A strain of Pseudomonas chlororaphis subsp. aurantiacae NEAU-L04 and its application in the control of leaf spot disease of Lonicera edulis
By using the biocontrol agent prepared by Pseudomonas chlororaphis subspecies NEAU-L04, the problem of lack of effective biocontrol strains in the prevention and control of blue indigo leaf spot disease was solved, and efficient and environmentally friendly prevention and control of blue indigo leaf spot disease caused by Alternaria tenuifolia was achieved.
Patent Information
- Application Number
- CN202510669145.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-23
- Publication Date
- 2025-09-19
- Estimated Expiration
- 2045-05-23
AI Technical Summary
The existing technology lacks effective biocontrol strains for preventing and treating blue indigo leaf spot disease, and chemical control methods have the side effect of polluting the environment.
Provided is a strain of Pseudomonas chlororaphis subsp. aurantiaca NEAU-L04, which can be used to prevent and control leaf spot disease of blueberry by preparing antibacterial products and biocontrol agents.
The strain NEAU-L04 showed a significant antagonistic effect against Alternaria leaf spot of blueberry, with a prevention rate of 56.02%, which is better than commercially available fungicides, and has broad-spectrum resistance and environmental friendliness.
Smart Images

Figure CN120173843B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of microorganisms, and in particular to a strain of Pseudomonas chlororaphis subspecies aurantiaca NEAU-L04 and application thereof in preventing and controlling leaf spot disease of Lonicera edulis. Background Art
[0002] Blue indigo berry, scientifically known as blue honeysuckle, is a deciduous shrub crop of the genus Lonicera in the family Caprifoliaceae. Blue indigo berry cultivation has become an important economic crop, bringing significant economic benefits.
[0003] Alternaria leaf spot is the main source of blue indigo leaf spot disease, causing serious blue indigo yield losses. The causative agent is Alternaria leaf spot ( Alternaria tenuissima At present, chemical control is a commonly used method for plant disease prevention and control, but chemical control has side effects such as soil and water pollution.
[0004] Biological control has experienced rapid development in recent years. It is environmentally friendly, has minimal impact on the environment and ecosystems, contributes to ecological balance and biodiversity maintenance, and targets pathogens with sustained effects, contributing to long-term disease control. Biological control is gaining increasing attention due to its safety, cost-effectiveness, and high efficiency.
[0005] Pseudomonas ( Pseudomonas spp.) are widely distributed in the rhizosphere soil of plants. Many strains can effectively inhibit pathogens while promoting plant growth and increasing yield. Pseudomonas spp.) have been found to control infectious diseases of various plants, including ginseng, Rehmannia glutinosa, and tomatoes, greatly expanding the application range of Pseudomonas bacteria. However, no Pseudomonas bacteria have been found to be effective in controlling blueberry leaf spot. Therefore, a biocontrol strain that can control blueberry leaf spot is needed to address the shortcomings of existing technologies. Summary of the Invention
[0006] The present invention aims to provide a strain of Pseudomonas chlororaphis subspecies aurantiacae NEAU-L04 and its application in preventing and treating blueberry leaf spot disease.
[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:
[0008] The present invention provides a strain of Pseudomonas chlororaphis subsp. aurantiacus ( Pseudomonas chlororaphis subsp . orange )NEAU-L04, deposited in the General Microbiology Center of China Culture Collection Administration, Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with a deposit date of October 23, 2024 and a deposit number of CGMCC No.32309.
[0009] The present invention also provides the Pseudomonas chlororaphis subsp. aurantiacus ( Pseudomonas chlororaphis subsp orange ) Application of NEAU-L04 in the preparation of products for inhibiting plant pathogens.
[0010] Preferably, the plant pathogenic bacteria include Escherichia coli ( Epicoccum sorghum ), E. nigricans ( Black Epicoccum ), Alternaria tenuissima ( Alternaria tenuissima ), Alternaria ( Alternaria alternate ), Pseudomonas aculeatus ( Stagonosporopsis cucurbitaceae )、Pseudocera spp. Pseudopithomyces chartarum ), Fusarium asiatica ( Fusarium asiatica ), pseudobud cladospore ( Cladosporium pseudocladosporioides ), Rose pseudodiscus hirsutus ( Neopestalotiopsis rosae )
[0011] The present invention also provides a microbial agent, including the Pseudomonas chlororaphis subspecies aurantiacus ( Pseudomonas chlororaphis subsp. orange ) NEAU-L04 and its bacterial suspension or fermentation broth.
