Cellulase mutant

By mutation of the amino acid sequence of cellulase, especially V45A mutation, the specific vitality of cellulase is improved, the problem of high production cost of cellulase is solved, and its application in the industrial field is promoted.

CN120173922AActive Publication Date: 2025-06-20WEIFANG KANGDIEN BIOTECH LTD
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510673747.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-23
Publication Date
2025-06-20
Estimated Expiration
2045-05-23

AI Technical Summary

Technical Problem

The production cost of existing cellulases is high and it is difficult to widely use in the industrial field.

Method used

By mutating the amino acid sequence of the cellulase, especially mutating the Val at position 45 into Ala, the cellulase mutant is constructed and recombinantly expressed in Trichoderma reesei, thereby improving the specific vitality of the enzyme.

Benefits of technology

The specific vitality of cellulase mutants at 50°C was increased by 22.78%, reducing production costs and contributing to their widespread use in the industrial field.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The invention relates to the technical field of genetic engineering and protein engineering modification, in particular to a cellulase mutant. Compared with wild cellulase, the specific activity of the V45A single-point mutant provided by the invention is improved by 22.78% under the condition of 50 DEG C, the production cost of the cellulase can be effectively reduced, the enzyme dosage is reduced, and wide application of the V45A single-point mutant in the industrial field is promoted.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering and protein engineering modification, and particularly relates to a cellulase mutant. Background Art

[0002] Lignocellulose is the most abundant renewable resource in nature, mainly composed of cellulose (40 - 50%), hemicellulose (20 - 30%) and lignin (15 - 25%). Among them, cellulose is a linear polymer of glucose linked by β-1,4-glycosidic bonds, forming a highly crystalline microfibril structure; hemicellulose is a heterogeneous polysaccharide containing monomers such as xylose and mannose; lignin is a complex aromatic polymer composed of phenylpropane units, which crosslinks with carbohydrates through covalent bonds to form a dense barrier. This complex structure results in extremely strong anti-degradability of lignocellulose, becoming the main bottleneck for its industrial utilization.

[0003] Traditional degradation methods (such as acid / alkali treatment, high temperature and high pressure, etc.) have problems such as high energy consumption, large pollution, and product inhibition. In contrast, enzymatic degradation has become a research hotspot due to its mild conditions, strong specificity, environmental friendliness and other advantages, and cellulase is the core catalyst in this process.

[0004] Cellulase is a complex inducible enzyme system composed of multiple hydrolases, referring to the general name of a group of enzymes that can degrade cellulose to produce small molecule substances such as cellobiose and glucose, and can directly degrade the most abundant cellulose in lignocellulose into directly utilizable energy. It has been widely used in industries such as food processing, textile industry, paper production, feed additive, biofuel manufacturing and detergent, and has important industrial value.

[0005] The production of cellulase currently mainly relies on microbial fermentation methods, including enzyme-producing strains such as bacteria, fungi and actinomycetes. Among them, filamentous fungi such as Trichoderma (such as Trichoderma reesei) and Aspergillus (such as Aspergillus niger) have become the mainstream industrial strains due to their high enzyme-producing ability. The production adopts two processes: solid-state fermentation and liquid deep fermentation, and the latter is more conducive to large-scale control. In recent years, genetic engineering and metabolic engineering technologies have significantly improved the enzyme-producing efficiency of strains, helping to reduce the production cost of cellulase and promoting its wide application. Summary of the Invention

[0006] In view of this, the present invention provides a cellulase mutant. Compared with the wild type, the specific activity of the mutant is significantly improved, which can effectively reduce the production cost of cellulase and promote its wide application in industrial fields such as textiles.

[0007] On the one hand, the present invention relates to a cellulase mutant, which is obtained by mutating the 45th amino acid of the cellulase with the amino acid sequence of SEQ ID NO:1 from Val to Ala.

[0008] The present invention also relates to a DNA molecule encoding the above-mentioned cellulase mutant.

[0009] The present invention also relates to a recombinant expression plasmid containing the above DNA molecule.

[0010] The present invention also relates to a host cell containing the above recombinant expression plasmid.

[0011] Transferring the above plasmid into a host cell significantly improves the specific activity of the recombinantly expressed cellulase mutant.

[0012] In some embodiments of the present invention, the host cell is Trichoderma reesei ( Trichoderma reesei ).

[0013] Compared with the wild-type cellulase NT45, the specific activity of the V45A single-point mutant provided by the present invention is increased by 22.78% under the condition of 50 °C, achieving an unexpected technical effect.

