervention;
[0021] Figure 12 is the abundance of Bifidobacterium or Lactobacillus at different time points during the intervention assessed by q-PCR. (A-C) The abundance of Bifidobacterium in the feces of mice was measured the day before the intervention, on the 11th day of the intervention, and after the completion of the intervention. (D-F) The abundance of Lactobacillus in the vaginal secretion of mice was measured the day before the intervention, on the 11th day of the intervention, and after the completion of the intervention;
[0022] Figure 13 is the administration of "gut-vaginal" probiotics to alleviate gastrointestinal side effects caused by chemotherapy. (A, B) The expression of SP in colon and brain tissues was detected by ELISA (C) The expression of NK-1R in brain tissues was detected by RT-qPCR (D) The expression of IL-1β in colon tissues was detected by ELISA (E-G) The relative expression amounts of TLR4, MyD88, p-p65, and p65 in colon tissues;
[0023] * p < 0.05, ** p < 0.01 in the above figures. DETAILED DESCRIPTION
[0024] Example 1: Screening of Bifidobacterium longum subsp. longum NCU-05 (hereinafter referred to as NCU-05) and Lactobacillus crispatus NCU-28 (hereinafter referred to as NCU-28) and determination of in vitro probiotic properties
[0025] I. Screening: NCU-05 is an oral probiotic isolated from infant feces, and NCU-28 is a vaginal probiotic isolated from the vaginal secretion of a healthy woman. Fresh feces collected from infants and vaginal secretion collected from healthy women were stored in sterile centrifuge tubes containing 50% glycerol, and then plated for dilution and coating immediately;
[0026] After sequencing, the sequence of NCU-05 is shown as SEQ ID No: 1; and the sequence of NCU-28 is shown as SEQ ID No: 2.
[0027] II. Acid and bile salt resistance experiment: 1) NCU-05 was placed in an anaerobic incubator with MRS liquid medium at 37°C for 36-72 h; NCU-28 was placed in an incubator at 37°C for 36-72 h; 100 μL was taken out and diluted 10 times with PBS buffer, centrifuged at 4,000 rpm for 3 min, and the supernatant was discarded; pH=3, 4, 5, and 7 PBS buffer was added, and after 4 h, 10 μL was taken and plated, and incubated in a 37°C incubator or an anaerobic incubator for 36-72 h, and viable cell count was performed; 2) The medium containing 0.0%-0.3% bovine bile salt was incubated at 37°C for 12-48 h, mixed, 10 μL was taken and plated, and incubated in a 37°C incubator or an anaerobic incubator for 36-48 h, and viable cell count was performed. 1 3 5
[0028] III. Antioxidant experiment: 1) DPPH radical scavenging capacity determination: 2 mL of bacterial culture supernatant was added to 2 mL (0.2 mmol / L) DPPH methanol solution, and reacted in the dark at room temperature for 30 min. The OD was measured at 517 nm, and the control was 2 mL deionized water plus DPPH methanol solution: DPPH radical scavenging rate = [1-A517(sample) / A517(blank)] x 100%. 2) Hydroxyl radical scavenging capacity determination: 1 mL of 2 mmol / L FeSO4 solution, 21 mL of 6 mmol / L H2O2, and 1 mL of 6 mmol / L salicylic acid were taken, 1 mL of bacterial culture supernatant was added, and it was left to stand at room temperature for 30 min. Deionized water was used as a blank control, and the absorbance at 510 nm was measured to calculate the hydroxyl radical scavenging rate: hydroxyl radical scavenging rate = [1-A510(sample) / A510(blank)] x 100%. 3) Superoxide radical scavenging capacity determination: 2 mL of 150 mmol / L pH=8.0 Tris-Hcl solution, 1 mL of 1.2 mmol / L pyrogallol solution were added in sequence to 0.5 mL of bacterial culture solution, and reacted at room temperature for 30 min. The absorbance at 330 nm was measured: superoxide radical scavenging rate = [1-(A11-A10) / (A01-A00) x 100%; A00: no sample and pyrogallol; A01: no sample with pyrogallol; A10: with sample without pyrogallol; A11: with sample and pyrogallol; 4) Fe 2+ Determination of chelating ability of Fe2+ : 0.5 mL sample solution was added with 0.1 mL of 0.4% ferrous sulfate solution, mixed well, then 1 mL of 1% VC and 0.2 mol / L NaOH solution was added, reacted at room temperature for 20 min, then 10% trichloroacetic acid was added, centrifuged at 6,000 rpm for 10 min at 4°C to remove protein, 0.4 mL of the above solution was taken and 4 mL of 0.1% o-diazenophenol was added, reacted at room temperature for 10 min, and the absorbance at 536 nm was determined. 2+ Chelating ability of Fe2+ = [Ablank-A sample / Ablank] x 100%. 5) Determination of total reducing power: 1 mL of bacterial culture solution was taken, 1 mL of phosphate buffer (pH 6.6) and 1 mL of 1% K3[Fe(CN)6] solution were added, mixed well, incubated in a thermostat at 50°C for 2 min, 1 mL of 10% trichloroacetic acid solution was added, mixed well, 1 mL of the mixed solution was taken, 4 mL of deionized water and 0.4 mL of 0.1% FeCl3 solution were added, and stood for 10 min. Deionized water was used as blank, and the absorbance at 700 nm was determined.