[0012] The present invention also provides the use of the microbial agent in preparing products for inhibiting plant pathogens.
[0013] Preferably, the plant pathogenic bacteria include Escherichia coli ( Epicoccum sorghum ), E. nigricans ( Black Epicoccum ), Alternaria tenuissima ( Alternaria tenuissima ), Alternaria ( Alternaria alternate ), Pseudomonas aculeatus ( Stagonosporopsis cucurbitaceae )、Pseudocera spp. Pseudopithomyces chartarum ), Fusarium asiatica ( Fusarium asiatica ), pseudobud cladospore ( Cladosporium pseudocladosporioides ), Rose pseudodiscus hirsutus ( Neopestalotiopsis rosae )
[0014] The present invention also provides a biocontrol agent for preventing and treating Alternaria tenuifolia leaf spot disease of blue loquat, comprising the Pseudomonas chlororaphis subsp. Pseudomonas chlororaphis subsp. orange ) NEAU-L04 and its bacterial suspension.
[0015] The present invention also provides a method for preparing a biocontrol agent for preventing and treating Alternaria edulis leaf spot disease, comprising the following steps:
[0016] The Pseudomonas chlororaphis subsp. aurantiacus ( Pseudomonas chlororaphis subsp. orange ) NEAU-L04 was inoculated into LB liquid medium and cultured to OD 600 is 0.7~0.9, we get;
[0017] The LB liquid culture medium uses water as a solvent and includes the following components at the following concentrations: yeast extract powder 4-6 g / L, tryptone 9-11 g / L, and sodium chloride 4-6 g / L.
[0018] The present invention also provides a method for preventing and treating Alternaria caerulea leaf spot disease of Lonicera edulis, comprising the following steps:
[0019] After diluting the biocontrol agent, spray and / or irrigate the roots of blue indigo fruit;
[0020] The biocontrol agent is the biocontrol agent or the biocontrol agent prepared according to the preparation method.
[0021] Preferably, the biocontrol agent is diluted 50 to 150 times.
[0022] The present invention provides a strain of Pseudomonas chlororaphis subsp. aurantifolia NEAU-L04 and its use in preventing and controlling leaf spot disease of blue indigo carp. The present invention isolates a strain NEAU-L04 from rhizosphere soil of blue indigo carp plants, which has a significant antagonistic effect on leaf spot disease of blue indigo carp. After morphological characteristics, electron microscopy, physiological and biochemical indicators, and multi-gene phylogenetic tree analysis of the strain, the strain NEAU-L04 is identified as Pseudomonas chlororaphis subsp. aurantifolia ( Pseudomonas Chlorophytum subsp. orange In antifungal spectrum testing, strain NEAU-L04 demonstrated broad-spectrum resistance, showing antagonistic effects against nine fungal pathogens. In greenhouse potted plant control tests, strain NEAU-L04 achieved a 7-day efficacy of 56.02% against Alternaria tenuifolia leaf spot in Lonicera edulis. This suggests that strain NEAU-L04 has promising application prospects and provides a theoretical basis and technical support for further development and utilization.
[0023] Certificate of Deposit
[0024] Pseudomonas chlororaphis subsp. aurantiacus ( Pseudomonas chlororaphis subsp. orange )NEAU-L04, deposited in the General Microbiology Center of China Culture Collection Administration, located at Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is October 23, 2024, and the deposit number is CGMCC No. 32309. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] Figure 1 This is the morphological observation result of strain NEAU-L04;
[0026] Figure 2 is the phylogenetic tree of strain NEAU-L04;
[0027] Figure 3 The plate confrontation-contact test was used to detect the antibacterial effect of strain NEAU-L04 on 9 pathogens;
[0028] Figure 4 is the test result of cellulase test;
[0029] Figure 5 is the test result of protease test;
[0030] Figure 6 This is a visual diagram of the control effect of the strain NEAU-L04 in a potted plant experiment (from left to right, it represents healthy blue loquat plants, model control group, treatment group 2, and treatment group 1);
[0031] Figure 7 These are the disease index of the potted plant test of strain NEAU-L04 and the statistical results of its inhibition on Alternaria tenuissima. DETAILED DESCRIPTION
[0032] The present invention provides a strain of Pseudomonas chlororaphis subsp. aurantiacus ( Pseudomonas chlororaphis subsp . orange )NEAU-L04, deposited in the General Microbiology Center of China Culture Collection Administration, Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with a deposit date of October 23, 2024 and a deposit number of CGMCC No.32309.