[0014] The specific activity of the cellulase mutant described in the present invention is greatly improved compared with the wild-type, which can effectively reduce the production cost of cellulase, reduce the enzyme dosage, and is conducive to promoting its wide application in the industrial field. Detailed implementation manners

[0015] The present invention uses conventional techniques and methods in the fields of genetic engineering and molecular biology, such as the methods described in MOLECULAR CLONING: A LABORATORY MANUAL, 3nd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, the present invention is not limited to any specific method, experimental protocol, or reagent described above.

[0016] The formulation of the culture medium used in the examples of the present invention is as follows: LB + Amp culture medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0; Upper layer culture medium: 0.1% MgSO4, 1% KH2PO4, 0.6% (NH4)2SO4, 1% glucose, 18.3% sorbitol, 0.35% agarose; Lower layer culture medium: 2% glucose, 0.5% (NH4)2SO4, 1.5% KH2PO4, 0.06% MgSO4, 0.06% CaCl2, 1.5% agar; Fermentation medium: 1.5% glucose, 1.7% lactose, 2.5% corn steep liquor, 0.44% (NH4)2SO4, 0.09% MgSO4, 2% KH2PO4, 0.04% CaCl2, 0.018% Tween 80, 0.018% trace elements.

[0017] The present invention will be described in detail below in conjunction with specific embodiments.

[0018] Example 1 Screening of cellulase mutants In order to improve the specific activity of wild-type cellulase NT45 (amino acid sequence is SEQ ID NO: 1, encoding nucleotide sequence is SEQ ID NO: 2), the applicant carried out a large number of mutation screenings on the amino acids near the active site of this enzyme.

[0019] Using the wild-type cellulase NT45 gene (SEQ ID NO: 2) as a template, mutation sites were designed using AI technology. Primers upstream and downstream of the mutation sites were synthesized by Shanghai Sangon Biological Engineering Co., Ltd. The upper and lower arms of the mutation sites were respectively amplified by PCR using the corresponding primers. The amplified products were recovered by gel electrophoresis. The upper arm, lower arm, and vector were ligated in a PCR instrument at 50°C for 0.5 - 1 h using U-cloning, and then transformed into Escherichia coli BL21(DE3). They were spread on an LB + Amp plate and cultured overnight at 37°C in an inverted position. After the transformants appeared, they were individually picked with toothpicks into a 96-well plate. 150 μL of LB + Amp medium containing 0.1 mM IPTG was added to each well, and cultured at 37°C and 220 rpm for about 6 h. The supernatant was discarded by centrifugation, and the cells were resuspended with buffer. The cells were broken by repeated freezing and thawing to obtain an Escherichia coli cell lysate containing cellulase.

[0020] 50 μL of the lysate was taken out and transferred to two new 96-well plates. The cellulase activity and protein content were measured at 50°C respectively, and the specific activities of different mutants were calculated.

[0021] The experimental results showed that some mutations had no effect on the specific activity of cellulase at 50°C, some mutations even made its specific activity worse, and some mutations could improve the specific activity of cellulase, but their enzymatic properties changed significantly after mutation, and these did not meet the requirements. Finally, the applicant obtained a mutation site with a significantly improved specific activity at 50°C: V45A.

[0022] Based on the wild-type cellulase NT45, the present invention provides a cellulase mutant containing a single mutation site V45A.

[0023] Example 2 Expression of cellulase mutants in Trichoderma reesei According to the codon preference of Trichoderma reesei, the gene sequences of wild-type cellulase NT45 and its mutants were optimized and synthesized.

[0024] 2.1 Construction of expression plasmid Using the cellulase NT45 gene (SEQ ID NO: 2) as a template, Shanghai Sangon Biological Engineering Technology & Services Co., Ltd. synthesized the upstream and downstream primers of the mutation site. The upper and lower arms of the mutation site were amplified by PCR using the corresponding primers, and the amplified products were recovered by gel extraction. The upper arm, lower arm, and vector were ligated in a PCR instrument at 50 °C for 0.5 - 1 h using U-cloning. The ligation product was transformed into Escherichia coli DH5α, incubated for 0.5 h, and then spread on an LB + Amp plate and cultured overnight at 37 °C in an inverted position. Then, colony PCR was performed to screen the transformants, and the positive transformants were selected for sequencing. The strains with correct sequencing were cultured in an LB + Amp liquid medium at 37 °C and 220 rpm for 14 h, and then the plasmids were extracted using the OMEGA Plasmid Mini Kit to obtain the recombinant plasmids containing the target cellulase gene.