[0029] Four, antibacterial test: NCU-05: (1) NCU-05 was inoculated in MRS liquid medium, cultured at 37°C in an anaerobic incubator for 36-72 h, centrifuged at 6,000 g for 5 min; (2) the supernatant of the culture was coated on LB solid medium. Oxford cups were gently placed on the plate, 250 μl of the supernatant of the culture of probiotics was taken into the Oxford cups (three replicates were made for each group), and incubated at 37°C, the size of the antibacterial ring was observed every 2 h, and the diameter of the antibacterial ring was measured after 8 h. C. albicans, Sh. flexneri, L. monocytogenes, S. haemolytic-β, S. aureus, E. coli, S. typhimurium enteritidis and S. C. albicans, E.faecalis, S. haemolytic-β, G. Coated on LB solid medium. Subsequently, NCU-05.
[0030] NCU-28: (1) NCU-28 was inoculated in MRS liquid medium, cultured at 37°C in a carbon dioxide incubator for 24-48 h, centrifuged at 6,000 g for 5 min; (2) the supernatant of the culture was coated on LB solid medium. Subsequently, NCU-05. vaginalis, S. aureus, E. coli and Figure 1 Coated on LB solid medium. Subsequently, NCU-05.
[0031] Five, cell adhesion experiment: NCU-05: (1) NCU-05 was inoculated in MRS liquid medium, and cultured in an anaerobic incubator at 37°C, and the culture was terminated after the OD value was equal to 0.6; (2) the HT-29 cell culture plate with a coverage rate of 30% on the cover glass was washed once with sterile PBS buffer, 1 mL of the above bacterial culture was mixed with 1 mL of HT-29 cell culture solution containing a small amount of bacteria, and then added to a six-well plate, which was cultured in a 37°C cell incubator; (3) after 1-1.5 hours of culture, the six-well cell culture plate was taken out, the culture solution was aspirated, and the PBS buffer was repeatedly washed 5 times, methanol was fixed, gram staining was performed, and oil immersion observation was performed. NCU-28: (1) NCU-28 was inoculated in MRS liquid medium, and cultured in a carbon dioxide incubator at 37°C, and the culture was terminated after the OD value was equal to 0.6; (2) the VK2 / E6E7 (human vaginal epithelial cells) culture plate with a coverage rate of 30% on the cover glass was washed once with sterile PBS buffer, 1 mL of the above bacterial culture was mixed with 1 mL of VK2 / E6E7 (human vaginal epithelial cells) culture solution containing a small amount of bacteria, and then added to a six-well plate, which was cultured in a 37°C cell incubator; (3) same as NCU-05.
[0032] The determination results are shown in Figure 1 , NCU-05 reached the plateau after 30 hours, and the OD600nm value was about 2.2 ( Figure 1 A). The antioxidant test showed that the clearance rates of DPPH, hydroxyl radical (-OH) and superoxide radical (O2-) were 80.39%, 68.06% and 84.50%, respectively. The chelation of divalent iron ion (Fe 2+ ) was 76.46%, and the total reducing power OD700nm value was 0.94 ( Figure 1 B). At the same time, NCU-05 could tolerate a moderate acidic environment and could survive in different concentrations of bile salt solution, and could maintain 2×10 7 CFU / mL of viable bacteria at pH 3.0, and 3×10 7 CFU / mL at 0.3% bile salt concentration ( Figure 1 C-F). In addition, NCU-05 also showed good adhesion ability, which could effectively adhere to HT-29 human colon cancer cells ( C. albicans, Sh. flexneri, L. monocytogenes, S. haemolytic-β, S. aureus, E. coli, S. typhimurium G), and had inhibitory effect on common intestinal pathogenic bacteria, including S. enteritidis Figure 1 and Figure 1 , and the inhibition zone diameters were 27.7 mm, 25 mm, 28 mm, 23.3 mm, 31 mm, 24 mm, 19 mm and 26.3 mm, respectively ( Figure 1 H-I).
[0033] Vaginal probiotic NCU-28 reached a plateau after 20 hours, with an OD600nm value of about 2.0 Figure 1 J). The scavenging rates of NCU-28 on DPPH, -OH and O2- were 61.39%, 83.57% and 77.54%, respectively, and the Fe 2+ chelating rate was 71.45%, and the total reducing power OD700nm value was 0.81 Figure 1 K). Notably, NCU-28 showed the highest viable cell count at pH 5.0, reaching 7.3 x 10 9 CFU / mL C. albicans, E.faecalis, L, M). Adhesion experiments showed that NCU-28 had strong adhesion to VK2 / E6E7 human vaginal epithelial cells S. haemolytic-β, G. vaginalis, S. aureus, N). The antibacterial experiment results showed that the inhibition zone diameters of NCU-28 on vaginal pathogenic bacteria E. coli Figure 1 and Figure 2 were 26 mm, 20.3 mm, 24 mm, 20 mm, 25 mm, and 21.6 mm, respectively Figures 2-5 O). The above results showed that both NCU-05 and NCU-28 had ideal probiotic properties and could be used for subsequent experiments.
[0034] Example 2: Effect of gavage of NCU-05 on chemotherapy of colon cancer mice and intestinal and reproductive tract flora
[0035] I. Mouse colorectal cancer modeling: As shown in Figure 2 A, the AOM / DSS induction method was used in four steps: a single dose of AOM (7.5-12.5 mg / kg) was injected intraperitoneally, and 7 days later, 2.5% DSS drinking water was fed, followed by normal drinking water, for a total of three cycles. The success criteria for the model were: a body weight decrease of more than 20%, a fecal occult blood score of 3 points or more, and pathological verification. At the beginning of DSS II, two mice from each group were randomly selected and sacrificed under anesthesia, and the colon was dissected to observe tumor growth, to further determine the success of the modeling.