[0033] The present invention also provides the Pseudomonas chlororaphis subsp. aurantiacus ( Pseudomonas chlororaphis subsp orange ) Application of NEAU-L04 in the preparation of products for inhibiting plant pathogens.
[0034] In the present invention, the plant pathogenic bacteria include Escherichia coli ( Epicoccum sorghum ), E. nigricans ( Black Epicoccum ), Alternaria tenuissima ( Alternaria tenuissima ), Alternaria ( Alternaria alternate ), Pseudomonas aculeatus ( Stagonosporopsis cucurbitaceae )、Pseudocera spp. Pseudopithomyces chartarum ), Fusarium asiatica ( Fusarium asiatica ), pseudobud cladospore ( Cladosporium pseudocladosporioides ), Rose pseudodiscus hirsutus ( Neopestalotiopsis rosae )
[0035] The present invention also provides a microbial agent, including the Pseudomonas chlororaphis subspecies aurantiacus ( Pseudomonas chlororaphis subsp orange ) NEAU-L04 and its bacterial suspension or fermentation broth.
[0036] The present invention also provides the use of the microbial agent in preparing products for inhibiting plant pathogens.
[0037] In the present invention, the plant pathogenic bacteria include Escherichia coli ( Epicoccum sorghum ), E. nigricans ( Black Epicoccum ), Alternaria tenuissima ( Alternaria tenuissima ), Alternaria ( Alternaria alternate ), Pseudomonas aculeatus ( Stagonosporopsis cucurbitaceae )、Pseudocera spp. Pseudopithomyces chartarum ), Fusarium asiatica ( Fusarium asiatica ), pseudobud cladospore ( Cladosporium pseudocladosporioides ), Rose pseudodiscus hirsutus ( Neopestalotiopsis rosae )
[0038] The present invention also provides a biocontrol agent for preventing and treating Alternaria tenuifolia leaf spot disease of blue loquat, comprising the Pseudomonas chlororaphis subsp. Pseudomonas chlororaphis subsp orange ) NEAU-L04 and its bacterial suspension.
[0039] The present invention also provides a method for preparing a biocontrol agent for preventing and treating Alternaria edulis leaf spot disease, comprising the following steps:
[0040] The Pseudomonas chlororaphis subsp. aurantiacus ( Pseudomonas chlororaphis subsp. orange ) NEAU-L04 was inoculated into LB liquid medium and cultured to OD 600 is 0.7-0.9, and the OD of the culture is obtained. 600 The value of is preferably 0.8.
[0041] The LB liquid culture medium uses water as a solvent and includes the following components in the following concentrations: yeast extract 4-6 g / L, preferably 5 g / L; tryptone 9-11 g / L, preferably 10 g / L; and sodium chloride 4-6 g / L, preferably 5 g / L.
[0042] The present invention also provides a method for preventing and treating Alternaria caerulea leaf spot disease of Lonicera edulis, comprising the following steps:
[0043] After diluting the biocontrol agent, spray and / or irrigate the roots of blue indigo fruit;
[0044] The biocontrol agent is the biocontrol agent or the biocontrol agent prepared according to the preparation method.
[0045] In the present invention, the biocontrol agent is diluted 50 to 150 times, preferably 100 times.
[0046] The solutions provided by the present invention are described in detail below with reference to the embodiments, but they should not be understood as limiting the scope of protection of the present invention.
[0047] The LB solid medium described in the embodiment of the present invention uses water as a solvent and includes the following components at the following concentrations: yeast extract powder 5 g / L, tryptone 10 g / L, sodium chloride 5 g / L, and agar powder 20 g / L. This medium is used to isolate and purify strains;
[0048] The LB liquid medium described in the embodiment of the present invention uses water as a solvent and includes the following components at the following concentrations: yeast extract powder 5 g / L, tryptone 10 g / L, and sodium chloride 5 g / L. This medium is used for the propagation of strains;
[0049] The PDA solid culture medium described in the embodiment of the present invention uses water as a solvent and includes the following components at the following concentrations: 200 g / L potato, 20 g / L glucose, and 20 g / L agar powder. This culture medium is used for the activation culture of the strain.
