Application of myostatin gene and its mutants in regulating growth and molting of macrobrachium rosenbergii

By discovering a 24bp deletion mutant of the Mstn gene in giant freshwater prawns, and using RNA interference agents to regulate the JH signaling pathway and Smad pathway, the problems of uneven growth and high mortality rate during molting in giant freshwater prawn farming were solved. This achieved synergistic regulation of growth and molting, improving farming efficiency and survival rate.

CN120173960BActive Publication Date: 2025-11-21PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510378657.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-03-27
Publication Date
2025-11-21
Estimated Expiration
2045-03-27

AI Technical Summary

Technical Problem

Giant freshwater prawn (Macrobrachium rosenbergii) farming suffers from problems such as uneven growth, high molting mortality, and loose meat quality. Existing RNAi technology has failed to achieve growth stage-specific regulation, and mutant resources have not been developed and utilized.

Method used

By discovering a 24bp deletion mutant of the Mstn gene in the giant freshwater prawn, we used RNA interference agents to regulate the JH signaling pathway and the Smad pathway to achieve synergistic regulation of growth and molting, including knocking down or promoting Mstn gene expression to control the growth and molting cycle.

Benefits of technology

It enables precise control over the growth of giant freshwater prawns, reduces feed waste, increases unit yield, lowers molting mortality, increases survival rate, meets the demands of high-end markets, shortens the breeding cycle, and improves capital turnover.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120173960B_ABST
    Figure CN120173960B_ABST
Patent Text Reader

Abstract

The application provides application of a myostatin gene and a mutant thereof in regulating growth and ecdysis of Macrobrachium rosenbergii. Specifically disclosed are a 24bp mutant of a promoter region of a Macrobrachium rosenbergii (Mstn) gene and a function thereof. It is proved by RNA interference technology that the mutant significantly affects growth speed and ecdysis cycle of shrimps by regulating muscle development and ecdysis pathways. Experiments show that knockdown of the mutant leads to a decrease of 45.67% to 66.67% in weight of the shrimps, a prolongation of more than 4.5 days in ecdysis cycle, and abnormal expression of ecdysis-related genes (Kr-h1, RXR, ECR). The application provides a new target for studying growth and ecdysis mechanism of crustaceans and has application potential in aquaculture.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of biological medicine, in particular to the application of myostatin gene and its mutant in regulating the growth and molting of Macrobrachium rosenbergii. BACKGROUND

[0002] Macrobrachium rosenbergii (Mr) is one of the largest freshwater prawns in the world, with high economic value and good breeding benefits, and is deeply loved by people. According to the statistics of China Fishery Statistical Yearbook 2024, the yield of Macrobrachium rosenbergii breeding in China in 2023 exceeded 196,300 tons (Ministry of Agriculture and Rural Affairs, 2024).

[0003] In the prior art, there are problems such as uneven growth, high molting mortality, and loose meat in the breeding of Macrobrachium rosenbergii (Lu et al., 2018). The functional research of Mstn in crustaceans is limited to muscle regeneration (Sarasvathi et al., 2019), and the molecular mechanism of its regulation of growth and molting is unknown. The existing RNAi technology has not realized the specific regulation of the growth stage, and the mutant resources have not been developed and utilized.

[0004] Therefore, it is necessary to develop a method for regulating the growth and molting of Macrobrachium rosenbergii. SUMMARY

[0005] The present application aims to provide the application of myostatin gene and its mutant in regulating the growth and molting of Macrobrachium rosenbergii. The present application first discovers a 24bp deletion mutant in the Mstn promoter region of Macrobrachium rosenbergii, and proves through experiments that it realizes the growth-molting synergistic regulation by regulating the JH signal pathway and the Smad pathway.

[0006] To achieve the above-mentioned purpose, the present application adopts the following technical solutions:

[0007] In the first aspect of the present application, the application of Macrobrachium rosenbergii Mstn gene in regulating the growth and molting cycle of Macrobrachium rosenbergii is provided, characterized in that the sequence of the Macrobrachium rosenbergii Mstn gene is shown in SEQ ID NO. 1.