[0036] II. Animal grouping: 60 C57BL / 6 female mice (SPF level, 8 weeks old, body weight 20-22 g) were randomly divided into different groups, with 12 mice per cage. (1) Blank control group (N=12, divided into two cages). (2) Colon cancer group (N=12, divided into two cages): AOM / DSS induced tumor model. (3) Colon cancer + gavage probiotic group (N=12, divided into two cages): Based on tumor treatment, 1 x 10 9CFU / 100µl NCU-05 21 days. (4) Colon cancer + FU group (N=12, divided into two cages): on the basis of tumor treatment, intraperitoneal injection of 5-FU 100 μl (25 mg / kg, prepared with normal saline, present preparation present use, once every 3 days, a total of 21 days). (5) Colon cancer + FU + gavage probiotics group (N=12, divided into two cages): on the basis of tumor treatment, intraperitoneal injection of 5-FU 100 μl (25 mg / kg, prepared with normal saline, present preparation present use, once every 3 days, a total of 21 days). 1x10 9 CFU / 100µl NCU-05 21 days.
[0037] III. Materials and Methods: 1. Mouse tissue sampling: (1) Feces and vaginal secretions: after treatment, the feces of mice in each group were collected and sent to Pasona for 16S rDNA sequencing. (2) Tissue: the colon, rectum, brain and vaginal tissues of the euthanized mice were removed and washed with sterilized normal saline. Part of it was fixed with 4% paraformaldehyde for histological analysis, and the rest was stored in a-80°C refrigerator.
[0038] 2. Kaolin experiment: pharmaceutical grade kaolin (hydrated aluminum silicate) was mixed with 3% (w / w) gum arabic with distilled water to make food-sized particles, which were completely dried at room temperature. 100 g of normal feed and kaolin were weighed, and each group of mice was allowed to freely ingest under constant temperature and normal light. The 24-hour kaolin intake of mice after drug intervention was recorded at regular intervals. The degree of nausea and vomiting was evaluated according to the kaolin intake of each group of mice.
[0039] 3. Disease activity index score: The feces of each group of mice were collected and observed for the degree of softness and occult blood, and scored. According to the scoring criteria of Cooper HS et al: DAI=(body weight loss score+stool character score+blood in stool score): (i) stool consistency (0=normal; 2=loose; 4=diarrhea); (ii) blood in stool (0=normal; 2=occult blood positive; 4=macroscopic blood stool); (iii) animal body weight (0=body weight loss less than 1%; 1=body weight loss 1 to 5%; 2=body weight loss 6 to 10%; 3=body weight loss 11 to 15%; 4=body weight loss>16%).
[0040] 4. HE staining analysis of lesion infiltration: part of the tumor specimens were cut thin, with a thickness of less than 5 mm, and fixed with 4% formaldehyde solution and embedded in paraffin; the tumor tissue fixed with 4% paraformaldehyde solution was taken out, paraffin-embedded, and 5 μm sections were cut; after pathological staining, the sections were mounted and observed under a microscope for cell structure, size, nuclear-cytoplasmic ratio, atypia, malignancy, and infiltration.
[0041] 5. Immunohistochemistry (IHC): 1) Dehydration and paraffin embedding: the same as H&E staining; 2) Sectioning: cut the fixed sample into thin (4-6 pm) tissue sections; 3) Antigen retrieval: place the slide in a dish containing antigen retrieval solution and boil (10 min), after cooling to room temperature, wash twice with PBS buffer; 4) Block endogenous peroxidase: incubate with 3% H2O2 aqueous solution in the dark for 8 min, rinse with PBS buffer 2 times; 5) Serum blocking: add 5% calf serum, incubate at room temperature for 30 min; 6) Antibody labeling: prepare the primary antibody according to the antibody instructions and select the corresponding secondary antibody. Incubate the primary antibody overnight at 4°C (avoid light), incubate the secondary antibody at room temperature for 40 min; 7) Antibody staining: add DAB working solution and incubate in the dark for 8 min, rinse with ddH2O to stop the reaction, then add hematoxylin for 30 s, rinse with ddH2O for 8 min; 8) Microscopic analysis: observe and record the expression of target protein under microscope.
[0042] 6. Extraction of tissue RNA and RT-qPCR: 1) Tissue disruption: weigh 0.1 g of tissue into an EP tube, add Trizol reagent and RNase inhibitor; disrupt the tissue for 30 s, interval 10 s, repeat 3 times; 2) Solution extraction: let the disrupted sample stand for 8 min, transfer the supernatant to a new RNase-free EP tube, add an equal volume of phenol / chloroform mixture, shake well for 30 s, then stand for 5 min, then centrifuge at low temperature 12000 rpm for 10 min, transfer the supernatant to a new centrifuge tube; 3) Alcohol precipitation: add an equal volume of isopropanol to the supernatant, mix and stand for 10 min to precipitate the RNA; 4) RNA washing: wash the RNA precipitate with 70% ethanol to remove impurities; 5) RNA quality detection: after drying, add 40 pL of nuclease-free water to dissolve the RNA, mix well and measure the concentration with a spectrophotometer.