[0050] The gelatin culture medium described in the embodiment of the present invention uses water as a solvent and includes the following components at the following concentrations: 5 g / L sodium chloride, 10 g / L tryptone, 3 g / L beef extract, and 120 g / L gelatin. This culture medium is used for gelatin liquefaction experiments.
[0051] The glucose-peptone water culture medium described in the embodiment of the present invention uses water as a solvent and includes the following components at the following concentrations: peptone 5 g / L, glucose 5 g / L, and dipotassium hydrogen phosphate 2 g / L. This culture medium is used for VP reaction and methyl red test;
[0052] The starch hydrolysis assay agar medium described in the embodiment of the present invention uses water as a solvent and includes the following components at the following concentrations: soluble starch 10 g / L, potassium nitrate 1 g / L, dipotassium hydrogen phosphate 0.3 g / L, magnesium carbonate 1 g / L, sodium chloride 0.5 g / L, agar 20 g / L, pH 7.2. This medium was used for starch hydrolysis experiments.
[0053] The skim milk powder plate medium described in the embodiment of the present invention uses water as a solvent and includes the following components at the following concentrations: 2 g / L potassium chloride, 1 g / L magnesium sulfate heptahydrate, 0.48 g / L calcium chloride dihydrate, 0.06 g / L sodium bicarbonate, 0.001 g / L ferric chloride, 40 g / L sodium chloride, 10 g / L skim milk powder, and 15 g / L agar, with a pH of 7.5. This medium is used for protease assays.
[0054] The CMC medium in the embodiment of the present invention uses water as a solvent and includes the following components at the following concentrations: 2.5 g / L dipotassium hydrogen phosphate, 2.5 g / L disodium hydrogen phosphate, 20.0 g / L sodium carboxymethyl cellulose, 2.0 g / L peptone, 0.5 g / L yeast extract powder, and 20 g / L agar.
[0055] The above-mentioned culture media are all sterile culture media. LB solid culture medium and LB liquid culture medium are culture media obtained by sterilizing at 121°C for 30 minutes.
[0056] PDA solid medium, gelatin medium and starch hydrolysis assay agar medium were obtained by sterilizing at 121°C for 20 min.
[0057] The glucose-peptone water culture medium and the skimmed milk powder plate culture medium were culture media obtained by sterilizing at 115°C for 20 min.
[0058] The sterilization condition of CMC culture medium is 121℃ for 15min.
[0059] The Congo red solution described in the embodiment of the present invention is a 0.2 wt% Congo red solution, and the specific preparation method is: 2 g of Congo red powder, 1 L of distilled water, and a small amount of alcohol can be added to help dissolve it evenly.
[0060] The sodium chloride solution described in the embodiment of the present invention is a 1 M sodium chloride solution, and the specific preparation method is: 58.5 g of sodium chloride is mixed with 1 L of distilled water, and stirred evenly to obtain a sodium chloride solution.
[0061] Example 1
[0062] Isolation, identification and preservation of strain NEAU-L04
[0063] 1. Isolation and purification of strain NEAU-L04
[0064] Rhizosphere soil from the 1–10 cm surface area of healthy blue loquat plants at the Xiangyang Base of Northeast Agricultural University was collected and stored at 4°C until use. 0.3 g of each soil sample was weighed, added to 30 mL of sterile water, and incubated in a 30°C shaker for 30 min. Then, 30 μL of the sample was spread onto LB solid medium and incubated in a 30°C incubator for 48 h. After single colonies grew on the plate, individual colonies of varying morphology were selected with a sterile toothpick and streaked onto LB solid medium plates for purification. The samples were then incubated in a 30°C incubator until single colonies of uniform morphology emerged. The strains were then stored in a refrigerator at 4°C until use. Strain NEAU-L04 was isolated.
[0065] 2. Identification of strain NEAU-L04
[0066] 1. Morphological identification
[0067] The morphological characteristics of strain NEAU-L04 were observed. Figure 1 As shown, the results showed that the colonies were round and slightly raised, with smooth surfaces and edges, easy to pick up, orange-yellow in color, and could produce orange-red pigments around the colonies and cover the surface of the colonies.