[0008] Further, the regulation of the growth of Macrobrachium rosenbergii includes:

[0009] Knocking down the Macrobrachium rosenbergii Mstn gene slows down the growth of Macrobrachium rosenbergii in the later stage, or promoting the expression of the Macrobrachium rosenbergii Mstn gene promotes the growth of Macrobrachium rosenbergii, thereby regulating the growth of Macrobrachium rosenbergii;

[0010] The method for regulating the molting cycle of the Macrobrachium rosenbergii comprises: knocking down the Mstn gene of the Macrobrachium rosenbergii to prolong the molting cycle of the Macrobrachium rosenbergii.

[0011] In the second aspect of the present application, a mutant of the Mstn gene of the Macrobrachium rosenbergii is provided, the sequence of the gene of the mutant of the Mstn gene of the Macrobrachium rosenbergii is shown in SEQ ID NO. 2, and compared with the Mstn gene of the Macrobrachium rosenbergii shown in SEQ ID NO. 1, the mutant has a 24 bp deletion in the 5'UTR region.

[0012] In the third aspect of the present application, the mutant of the Mstn gene of the Macrobrachium rosenbergii is provided for use in regulating the growth and molting cycle of the Macrobrachium rosenbergii.

[0013] Further, the method for regulating the growth of the Macrobrachium rosenbergii comprises: knocking down the mutant of the Mstn gene of the Macrobrachium rosenbergii to slow down the growth and molting cycle of the Macrobrachium rosenbergii in the later stage, or promoting the expression of the mutant of the Mstn gene of the Macrobrachium rosenbergii to promote the growth of the Macrobrachium rosenbergii, thereby regulating the growth of the Macrobrachium rosenbergii.

[0014] The method for regulating the molting cycle of the Macrobrachium rosenbergii comprises: knocking down the mutant of the Mstn gene of the Macrobrachium rosenbergii to prolong the molting cycle of the Macrobrachium rosenbergii.

[0015] In the fourth aspect of the present application, a method for regulating the growth and molting cycle of the Macrobrachium rosenbergii is provided, and the RNA interference agent of the Mstn gene of the Macrobrachium rosenbergii or the mutant of the Mstn gene of the Macrobrachium rosenbergii is injected into the Macrobrachium rosenbergii.

[0016] The one or more technical solutions in the embodiments of the present application have at least the following technical effects or advantages:

[0017] 1. The present application first discovers the mutant of the Mstn gene of the Macrobrachium rosenbergii, and then takes the 24 base mutant of the Mstn gene and the promoter region thereof as the research object, and carries out the regulation research of the Mstn gene and the mutant thereof in the Macrobrachium rosenbergii, thereby providing the theoretical basis for analyzing the function of the Mstn of the crustacean. The spatiotemporal expression result of the Mstn gene shows that the gene is expressed in the embryonic development and the body tissue, and the expression level in the gastrula stage and the hepatopancreas is the highest; in the molting cycle, the expression level of the gene from high to low is in the post-molting stage (A stage), the pre-molting stage (D3 stage) and the molting stage (E stage). The knockdown result of the two genotypes (normal and deletion) in the promoter region of the gene shows that the growth rate of the shrimps after the knockdown of the two Mstn genotypes is significantly lower than that of the non-knockdown group, and the average molting cycle is significantly higher than that of the non-knockdown group;

[0018] 2, The results of the detection of three ecdysis-related genes show that Mstn affects the expression of ecdysis-related genes. The results of the knockdown test on the F2 generation of the two knockdown groups also show that the knockdown of the promoter region of the gene prolongs the molting cycle of the shrimps and causes the growth of the Macrobrachium rosenbergii to be slow. The present application determines the function of the Mstn gene and the mutant of the Mstn gene of the Macrobrachium rosenbergii in the growth and ecdysis of the shrimps, and lays a foundation for exploring the regulation mechanism of the gene in the crustaceans.

[0019] 3, The mutant of the Mstn gene of the Macrobrachium rosenbergii and the interference reagent thereof in the present application have great application prospects in the precise control of the growth cycle and the molting cycle regulation and the synchronized breeding management. BRIEF DESCRIPTION OF DRAWINGS

[0020] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings needed in the embodiment description will be briefly introduced as follows. Obviously, the drawings in the following description are some embodiments of the present application, and other drawings can also be obtained by those skilled in the art without any creative effort on the basis of these drawings.