[0043] 7. Reverse transcription of RNA and RT-qPCR: 1) Take 0.1 g of tissue in 1 mL of TRIzol lysis solution, crush homogenate on ice, centrifuge at 5000 rpm for 10 min at 4°C, and take the supernatant. 2) Add chloroform at a ratio of 200 μL of chloroform per 1 mL of TRIzol, shake vigorously, and incubate at room temperature for 3 min, centrifuge at 13000 rpm for 15 min at 4°C, and take the upper aqueous phase. 3) Add 600 μL of isopropanol to every 400 μL of aqueous phase, mix well by inverting, incubate at room temperature for 10 min, centrifuge at 13000 rpm for 15 min at 4°C, and retain the precipitate. 4) Add 1 mL of 75% ethanol to the precipitate, centrifuge at 13000 rpm for 10 min at 4°C. 5) After removing the supernatant, dry at room temperature for 15-30 min, add DEPC water, dissolve in a water bath at 65°C, and then determine the concentration. 6) Genomic DNA removal reaction: x gDNA Eraser Buffer 2.0 μL, gDNA Eraser 1.0 μL, Total RNA 1.0 μg, RNase-free ddH2O up to 10.0 μL, 2°C water bath for 2 min, and 4°C storage. 2) Reverse transcription reaction: experimental liquid after DNA removal system reaction 10.0 μL, 5x PrimeScript Buffer 2 4.0 μL, PrimeScript RT Enzyme Mix I 1.0 μL, RT Primer Mix 1.0 μL, RNase-free ddH2O 4.0 μL; PCR program: 37°C for 15 min; 85°C for 5 s; 4°C storage. 3) q-PCR reaction: Hieff UNICON® Universal Blue qPCR SYBR Green Master Mix 10.0 μL, Forward Primer (10 μM) 0.4 μL, Reverse Primer (10 μM) 0.4 μL, template DNA 2 μL, sterile ultrapure water 7.2 μL; PCR program: 95°C for 2 min; 95°C for 10 s, 60°C for 30 s, cycle 40 times; 95°C for 15 s; 60°C for 1 min; 95°C for 15 s. 4) Specific sequences: 5-HT3R: GCTATCCTCCATCCGCCACTTC (forward), CGAGCACAGCCAGCAGGTAG (reverse); NK-1R: GTGCAACCTACCTGGCAAAT (forward), ACCAGCAGAGGCAGGAAGTA (reverse); GAPDH: CTCGTGGAGTCTACTGGTGT (forward), GTCATCATACTTGGCAGGTT (reverse).
[0044] 8. Western-blot: 1) Gel preparation: After the completion of the hole picking, the appropriate concentration of the separation gel was prepared according to the molecular weight of the target protein, and the comb was inserted after the addition of the concentrated gel. Wait for solidification; 2) Sample loading: After the protein sample was fully mixed, it was added to the gel well, and the electrophoresis liquid was added to the electrophoresis tank. First set the constant voltage 80 V electrophoresis for 20 min, and then set the voltage to 180 V electrophoresis for 1 h; 3) Membrane transfer: After the electrophoresis was completed, the target protein band area was reserved, and the PVDF excited in advance with methanol was placed on the target fragment. Set the constant current 260 mA, 80 min; 4) Blocking: Prepare 5% skimmed milk, incubate at room temperature for 1 h; 5) Antibody incubation: Incubate the primary antibody with the target band in the refrigerator at 4°C overnight. Wash the membrane 3 times with 1xTBST. According to the selection of the primary antibody, the corresponding secondary antibody is incubated at room temperature for 1 h, and the membrane is washed 3 times; 6) Development: Prepare the exposure solution and expose.
[0045] 9. ELISA: 1) According to the kit instructions, prepare the antibody, washing solution and standard; 2) According to the arrangement order of the blank hole, standard and sample hole, add the sample in turn, the sample amount is 100 μL, incubate at 37°C for 1 h, add 300 μL washing solution to wash the plate and dry, cycle 5 times; 3) Dilute the antibody with antibody diluent, add 100 μL per well, incubate at 4°C for 1 h, add 300 μL washing solution to wash the plate 5 times and dry, cycle 5 times; 4) Add 60 μL of color developing solution to each well, and incubate at 37°C for 30 min; 5) Add stop solution to each well, and use the enzyme labeler to read.
[0046] 10. qPCR: Verify the difference of flora in each group of mice: (1) Feces: Select common flora in the intestine to verify the difference by qPCR. Use Gene Bank database to compare the representativeness and specificity of different primers, select primers with strong specificity and maximum coverage of corresponding bacteria, synthesized by relevant companies, 16s Bifidobacterium Lactobacillus: ACTCCTACGGGAGGCAGCAGTTCGCGTC(C / T)GGTGTGAAAGCACCGCTACACATGGAG (forward), TATTACCGCGGCTGCTGGCCCACATCCAGC(A / G)TCCACAGCAGTAGGGAATCTTCCA (reverse); Clostridium Bacteroides Enterococcus Enterobacter: GCACAAGCAGTGGAGTGGTGTCGGCTTAAGTGCCATCATGACGTTACCCGCAGAAGAAGATCAGATGTGCCCAGATGG (forward), CTTCCTCCGTTTTGTCAACGGACTGTAAGGGCCGTGCCTCTACGAGACTCAAGCTTGCCCGTGTCTCAGTTCCAGTG (reverse). Total intestinal flora represents all intestinal flora, and the primer corresponds to the conserved sequence shared by different species and genera of bacteria. According to the NCBI Primer-Blast comparison results, this primer can bind to almost all known 16S rRNA sequence of intestinal flora target sequence, real-time detection and quantitative amplification.