[0068] 2. Physiological and biochemical identification
[0069] With reference to the methods in the Common Bacterial Systematic Identification Manual and Bergey's Manual of Bacterial Identification, strain NEAU-L04 was subjected to the following physiological and biochemical tests: Gram test, growth temperature test, salt tolerance test, gelatin liquefaction test, methyl red test, VP test, lecithinase test, catalase test, starch hydrolysis test, and protease test. The results are shown in Table 1. The results of the salt tolerance, catalase, VP reaction, and starch hydrolysis tests of strain NEAU-L04 were consistent with those of Pseudomonas chlororaphis, preliminarily confirming that it belongs to the genus Pseudomonas chlororaphis.
[0070] Table 1 Physiological and biochemical identification results of strain NEAU-L04
[0071]
[0072] In Table 1, “+” indicates positive, and “-” indicates negative.
[0073] 3. Molecular biological identification of strain NEAU-L04
[0074] The genomic DNA of strain NEAU-L04 was extracted using a bacterial genome extraction kit, and the 16S rDNA gene sequence of strain NEAU-L04 was amplified by PCR using primers.
[0075] 16S rDNA gene amplification primers: 27F (SEQ ID NO. 1): 5'AGAGTTTGATCCTGGCTCAG 3'; 1492R (SEQ ID NO. 2): 5'AAGGAGGTGATCCAGCCGCA 3'.
[0076] PCR amplification system: 25 μL, including 1 μL each of upstream and downstream primers, 1 μL template DNA, 12.5 μL T-Taq Mix, and 9.5 μL sterile water. PCR reaction program: 94°C initial denaturation for 5 min; 35 cycles of 94°C denaturation for 30 s, 55°C annealing for 30 s, and 72°C extension for 90 s; and 72°C extension for 10 min.
[0077] After amplification, 3 μL of the PCR product was aspirated and run on a 1.5% agarose gel for electrophoresis. The PCR product was sequenced at Sangon Biotech (Shanghai) Co., Ltd., and a preliminary BLAST comparison was performed against the NCBI database. Gene sequences relevant for constructing a phylogenetic tree were obtained from the GenBank database. A phylogenetic tree was constructed using the Neighbor-Joining Tree method in MEGA 7.0 software to determine the species relationships of strain NEAU-L04.
[0078] Based on the 16S rDNA gene sequence of strain NEAU-L04 (SEQ ID NO.3), the phylogenetic tree of NEAU-L04 was constructed. Figure 2 As shown, the results showed that the strain NEAU-L04 and Pseudomonas chlororaphis subsp. Pseudomonas Chlorophytum subsp. Orange )zm-1 clustered together with a support rate of 100%.
[0079] Based on the growth characteristics, morphological characteristics, physiological and biochemical tests, and molecular biological identification of strain NEAU-L04, it was determined to be Pseudomonas chlororaphis subsp. Pseudomonas chlororaphis subsp. Orange.
[0080]
[0081] 3. Deposit of strain NEAU-L04
[0082] Pseudomonas chlororaphis subsp. aurantiacus ( Pseudomonas chlororaphis subsp. Orange )NEAU-L04 is deposited in the General Microbiology Center of China Culture Collection Administration, located at Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is October 23, 2024, and the deposit number is CGMCC No. 32309.
[0083] Example 2
[0084] Identification of the antibacterial spectrum of strain NEAU-L04
[0085] The plate confrontation-contact test was used to detect the antibacterial activity of strain NEAU-L04 against nine pathogens of blue loquat leaf spot. The antibacterial results are shown in Table 2 and Figure 3 Inhibition rate (%) = [(control colony diameter - treated colony diameter) / (control colony diameter - 5 mm)] × 100%.
[0086] Table 2 Inhibition results of strain NEAU-L04 against 9 pathogens of blue loquat leaf spot
[0087]
[0088] Data are mean ± standard error.
[0089] The results showed that strain NEAU-L04 can effectively inhibit nine fungi, including Alternaria alternata, Alternaria solani, Cladosporium pseudobuddingii, Echinococcus nigricans, Echinococcus sorghum, Fusarium asiatica, Pseudomonas roseus, Pseudomonas pelargonifolia, and Pseudomonas cucurbitae, with inhibition rates greater than 50%.