[0021] Figure 1 Nucleotide and deduced amino acid sequence of MrMstn cDNA. Black numbers on the left side of each line represent the position of nucleotides, and red numbers represent the position of amino acids. The yellow highlighted area in the promoter region is the predicted auxin response element (AACGAC), the red highlighted area is the common cis-acting element (CCAAT) in the promoter and enhancer region, and the green highlighted area is the short sequence element (ATCTACGCTTCACG). The underlined area represents a 24bp deletion region (GTAACATCTACGCTTCACGCTCAG). In the amino acid region, the yellow highlighted area is the TGF-beta propeptide region, and the blue highlighted area is the mature TGF-beta region.

[0022] Figure 2 (A) Expression level of Mstn in different tissues, (B) Expression level of Mstn in different ecdysis stages, each letter represents a specific stage: E: ecdysis stage; A and B: post-ecdysis stage; C: inter-ecdysis stage; D1, D2 and D3: pre-ecdysis stage, (C) Expression level of Mstn in nine different embryonic stages. Different letters indicate significant differences between experimental groups at the same time point (p<0.05).

[0023] Figure 3 (A) Expression level of Mstn at 1, 3, 5, 7 and 14 days after injection of dsRNA; (B) Expression level of Mstn after injection of five different concentrations of dsRNA. Different letters and asterisks indicate significant differences between experimental groups at the same time (p<0.05).

[0024] Figure 4 (A) The weight trend of the dsRNA group and the control group within eight weeks. (B) The weight of the remaining Macrobrachium rosenbergii in each group was raised to 180 days. (C) The weight of the offspring after the experimental group and the control group were continuously injected with dsRNA for 8 weeks. (D) The liver-somatic index of the experimental group and the control group. Different letters indicate that there are significant differences between the experimental groups at the same time (p < 0.05).

[0025] Figure 5 (A) Muscle tissue of the control group. (B) Muscle tissue of group D. (C) Muscle tissue of group N. (D) The number of muscle fibers. (E) The average area of muscle fibers. Different letters indicate that there are significant differences between the experimental groups at the same time (p < 0.05).

[0026] Figure 6 (A) Krüppel-homolog 1 expression level, (B) retinoic acid-X receptor expression level, (C) ECR expression level. Different letters indicate that there are significant differences between the experimental groups at the same time (p < 0.05).

[0027] Figure 7 The average molting time of Macrobrachium rosenbergii after injection of dsRNA indicates that there are significant differences between the experimental groups at the same time (p < 0.05). DETAILED DESCRIPTION

[0028] The advantages and various effects of the present application will be more clearly presented from the following specific embodiments and examples. Those skilled in the art should understand that these specific embodiments and examples are used to illustrate the present application, not to limit the present application.

[0029] Throughout this specification, unless otherwise specifically indicated otherwise, the terms used herein are to be understood as having the meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as generally understood by those skilled in the art to which the present application belongs. If there is a contradiction, the present specification takes precedence.

[0030] Unless otherwise specifically stated, the various raw materials, reagents, instruments and equipment used in the present application can be purchased from the market or can be obtained by existing methods.

[0031] To solve the technical problems of the present application, the general idea of the present application is as follows:

[0032] The present application inventors found that the 533-557 bp of the 5'UTR region of the promoter of the Mstn gene of Macrobrachium rosenbergii has a 24 bp base natural mutation, and the molecular regulation mechanism of the natural mutation region on the growth and molting of Macrobrachium rosenbergii is still unclear. Therefore, this paper aims to clarify the molecular regulation mechanism of Mstn gene and its mutant in Macrobrachium rosenbergii, and to provide a basis for studying the function of Mstn gene in crustaceans.

[0033] That is, the present application finds a mutant of Mstn gene of Macrobrachium rosenbergii, the sequence of the mutant of Mstn gene of Macrobrachium rosenbergii is shown in SEQ ID NO. 2, compared with the Mstn gene of Macrobrachium rosenbergii shown in SEQ ID NO. 1, there is a 24 bp deletion in the 5'UTR region of the mutant.

[0034] Then, after the promoter region (SEQ ID NO. 5) of the normal Mstn gene of Macrobrachium rosenbergii and the mutant of Mstn gene of Macrobrachium rosenbergii were knocked down respectively, it was found that the growth rate of shrimps in the two groups was significantly lower than that in the non-knocking down group, and the average molting period was significantly higher than that in the non-knocking down group. It is shown that the promoter region of Mstn gene of Macrobrachium rosenbergii (including normal gene and mutant gene) is knocked down, which prolongs the molting period of shrimps and causes the growth rate of Macrobrachium rosenbergii to slow down.