[0047] 11. High-throughput sequencing analysis: Before the end of the experiment, collect fecal samples from each group of mice, respectively, into sterile EP tubes, and quickly freeze with liquid nitrogen and store in a -80°C refrigerator. According to the guidelines of the Genomic DNA Extraction Kit, extract DNA from the collected mouse fecal samples, and send to Shanghai Pisennuo Company for 16S rDNA high-throughput sequencing analysis. Use universal primers (515F: 5'-GTG CCA GCMGCC GCG GTAA-3'; 806R: 5'-GGACTA CVSGGG TAT CTAAT-3') to amplify the target fragment of 16S rRNA V4 region. Use QIIME software to analyze the effective sequencing data, including alpha diversity, beta diversity, inter-group difference, and use SIMCA-P software to identify, cluster analysis and partial least squares discriminant analysis of different abundant taxonomic units.
[0048] The above determination results are as follows: Figure 11As shown. To evaluate the effect of oral NCU-05 on the anticancer effect of 5-FU, a colorectal cancer mouse model was established using AOM / DSS (as shown). Figure 2 A). The level of Bifidobacteria in mouse feces was monitored by q-PCR, and samples were collected before, during, and after the intervention. At the end of the intervention, the abundance of Bifidobacteria in the feces of mice in the NCU-05 gavage group was significantly higher than that in the non-gavage group ( Figure 2 AC). Oral administration of NCU-05 improved weight loss in MF mice (p<0.05). Figure 2 B). Compared with the MF group, the number of colon tumors in the MFB group mice was significantly reduced (p<0.05). Figure 2 C, D). Compared with group M, the tumor area in mice in group MFB was significantly reduced, histological damage was alleviated, and its therapeutic effect was significantly better than that of group M treated with 5-FU alone. Figure 2 E). The MFB group significantly enhanced the phosphorylation level of p53 in tumor tissue, thereby promoting the repair of chemotherapy-induced DNA damage, with a more significant effect than the MF group (p<0.05). Figure 3 F, G). When DNA damage cannot be repaired, P53 further initiates the apoptosis program. The Bax / Bcl-2 ratio in the MFB group was significantly higher than that in the MF group (p<0.01), and the expression of Cleaved Caspase-3 was also significantly upregulated (p<0.01). Figure 3 These results indicate that oral administration of NCU-05 helps enhance the apoptotic effect of 5-FU on colon cancer cells.
[0049] Common gastrointestinal side effects of chemotherapy include nausea, vomiting, and enteritis. Firstly, to verify the efficacy of NCU-05 in treating chemotherapy-induced nausea and vomiting (CINV), a kaolin test was conducted. Figure 3 A). The experimental results showed that the kaolin intake in the MFB group on day 1 was significantly lower than that in the MF group (MF vs. MFB = 3.45% vs. 2.93%, p<0.05) (Fig. 3A). Figure 3 A). Immunohistochemical analysis showed that, compared with the MF group, the expression of FOS protein in the postmedullary (AP) neurons of the MFB group was reduced. Figure 3 B). ELISA results showed that the level of serotonin (5-HT) in the colon tissue of the MF group was significantly increased (C vs. MF = 25.59 vs. 74.05, p<0.01), while the MFB group showed downregulation of 5-HT expression (MF vs. MFB = 74.05 vs. 48.23, p<0.01). Figure 3C). Similarly, the expression of Substance P (SP) followed the same trend as 5-HT (MF vs MFB = 128.60 vs 112.55, p<0.05) ( Figure 3 D). The bidirectional interaction of the gut-brain axis (GBA) in CINV was further investigated. ELISA results showed that the levels of 5-HT in the brain tissue of MFB group mice were significantly downregulated (MF vs. MFB = 101.04 vs. 86.84, p<0.05) ( Figure 3 E). Meanwhile, the expression of SP was also significantly downregulated in the MFB group (MF vs. MFB = 168.22 vs. 153.56, p<0.01) ( Figure 3 F). Compared with the control group, the transcriptional levels of 5-HT3R and NK-1R receptors in the brain tissue of chemotherapy-treated mice were significantly increased (p<0.01). However, this trend was reversed after oral administration of NCU-05 ( Figure 3 G, H). These data suggest that NCU-05 relieves CINV by regulating the expression of related neurotransmitters through the gut-brain axis.
[0050] To investigate the therapeutic effect of oral NCU-05 on chemotherapy-induced intestinal mucositis (CIM), the present study observed that oral NCU-05 significantly increased the colon length of chemotherapy mice (MF vs. MFB = 5.25 vs. 6.92, p<0.01) ( Figure 3 I). The disease activity index (DAI) was further evaluated, and the results showed that the score of the MF group was the highest, while the intervention of NCU-05 effectively alleviated the pathological score (p<0.01) ( Figure 3 J). The expression of inflammatory factors in colorectal tissue was detected by ELISA. Compared with group C, the levels of tumor necrosis factor alpha (TNF-α) and interleukin-1 beta (IL-1β) were significantly upregulated, while the level of interleukin-4 (IL-4) was significantly downregulated (p<0.01), and the MFB group reversed this trend (p<0.01) ( Figure 3 K-M). Western blot results showed that the NF-κB pathway in the intestinal tissue of MF group mice was activated ( Figure 4 N). In the MB and MFB groups, the protein levels of TLR4, MyD88, and p-p65 were significantly reduced, indicating that NCU-05 had an inhibitory effect on inflammation ( Figure 4 O-Q). Immunohistochemical analysis showed that the expression of MUC-2 and ZO-1 proteins in the colon tissue of the MF group was reduced, while the MFB group showed an increase in the expression of these two proteins ( Figure 4These results indicate that oral administration of NCU-05 can significantly alleviate chemotherapy-induced intestinal inflammation and improve chemotherapy-induced intestinal damage by inhibiting inflammatory responses, regulating cytokine expression, and enhancing intestinal barrier function.