[0090] Figure 3 From left to right in the first row, they represent Alternaria tenuissima, Alternaria alternata, and Cladosporium pseudobuddingii; from left to right in the second row, they represent Pseudomonas pseudodermatitis, Echinococcus nigricans, and Echinococcus sorghum; from left to right in the third row, they represent Fusarium asiatica, Pseudomonas rosei, and Pseudomonas cucurbitae.
[0091] Example 3
[0092] Determination of biocontrol factors of strain NEAU-L04
[0093] 1. Detection of cellulase
[0094] A single colony of strain NEAU-L04 was picked and inoculated in the center of the CMC medium. After incubation at 28°C for 24 h, 3 mL of 0.2 wt% Congo red solution was added and stained for 30 min. The dye was discarded and 5 mL of 1 M sodium chloride solution was added for decolorization for 15 min. The digestion zone was observed. Each treatment was repeated 3 times. The results are shown in Figure 2. Figure 4 shown.
[0095] 2. Detection of protease
[0096] A single colony of strain NEAU-L04 was picked and inoculated at the center of the skim milk powder culture medium. The digestion zone was observed after incubation at 28°C for 24 hours. Each treatment was repeated 3 times. Figure 5 shown.
[0097] Figure 4~5 The results showed that strain NEAU-L04 had no digestion zone on CMC medium but had a digestion zone on skim milk powder medium, indicating that strain NEAU-L04 had protease activity.
[0098] Example 4
[0099] Determination of the efficacy of strain NEAU-L04 in controlling Alternaria tenuifolia leaf spot disease of Indigofera caerulea
[0100] Treatment 1: Use sterile water to adjust the OD 600 = 0.8, the bacterial suspension of strain NEAU-L04 was diluted 100 times and sprayed on the blue loquat plants respectively until the leaves were covered with the liquid and no water was dripping. At the same time, 50 mL of treatment solution (OD 600 = 0.8) of the strain NEAU-L04 suspension diluted 100 times) for root irrigation.
[0101] Model control group: distilled water was used to replace the OD 600 =0.8 bacterial suspension of strain NEAU-L04, and other treatment methods were the same as those of treatment 1.
[0102] Treatment 2: The commercially available bacterial agent (the main active strain is Pseudomonas fluorescens ( Pseudomonas fluorescent )) replaced the NEAU-L04 strain in treatment group 1, and other treatments were the same as those in treatment group 1.
[0103] After 24 h of treatment, the spray inoculation concentration of each treatment group and the model control group was 1×10 8 cfu / mL of Alternaria tenuissima ( Alternaria tenuissima) LD-12 suspension was applied to eight plants per treatment, with three replicates. The suspension was kept moist at 28°C. Disease activity was assessed seven days after treatment, with healthy blue loquat plants serving as blank controls. Disease classification was performed according to the "Guidelines for Field Efficacy Tests of Pesticides," and the disease index and control efficacy were calculated.
[0104] Disease index = ∑ (number of diseased leaves at each level × disease level) / (total number of leaves surveyed × highest disease level) × 100. Disease level classification criteria: Level 0: No lesions; Level 1: Lesions account for less than 5% of the total leaf area; Level 2: Lesions account for 6% to 25% of the total leaf area; Level 3: Lesions account for 26% to 50% of the total leaf area; Level 4: Lesions account for 51% to 75% of the total leaf area; Level 5: Lesions account for more than 75% of the total leaf area.
[0105] Control effect (%) = (model control disease index - treatment disease index) / model control disease index × 100%.
[0106] The results are as follows Figure 6~7 As shown, the results showed that: Pseudomonas chlororaphis subsp. aurantiaca ( Pseudomonas Chlorophytum subsp. orange )NEAU-L04 is effective against Alternaria tenuissima ( Alternaria tenuissima ) caused by blue indigo leaf spot disease, the 7-day control effect reached 56.02%, which was better than the commercial fungicide Pseudomonas fluorescens ( Pseudomonas fluorescens )’s control effect (36.11%).