[0025] 2.2 Preparation of protoplasts Take the spore suspension of the cellulase gene-deficient host strain Trichoderma reesei and inoculate it on a PDA plate, and culture it at 30 °C for 6 days; after it is rich in spores, cut a colony of about 1 cm × 1 cm and place it in a liquid medium containing 120 mL of YEG + U (0.5% yeast powder, 1% glucose, 0.1% uridine), and culture it at 30 °C and 220 rpm for 14 - 16 h; filter and collect the mycelium with sterile gauze and wash it once with sterile water; place the mycelium in a triangular flask containing 20 mL of 10 mg / mL lytic enzyme solution (Sigma L1412), and act on it at 30 °C and 90 rpm for 1 - 2 h; observe and detect the progress of protoplast transformation under a microscope.

[0026] Add 20 mL of pre-cooled 1.2 M sorbitol (1.2 M sorbitol, 50 mM Tris-Cl, 50 mM CaCl2) to the above triangular flask, gently shake it well, filter and collect the filtrate with a sterile Miracloth filter, centrifuge it at 3000 rpm and 4 °C for 10 min; discard the supernatant, add 5 mL of pre-cooled 1.2 M sorbitol solution to suspend the cells, centrifuge it at 3000 rpm and 4 °C for 10 min; discard the supernatant, and add an appropriate amount of pre-cooled 1.2 M sorbitol to suspend and aliquot (200 μL / tube, the protoplast concentration is 10 8 cells / mL).

[0027] 2.3 Transformation of expression plasmid and verification of strains All the following operations were carried out on ice. Take 10 μg of recombinant plasmid and add it to a sterile 7 mL centrifuge tube containing 200 μL of protoplast solution. Then add 50 μL of 25% PEG (25% PEG, 50 mM Tris-HCl, 50 mM CaCl2), flick the bottom of the tube to mix well, and place it on ice for 20 min; add 2 mL of 25% PEG, mix well and place it at room temperature in a laminar flow hood for 5 min; add 4 mL of 1.2 M sorbitol, gently mix and pour it into the upper medium that has been melted and maintained at 55 °C; gently mix and spread it on the prepared lower medium, and culture it at 30 °C for 5 - 7 d until transformants grow out. Pick the transformants onto the lower medium plate for rescreening, culture it at 30 °C for 2 d, and the strain with a relatively smooth colony edge morphology is the positive transformant.

[0028] Take an appropriate amount of mycelium and place it in a 2 mL centrifuge tube, add 100 mg of sterile quartz sand and 400 μL of extraction buffer (100 mM Tris-HCl, 100 mM EDTA, 250 mM NaCl, 1% SDS); vigorously shake it with a bead beater for 2 min; after a 20 min water bath at 65 °C, add 200 μL of 10 M NH4AC, and place it in an ice bath for 10 min; centrifuge at 13000 rpm for 10 min; take the supernatant, add 2 volumes of absolute ethanol, place it at -20 °C for 30 min; centrifuge at 13000 rpm for 10 min, discard the supernatant; wash it twice with 70% ethanol; air dry, dissolve it in water, and store it at -20 °C.

[0029] Using the genomic DNA of the above-mentioned extracted transformant as a template, primers M6-F and M6-R were used for PCR amplification to verify the target gene.

[0030] M6-F: ATGCGCTCCTCCACCATTC (as shown in SEQ ID NO: 3); M6-R: TTAGGCGCACTGGTGGTAGTAGTC (as shown in SEQ ID NO: 4).

[0031] The PCR amplification conditions were 94 °C for 4 min; 94 °C for 40 s; 58 °C for 40 s, 72 °C for 1 min, for 30 cycles; 72 °C for 7 min, 16 °C; the PCR amplification product was recovered using a gel recovery kit and subjected to sequencing analysis.

[0032] According to the above method, the applicant respectively constructed Trichoderma reesei engineering strains expressing recombinant cellulase NT45 and its mutants.

[0033] Example 3 Fermentation Verification Inoculate the Trichoderma reesei engineering strain constructed above onto a solid PDA 6-well plate and culture it at 30 °C for 5 - 7 d. After abundant spore production, use a cotton swab to inoculate spores with an area of approximately 1 cm × 1 cm into a 24-well plate (each well of the 24-well plate contains 2.5 mL of fermentation medium), and first culture it at 30 °C and 500 rpm for 48 h, then culture it at 25 °C and 500 rpm for 72 h. Centrifuge the fermentation broth at 4 °C and 3700 r / min for 3 min to obtain the fermentation supernatant containing cellulase NT45 and its mutants. Measure the cellulase activity and protein content of the supernatant respectively, and calculate the specific activity.