[0051] Gut microbiota imbalance is closely associated with colorectal cancer and chemotherapy. To further analyze the effects of NCU-05 on 5-FU-induced gut microbiota imbalance, high-throughput sequencing was used to analyze the gut microbiota composition of mice. Assessments using the Simpson, Pielou_e, and Chao 1 indices revealed that α-diversity of the gut microbiota was significantly reduced in chemotherapy-treated mice (p<0.01). Figure 4 AC), while oral NCU-05 restored its α-diversity (p<0.05). Figure 4 A, B). Principal coordinate analysis (PCoA) was used to analyze β-diversity. The results showed that the gut microbiota of mice in groups M and MF exhibited significantly different microbial characteristics compared to group C. However, gavage administration of NCU-05 brought the gut microbiota composition closer to that of the control group ( Oscillospira D). The Venn diagram showed that the gut microbiota of mice in groups C, M, MF, MB, and MFB shared 306 OTUs, while the number of unique OTUs in each group was 315, 181, 93, 208, and 158, respectively. Ruminococcus E). At the phylum level, compared with chemotherapy-treated mice, oral administration of NCU-05 increased the levels of Tenericutes, Bacteroidetes, and Actinobacteria in the mouse intestine. Turicibacter (FH). At the genus level, several microorganisms associated with colorectal cancer were selected for analysis. Compared with group C, group MF... Figure 4 and Figure 5 The level decreased, while Figure 5 The level increased, and this trend improved after oral administration of NCU-05. Figure 5 IK)
[0052] High-throughput sequencing was used to assess the composition of the vaginal microbiota in mice. Compared with group C, mice in group MF showed significantly lower Simpson and Chao1 indices for vaginal microbiota α-diversity, while group MFB showed improvement in α-diversity. Figure 5 A, B). Principal coordinate analysis (PCoA) showed that 5-FU chemotherapy significantly altered the vaginal microbiota in mice, causing it to deviate from a healthy state. AggregatibacterC). In addition, the Venn diagram showed that there were 34 shared OTUs among the C, M, MF, MB and MFB groups, and the number of unique OTUs for each group was 618, 538, 245, 939 and 298, respectively. Corynebacterium, Lactobacillus D). When analyzing the microbial composition at the phylum level, the abundance of Proteobacteria in the vaginal secretions of the chemotherapy mice was significantly increased (p<0.01), while the abundance of Firmicutes and Actinobacteria was significantly reduced (p<0.01) Adlercreutzia E-H). At the genus level, the abundance of Lactobacillus in the MF group was increased (p<0.01), while the abundance of Atopobium and Parvibacter was reduced (p<0.01) Figure 5 Figure 5 Figure 5 Figure 6 I-M).
[0053] HE staining results showed that the vaginal mucosa of the chemotherapy-treated mice exhibited loss of the stratum corneum, proliferation of squamous epithelial cells, and extensive inflammatory cell infiltration within the mucosa. Notably, the vaginal epithelial stratum corneum structure of the MFB group mice was partially restored, although it failed to completely reverse the vaginal damage caused by chemotherapy (Fig. 6D). Figure 12 N). Immunohistochemical analysis showed that the expression of Cleaved Caspase-3 in the vaginal tissue of the MF group mice was increased, while in the MFB group, its expression was partially down-regulated (Fig. 6E). Lactobacillus N). The above results indicate that 5-FU chemotherapy not only leads to an imbalance in the vaginal micro-ecology, but also causes damage to the vaginal epithelial tissue.
[0054] Example 3: Effect of vaginal insertion of NCU-28 and intestinal gavage of NCU-05 on chemotherapy and intestinal and reproductive tract flora in colon cancer mice
[0055] One, mouse colorectal cancer modeling: same as example 2. Two, animal grouping: (1) blank control group (N=12, divided into two cages). (2) colon cancer group (N=12, divided into two cages): AOM / DSS induced tumor model. (3) colon cancer + FU group (N=12, divided into two cages): on the basis of tumor treatment, intraperitoneal injection of 5-FU 100 μl (25 mg / kg, prepared with normal saline, present preparation present use, once every 3 days, a total of 21 days). (4) colon cancer + FU + gavage probiotics group (N=12, divided into two cages): on the basis of tumor treatment, intraperitoneal injection of 5-FU 100 μl (25 mg / kg, prepared with normal saline, present preparation present use, once every 3 days, a total of 21 days). Gavage 1x109CFU / 100 μl NCU-05 per day for 21 days. (5) MFL group: after modeling, intraperitoneal injection of 5-FU (40 mg / kg); at the same time, 50 μL of NCU-05 with a concentration of 1x109CFU / mL was administered intragastrically. 6 CFU / ml NCU-28 was placed into the vagina of mice once every 2 days. (6) MFBL group: After the model was established, 5-FU (40 mg / kg) was injected intraperitoneally, and NCU-05 (109 CFU / ml, 100 μL) was administered orally for 3 weeks. Then, 50 μL of NCU-28 bacterial solution with a concentration of 1 x 106 CFU / ml was placed into the vagina of mice once every 2 days. Three, Materials and methods were the same as before.