[0107] As can be seen from the above examples, the present invention provides a strain of Pseudomonas chlororaphis subsp. aurantifolia NEAU-L04 and its use in the prevention and treatment of blue indigo leaf spot disease. The present invention isolated a strain NEAU-L04 from the rhizosphere soil of blue indigo plants, which has a significant antagonistic effect on blue indigo leaf spot disease caused by Alternaria tenuifolia. After analysis of the strain's morphological characteristics, electron microscopy, physiological and biochemical indicators, and multi-gene phylogenetic tree, the strain NEAU-L04 was identified as Pseudomonas chlororaphis subsp. aurantifolia ( Pseudomonas chlororaphis subsp. orange In antifungal spectrum testing, strain NEAU-L04 demonstrated broad-spectrum resistance, showing antagonistic effects against nine fungal pathogens. In greenhouse potted plant control tests, strain NEAU-L04 achieved a 7-day efficacy of 56.02% against Alternaria tenuifolia leaf spot in Lonicera edulis. This suggests that strain NEAU-L04 has promising application prospects and provides a theoretical basis and technical support for further development and utilization.
[0108] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.
Claims
1. A strain of Pseudomonas chlororaphis subsp. aurantiacus ( Pseudomonas chlororaphis subsp. aurantiaca ) NEAU-L04, characterized in that, It is deposited in the General Microbiology Center of China Culture Collection Administration, located at Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is October 23, 2024, and the deposit number is CGMCC No.32309.
2. The Pseudomonas chlororaphis subspecies aurantiacus according to claim 1 ( Pseudomonas chlororaphis subsp. aurantiaca ) Use of NEAU-L04 in the preparation of products for inhibiting plant pathogens; The plant pathogens include Escherichia coli ( Epicoccum sorghinum ), E. nigricans ( Epicoccum nigrum ), Alternaria tenuissima ( Alternaria tenuissima ), Alternaria ( Alternaria alternata ), Pseudomonas aculeatus ( Stagonosporopsis cucurbitacearum )、Pseudocera spp. Pseudopithomyces chartarum ), Fusarium asiatica ( Fusarium asiaticum ), pseudobud cladospore ( Cladosporium pseudocladosporioides ), Rose pseudodiscus hirsutus ( Neopestalotiopsis rosae ) 3. A microbial agent, characterized in that: Including the Pseudomonas chlororaphis subspecies orange ( Pseudomonas chlororaphis subsp . aurantiaca ) NEAU-L04 and its bacterial suspension.
4. Use of the microbial agent according to claim 3 in the preparation of a product for inhibiting plant pathogens; The plant pathogens include Escherichia coli ( Epicoccum sorghinum ), E. nigricans ( Epicoccum nigrum ), Alternaria tenuissima ( Alternaria tenuissima ), Alternaria ( Alternaria alternata ), Pseudomonas aculeatus ( Stagonosporopsis cucurbitacearum )、Pseudocera spp. Pseudopithomyces chartarum ), Fusarium asiatica ( Fusarium asiaticum ), pseudobud cladospore ( Cladosporium pseudocladosporioides ), Rose pseudodiscus hirsutus ( Neopestalotiopsis rosae ) 5. A biocontrol agent for preventing and treating Alternaria leaf spot of Lonicera caerulea, characterized in that: Including the Pseudomonas chlororaphis subspecies orange ( Pseudomonas chlororaphis subsp. aurantiaca ) NEAU-L04 and its bacterial suspension.
6. A method for preparing a biocontrol agent for preventing and treating Alternaria edulis leaf spot disease, characterized in that: The steps include: The Pseudomonas chlororaphis subspecies aurantiacus ( Pseudomonas chlororaphis subsp . aurantiaca ) NEAU-L04 was inoculated into LB liquid medium and cultured to OD 600 is 0.7~0.9, we get; The LB liquid culture medium uses water as a solvent and includes the following components at the following concentrations: yeast extract powder 4-6 g / L, tryptone 9-11 g / L, and sodium chloride 4-6 g / L.
7. A method for preventing and treating Alternaria caerulea leaf spot of Lonicera edulis, characterized in that: The steps include: After diluting the biocontrol agent, spray and / or irrigate the roots of blue indigo fruit; The biocontrol agent is the biocontrol agent according to claim 5 or the biocontrol agent prepared according to the preparation method according to claim 6.
8. The method according to claim 7, characterized in that The biocontrol agent is diluted 50 to 150 times.
Citation Information
Patent Citations
Pseudomonas chlororaphis subsp. Aurantiaca mutant strain and application thereof
CN113088476A