[0034] 3.1 Determination of enzyme activity (1) Definition of cellulase activity Under the conditions of 50 °C and a pH value of 6.0, the amount of enzyme required to release 1 μmol of reducing sugar per minute from a sodium carboxymethyl cellulose solution with a concentration of 5 mg / ml is defined as one enzyme activity unit U, and the reducing sugar is equivalent to glucose.

[0035] (2) Method for determining cellulase Take three test tubes and add 0.5 mL of CMC substrate to each, and preheat them in a 50 °C water bath with the enzyme solution to be tested for 5 min. Add 0.5 mL of the solution to be tested to the first and second test tubes respectively, and start timing. React in a 50 °C water bath for 15 min. After the reaction, add 1.5 mL of DNS reagent to each of the three test tubes, and add an additional 0.5 mL of the enzyme solution to be tested to the third test tube. Take out and shake the three test tubes well, and then react in a boiling water bath for 5 min. Quickly cool to room temperature and make up to 5.0 mL with water. Using the test solution in the third test tube as a control, measure the absorbance of the test solutions in the first and second test tubes at a wavelength of 540 nm. The absorbance is preferably between 0.25 - 0.35. The absolute value of the difference between the absorbance of the reaction solution of the enzyme solution to be tested and the absorbance of the reaction solution of the level control enzyme solution does not exceed 0.015.

[0036] Enzyme activity: X = (equivalent value of glucose / 180 / 15 / 0.5) × n.

[0037] Where: X - enzyme activity unit, IU / g (mL); 180 - conversion of glucose from micrograms to micromoles; 15 - reaction time of the test solution and the substrate; 0.5 - amount of the enzyme solution to be tested added to the reaction; n - dilution factor.

[0038] 3.2 Determination of protein content The Bradford method for determining protein content is a composite method combining colorimetry and pigment method. Coomassie Brilliant Blue G-250 is brownish-red in acidic solution and turns blue when combined with proteins. It conforms to Beer's law within a certain protein concentration range and can be colorimetrically determined at 595 nm. A large amount of absorption occurs within 3 - 5 minutes and remains stable for at least 1 h. Within the range of 10 - 1000 μg / mL, the absorbance value is proportional to the protein concentration.

[0039] Mix according to the volume ratio of enzyme solution to Coomassie Brilliant Blue solution of 1:5, and let it stand for 10 min. Determine the protein content by the Bradford method.

[0040] 3.3 Calculation of specific activity "Specific Activity" refers to: the number of enzyme activity units per unit weight of protein, generally expressed as U / mg protein. Generally speaking, the higher the specific activity of an enzyme, the purer the enzyme.

[0041] Specific activity calculation formula: Specific activity (U / mg) = Enzyme activity (U / mL) / Protein content (mg / mL).

[0042] The specific activity of the fermentation supernatant of the Trichoderma reesei engineering bacteria expressing recombinant cellulase NT45 and its mutants constructed in the present invention at 50 °C is shown in Table 1.

[0043] Table 1 Specific activity of cellulase NT45 and its mutants at 50 °C Cellulase Specific activity at 50 °C (U / mL) Cellulase NT45 180.0 Single-point mutation V45A 221.0 It can be seen from the results in Table 1 that compared with the wild-type cellulase NT45, the specific activity of the V45A single-point mutation provided by the present invention at 50 °C has increased by 22.78%, achieving an unexpected technical effect.

[0044] The significant increase in the specific activity of the cellulase mutants provided by the present invention is beneficial to reducing the production cost of this enzyme, thereby promoting its wide application in the industrial field.

Claims

1. A cellulase mutant, characterized in that, The mutant is obtained by mutating the 45th amino acid of the cellulase with the amino acid sequence of SEQ ID NO: 1 from Val to Ala.

2. A DNA molecule encoding the cellulase mutant according to claim 1.

3. A recombinant expression plasmid containing the DNA molecule according to claim 2.

4. A host cell, characterized in that, The host cell comprises the recombinant expression plasmid according to claim 3.

5. The host cell according to claim 4, characterized in that, The host cell described is Trichoderma reesei ( Trichoderma reesei ).

Citation Information

Patent Citations

  • Low temperature resistant cellulase mutant

    CN112795554A

  • High-specific-activity cellulase mutant and application thereof

    CN112795555A

  • Continuous endo-cellulase mutant based on consensus mutation and structural guidance

    CN117568316A

  • Endoglucanase mutant with acid resistance and application thereof

    CN119506253A