[0056] The results showed that chemotherapy had a negative impact on the intestinal and vaginal microbiota. Oral supplementation enhanced the anti-cancer response of 5-FU and improved intestinal toxicity. However, the damage to the vaginal environment was not significantly improved. Therefore, the adjunctive effect of oral NCU-05 combined with intravaginal NCU-28 on 5-FU chemotherapy was further studied (MFBL group). Figure 12 A). q-PCR analysis confirmed that the abundance of Bifidobacterium in the feces of mice orally supplemented with NCU-05 was increased ( Figure 6 A-C). Similarly, in the NCU-28 vaginal intervention group, the abundance of Figure 6 Bacteroides in the vaginal secretions of mice was also significantly increased ( Figure 6 D-F).
[0057] The combination of oral NCU-05 and intravaginal NCU-28 (MFBL group) significantly improved the weight loss caused by chemotherapy (p < 0.01) ( Figure 6 B). In addition, compared with the treatment group with only oral probiotics, the combination of "intestinal-vaginal" probiotics showed better results in reducing the number of colon cancer tumors in mice (p < 0.05) ( Figure 7 C, D). Compared with the MFB group, the MFBL group was more effective in restoring the structure of the colon glands, reducing the area of canceration, and effectively slowing down the malignant degree of cancerous lesions ( Figure 7 E). Compared with the MFB group, the MFBL group significantly up-regulated the levels of p-p53 (p < 0.05), Bax / Bcl-2 ratio (p < 0.01), and Cleaved-Caspase 3 (p < 0.05) in tumor tissues, thereby inhibiting the proliferation of tumor cells ( Figure 7 F-I). The above results indicate that compared with oral NCU-05 alone, the combination of "intestinal-vaginal" probiotics is more effective in enhancing the anti-cancer effect of 5-FU.
[0058] In terms of improving chemotherapy-induced vomiting and nausea (CINV), the kaolin intake of MFBL group mice decreased compared with the MFB group (MFB vs MFBL = 2.51% vs 1.78%, p < 0.05) ( Figure 13A). At the same time, the FOS protein expression in the AP region of the brain of the MFBL group mice was significantly lower than that of the MFB group ( Figure 7 B). In addition, the MFBL group significantly reduced the increase in 5-HT, SP, 5-HT3R and NK-1R levels caused by chemotherapy and showed a more obvious effect than the MFB group ( Figure 7 C-E and Figure 13 A-C). Interestingly, although a decrease in neurotransmitter levels was also observed in the MFL group, the effect was not as obvious as that in the MFB and MFBL groups.
[0059] In terms of improving chemotherapy-induced intestinal mucositis (CIM), the MFBL group of mice showed the most significant recovery in colon shortening and DAI score increase ( Figure 7 F, G). Compared with the MFB group, the MFBL group of mice showed a significant decrease in TNF-α and IL-1β levels (p<0.05) ( Figure 7 H and Figure 13 D), while the expression of IL-4 was significantly increased (p<0.05) ( Figure 7 I). In addition, the TLR4, MyD88 and p-p65 protein levels in the intestinal tissue of the MFBL group of mice were significantly down-regulated ( Lactobacillus, Clostridium J and Bacteroides E-G), indicating that the combined use of NCU-05 and NCU-28 inhibited the inflammatory response. The expression of MUC-2 and ZO-1 proteins in the intestines of the MFBL group of mice was most significantly improved, which helped to restore the function of the intestinal barrier ( Figure 7 K).
[0060] To evaluate the effect of the combined use of "gut-vaginal" probiotics on the improvement of intestinal microecological imbalance, the abundance of common intestinal bacterial genera was detected by q-PCR. Compared with the C group, the levels of Enterococcus , and Enterobacter in the MF group of mice were significantly decreased (p<0.01) ( Figure 7 L-N), while Lactobacillus, Clostridium and Bacteroides abundance was significantly increased (p<0.01) ( Enterococcus O, P). In the feces of the MFB group of mice, , and abundance was significantly increased (p<0.01), while and Enterobacter abundance was significantly decreased (p<0.01). The MFL group to some extent restored the microecological imbalance caused by chemotherapy, while the MFBL group showed the most effective treatment effect. The above results show that the combined use of "gut-vaginal" probiotics has the most significant effect on improving chemotherapy-induced gastrointestinal side effects and restoring intestinal microecological balance.
[0061] Further investigation of the effect of dual-channel probiotic therapy on post-chemotherapy vaginal epithelial tissue showed that HE staining results revealed that in the MFL and MFBL groups, vaginal epithelial damage was significantly alleviated, inflammatory cell infiltration was reduced, vaginal mucosa structure integrity was restored, and the keratin layer was clearly visible, and the effect was better than that of the MFB group ( Figure 8 A). Compared with the MFB and MFL groups, the MFBL group more effectively reversed the overexpression of TNF-α and IL-1β in the vaginal tissue caused by chemotherapy, while significantly increasing the expression of IL-4 ( Figure 8 B-D). At the same time, the MFBL group more effectively inhibited the activation of the NF-κB inflammatory pathway ( Figure 8 E-H), and reduced the apoptosis of epithelial cells ( Figure 8 I-J). At the same time, the level of Cleaved Caspase-3 in the MFBL group was also significantly reduced ( Figure 8 K). According to the above results, oral and vaginal probiotic combined intervention therapy is more effective than oral or vaginal probiotic therapy alone in reducing vaginal inflammation and tissue damage.