[0035] According to the above conclusion, it can be applied in regulating the growth and molting of Macrobrachium rosenbergii. For example:

[0036] I. Reverse application: precise control of growth period

[0037] 1. Stage growth regulation

[0038] Application scenario: For the pain points of "rapid growth leading to sharp increase in feed cost" or "uneven size" in Macrobrachium rosenbergii breeding, stage growth inhibition can be achieved by regulating Mstn expression.

[0039] Technical path: Inject mutant dsRNA2 (5 μg / g) in the fry period to inhibit Mstn expression, slow down the growth of shrimps, and prolong the breeding period to the target size (such as 20 g per tail). Stop RNAi injection to restore Mstn expression 1-2 weeks before listing, promote rapid weight gain, and shorten the listing time.

[0040] Advantages: Reduce feed waste, improve unit output (such as increase 15%-20% per mu). Adapt to the demand of high-end market (such as special size gift shrimps).

[0041] 2. Regulation of off-season breeding

[0042] Application scenario: In the low-temperature season (such as winter), when natural growth is slow, use Mstn inhibitors to maintain the basic metabolism of shrimps, avoid excessive energy consumption, and grow rapidly after the water temperature rises.

[0043] Technical path: Inject low-dose dsRNA (2.5 μg / g / week) in winter to maintain the basic growth rate. Resume regular aquaculture management in spring.

[0044] Advantages: Shorten the annual aquaculture cycle and improve capital turnover.

[0045] Second, molting cycle regulation: Synchronized aquaculture management

[0046] 1. Batch production

[0047] Application scenario: The extension of the molting cycle by 4.5 days can break the natural molting synchronization of shrimps, and achieve batch molting and concentrated harvesting through artificial regulation.

[0048] Technical path: Inject mutant dsRNA in part of the shrimp population to extend the molting cycle of 50% of the individuals, and the other 50% remain normal. Harvest the shrimps with extended molting cycle in batches (such as harvesting twice with an interval of 7 days), to avoid the risk of "concentrated molting death" in traditional aquaculture.

[0049] Advantages: Improve survival rate (reduce molting period mortality), and increase annual yield by 20%.

[0050] 2. Disease prevention and control window period

[0051] Mechanism: The extension of the molting cycle may weaken the resistance of shrimps to pathogens (such as white spot disease and EMS), but this feature can also be used to stagger the high incidence period of diseases.

[0052] Application scenario: According to experimental data, the mortality rate of the mutant group is 12% lower than that of the control group in high-temperature periods (28°C). The mutant dsRNA can be injected in advance during the epidemic period of shrimps (such as summer) to delay molting to a safe period (such as after the water temperature drops).

[0053] The present application will be described in detail below in conjunction with examples and experimental data.

[0054] Example 1

[0055] I. Method

[0056] 1.1 Primer design

[0057] Using the transcriptome data of Macrobrachium rosenbergii obtained by the team (GenBank No: PRJNA884099), the Mstn gene cDNA sequence (sequence see Figure 1). The specific primers of the target gene Mstn, the reference gene β-actin and the ecdysis-related genes (Retinoid-X receptor, Krüppel-homolog 1 and Ecdysone Receptor) were designed using Primer Premier 5.0 (Premier, Canada) (Table 1).

[0058] Table 1

[0059]

[0060]

[0061] 1.2 Sample collection and detection of spatiotemporal expression of Mstn

[0062] The brain (including protocerebrum, mesocerebrum and metacerebrum), stomach, intestine, heart, hepatopancreas, muscle and gonad of Macrobrachium rosenbergii (body weight of 5 ± 0.32 g) were collected for the detection of Mstn in the body tissues of M. rosenbergii. The samples of unfertilized eggs, fertilized eggs, cleavage stage (8 cells), pre-multicellular morula stage (64 cells), early multicellular morula stage (128 cells), morula stage (256 cells), blastula stage, gastrula stage and larva stage were collected according to the method described by Zhao et al. (Zhao et al., 1998) for the detection of the expression level of Mstn in different embryonic development stages of M. rosenbergii. The muscle tissue samples of the pre-molting stage (D1, D2 and D3 stages), the molting stage (E stage), the post-molting stage 0-5 h (A stage), the post-molting stage 5-24 h (B stage) and the inter-molting stage (C stage) were collected according to the method described by Lu et al. (Lu et al., 2018) for the detection of the expression level of Mstn in different molting cycles of M. rosenbergii. The muscle tissue site was selected according to the research conclusion of Covi et al. (Covi et al., 2010) (the same below). The total RNA extraction, cDNA reverse transcription and fluorescence quantitative PCR detection were performed according to the method described by Wang et al. (Wang et al., 2023).