[0062] To evaluate the effect of "gut-vaginal" probiotic combination on the distal vaginal microecology, the results showed that in the comparison of Shannon and Pielou_e indexes, the vaginal microecological α diversity of the MFL and MFBL groups was significantly restored, compared with the MF group ( Figure 9 A, B). PCoA analysis showed that the vaginal microecological imbalance caused by chemotherapy was partially alleviated in the MFB and MFL groups, while the vaginal microecological composition of the MFBL group was closer to that of the healthy control group ( Figure 9 C). In addition, the Venn diagram showed that there were 64 OTUs shared between the C, M, MF, MFB, MFL and MFBL groups, and the unique OTUs of each group were 578, 507, 178, 128, 489 and 500, respectively ( Figure 9 D). In terms of door level composition, the upregulation of Proteobacteria and the downregulation of Firmicutes caused by chemotherapy were improved in the MFB, MFL and MFBL groups ( Figure 9 E-G). In terms of genus level composition, the abundance of Aggregatibacter in the MFBL group was significantly lower than that in the MF group (p<0.01), while the abundance of Acinetobacter, Enhydrobacter and Methyloversatilis increased (p<0.05) ( Figure 9 I-L), which reversed the microecological imbalance caused by chemotherapy. Vaginal probiotics had better improvement effect than oral probiotics, but still not as good as dual-channel probiotic therapy. Therefore, "gut-vaginal" probiotic combination is the most effective in alleviating the vaginal microecological imbalance caused by chemotherapy.Figure 10 To illustrate the mechanism, in AOM and DSS-induced colorectal cancer (CRC) mouse models, oral NCU-05 combined with vaginal NCU-28 intervention enhances the anti-cancer effect of 5-FU by activating the P53 signaling pathway and increasing the expression of pro-apoptotic proteins, thereby contributing to the treatment of CRC. In terms of improving the side effects of chemotherapy, the "gut-vaginal" probiotic combination administration modulates the release of neurotransmitters (such as 5-HT, SP) through the GBA axis, reducing nausea and vomiting. In addition, it also restores the imbalance of intestinal and vaginal microbiota, thereby alleviating inflammation-related damage in the intestine and vagina.
Claims
1. A double chamber probiotic, characterized in that, The dual-cavity probiotic is *Bifidobacterium longum* subsp. *longum* (… Bifidobacterium longum Bifidobacterium longum subsp Lactobacillus crispatus NCU-05 and Lactobacillus curvature ( The Bifidobacterium longum longum subspecies NCU-05 was deposited with the China General Microbiological Culture Collection Center on January 18, 2023, and the deposit number is CGMCC NO. 26492. NCU-28; The Lactobacillus crispatus NCU-28 was deposited with the China General Microbiological Culture Collection Center on July 22, 2024, and the deposit number is CGMCC NO. 31387.
2. The use of the bifidobacterium of claim 1 in the preparation of a medicine for assisting 5-FU chemotherapy in the treatment of colon cancer, wherein the Bifidobacterium longum longum subspecies NCU-05 is administered through the intestinal tract, and the Lactobacillus crispatus NCU-28 is administered through the vagina. The use includes the preparation of a combination medicine for assisting 5-FU chemotherapy in the treatment of colon cancer, wherein the Bifidobacterium longum longum subspecies NCU-05 and the Lactobacillus crispatus NCU-28 are used as active ingredients.
3. Use according to claim 2, characterized in that, consists of biological agent A and biological agent B, wherein the active ingredient of the biological agent A is the Bifidobacterium longum longum subspecies NCU-05 of claim 1, and the active ingredient of the biological agent B is the Lactobacillus crispatus NCU-28 of claim 1.
4. A biological agent, characterized in that, The biological agent A is administered through the intestinal tract, and the biological agent B is administered through the vagina.
5. The biological preparation of claim 4, wherein, consists of auxiliary medicine A and auxiliary medicine B, wherein the active ingredient of the auxiliary medicine A is the Bifidobacterium longum longum subspecies NCU-05 of claim 1, and the active ingredient of the auxiliary medicine B is the Lactobacillus crispatus NCU-28 of claim 1.
6. A drug for assisting 5-FU chemotherapy for colon cancer, characterized by, The auxiliary medicine A is administered through the intestinal tract, and the auxiliary medicine B is administered through the vagina.
7. The auxiliary drug for 5-FU chemotherapy treatment of colon cancer according to claim 6, characterized in that, The auxiliary medicine A and the auxiliary medicine B further include a pharmaceutical carrier.
8. The auxiliary drug for 5-FU chemotherapy treatment of colon cancer according to claim 6, characterized in that, The pharmaceutical carrier is at least one of water, lactose, sodium chloride, and glucose.
9. The auxiliary drug for 5-FU chemotherapy treatment of colon cancer according to claim 8, characterized in that, The dosage form of the auxiliary medicine for 5-FU chemotherapy in the treatment of colon cancer is powder, granules, capsules, or tablets.
10. The auxiliary drug for 5-FU chemotherapy treatment of colon cancer according to claim 6, characterized in that,
Citation Information
Patent Citations
Probiotic powder for treating female vaginal infection and preparation method thereof
CN114159479A
Lactobacillus crispatus NCU-23 and application thereof
CN118360221A