[0063] 1.3 Synthesis of Mstn dsRNA of M. rosenbergii and its injection

[0064] The target fragment of the special region of Mstn 5’UTR was obtained by PCR amplification using the upstream primer F1 and the downstream primer R1 of the Mstn gene.

[0065] The target fragment was ligated to the T7 (TaKaRa, China) vector and transformed into E. coli DH5a competent cells (TaKaRa, China). Normal and mutant positive monoclonal vectors were screened, sequenced and confirmed.

[0066] Normal Mstn dsRNA (referred to as N-Mstn dsRNA, as shown in SEQ ID NO. 3) and mutant Mstn dsRNA (referred to as D-Mstn dsRNA, as shown in SEQ ID NO. 4) were synthesized using the T7 RNAi Transcription Kit (Vazyme Biotech, China) and stored at -80°C for later RNAi experiments. All dsRNA injections in this experiment were performed under a stereomicroscope (Nikon, Japan), and the injection site was between the first and second abdominal segments.

[0067] 1.4 Optimal timing and injection dose detection of RNAi

[0068] Macrobrachium rosenbergii (0.86 ± 0.12 g) were injected with normal and mutant dsRNA at a concentration of 5 μg / g, and the control group was injected with DEPC water. Muscle samples were collected on days 1, 3, 5, 7 and 14. According to Covi's research conclusion (Covi et al., 2010), the chest muscle of Macrobrachium rosenbergii at the intermolt stage was selected. Total RNA was extracted and reverse transcribed into cDNA, which was stored at -20°C. The cDNA was used for Mstn dsRNA timing detection.

[0069] Based on the optimal timing detection results, the normal dsRNA was set to 0 μg / g, 5 μg / g, 10 μg / g, 20 μg / g, 40 μg / g and 100 μg / g, and was injected into Macrobrachium rosenbergii juvenile shrimp (0.86 ± 0.12 g) at the intermolt stage. Total RNA was extracted from muscle samples of Macrobrachium rosenbergii in each group 48 h after injection and reverse transcribed into cDNA, which was stored at -20°C. The cDNA was used for Mstn dsRNA concentration detection.

[0070] 1.5 Effect of MrMstn mutant region on growth and molting-related genes of Macrobrachium rosenbergii

[0071] According to the results of the RNAi time effect and dose effect experiments, the normal type and mutant type MrMstn dsRNA were injected into the juvenile Macrobrachium rosenbergii (body weight 0.02±0.00 g) at a concentration of 5 μg / g, and the control group was injected with DEPC water. The injection method was referred to the experimental method 2.3, and the injection frequency was once a week (for 8 W). Then, the normal feeding was carried out until 180 days to sexual maturity. Then, the Macrobrachium rosenbergii in each group were grouped and hatched after sexual maturity, and the F2 generation larvae were obtained. The F2 larvae (body weight 1.01±0.07 g) in each group were injected with the corresponding dsRNA (the normal type RNAi group F2 larvae were injected with the normal type dsRNA, the mutant type RNAi group F2 larvae were injected with the normal type dsRNA, and the control group F2 larvae were injected with DEPC water), and the concentration was 5 μg / g. The injection method was referred to the experimental method 2.3, and the injection frequency was once a week (for 8 W). The breeding cycle was 8 W.

[0072] During the injection of dsRNA in the F1 and F2 generations, the body weight of the Macrobrachium rosenbergii was detected every week, and in addition, the body weight of the F1 generation was measured again when it was fed for 24 weeks. The hepatopancreas of the Macrobrachium rosenbergii in the F1 generation for 8 weeks was collected for the detection of the expression levels of three molting related genes Krüppel-homolog 1, Retinoid-X receptor and Ecdysone Receptor (the primer sequences are shown in Table 1). The weight of the hepatopancreas and the body weight of the Macrobrachium rosenbergii in the F2 generation for 8 weeks were measured, and the hepatosomatic index (HSI) was calculated.

[0073] Hepatosomatic index (HSI, %)=100%×WL / WS

[0074] (WL is the hepatopancreas weight of the sampled shrimp, and WS is the body weight of the sampled shrimp)

[0075] 1.6 Histological analysis

[0076] Muscle samples of F2 generation of M. rosenbergii at 8 weeks in the intermolt stage were collected (collection site: pectoral muscle between the first and second abdominal segments), fixed with 4% paraformaldehyde, dehydrated, and then embedded in paraffin. Sections were cut using a Leica RM 2016 Microtomes paraffin sectioning machine (Leica, Weztlar, Germany) with a thickness of 5 pm. After paraffin sections were deparaffinated and dehydrated with xylene-ethanol, they were stained with hematoxylin-eosin (HE) solution (Nanjing Jiancheng Biological Engineering Institute, Nanjing, China), and the stained sections were sealed with neutral resin. Then, tissue information was obtained using a PANNORAMIC whole-slide scanner (3DHISTECH, Hungary), and 5 fields of view were randomly selected in the tissue sections using CaseViewer 2.4 software (3DHISTECH, Hungary). The number of muscle fibers and the corresponding tissue area in each field of view were calculated using Image-Pro Plus 6.0 analysis software (Media Cybemetics, USA) to calculate the average muscle fiber area and muscle fiber density.

[0077] Muscle fiber average area = muscle fiber area / muscle fiber number

[0078] Muscle fiber density = muscle fiber number / muscle fiber area

[0079] 1.7 Effect of MrMstn gene on the molting cycle

[0080] M. rosenbergii at the pre-molting stage (body weight 2.73 ± 0.99 g) were selected and injected with normal dsRNA, mutant dsRNA, and DEPC water, respectively, at a dose of 5 pg / g, with an injection frequency of once a week and a breeding cycle of two molting cycles (about 3 weeks). Each M. rosenbergii was individually raised in a 10*10*10 cm cage. The molting of each M. rosenbergii was observed and recorded daily, and the molting cycle of each group of M. rosenbergii was finally analyzed.

[0081] 1.8 Statistical analysis

[0082] Statistical analysis of the data was performed using SPSS 24.0 software (SPSS Corp., Armonk, NY, USA), and one-way ANOVA was used to compare the differences between the treatment data, with the results expressed as mean ± standard error. The mRNA abundance of the genes was calculated using the 2-△△Ct method (Livak et al., 2001). Mean comparisons were made at a significance level of 5%, with p>0.05 indicating no significant difference and p<0.05 indicating a significant difference.

[0083] 2 Results

[0084] 2.1 MrMstn cDNA and mutant sequence

[0085] The full-length cDNA sequence of the *Macrobrachium rosenbergii* (Mstn) gene is 2,706 bp, with an open reading frame (ORF) of 738 bp encoding 246 amino acids. The 5' UTR is 585 bp long, and the 3' UTR is 1,383 bp long. It contains a 119-amino acid propeptide domain and a 96-amino acid TGF-β mature peptide domain. CDNA sequence alignment of the *Mstn* gene revealed two cDNA sequences. The shorter sequence, compared to the longer sequence, has a 24 bp deletion (533 bp - 557 bp) in the 5' UTR region, and this deleted sequence contains a short sequence element (ATCTACGCTTCACG). Figure 1 ).

[0086] 2.2 Spatiotemporal expression analysis of the MrMstn gene

[0087] The expression levels of the Mstn gene in different body tissues of the giant freshwater prawn, from highest to lowest, are: hepatopancreas, muscle, heart, brain, intestine, gills, and gonads. Figure 2 A); During different embryonic developmental stages, this gene is expressed from the unfertilized egg stage, gradually increasing in the early multicellular morula (64 cells), then gradually decreasing, reaching its lowest level in the blastocyst stage, and subsequently rising to its highest level in the gastrula stage (p < 0.05); During the larval stage, the expression level of this gene stabilizes at a certain level ( Figure 2 B); In different molting cycles, the expression level of this gene significantly increased in the late molting stage A (0-5h after molting) (p<0.05), and then rapidly decreased in stage B (24-48h after molting), similar to the intermolting level, and then maintained a low expression level until the premolting stage D2, while its expression level slightly increased in stages D3 and E. Figure 2 C).

[0088] 2.3 Detection of the time- and dose-effect relationships of MrMstn dsRNA

[0089] To determine the optimal timing and dose-response effect of MrMstn dsRNA, different dsRNAs were injected into intermolting juvenile Macrobrachium rosenbergii. RNAi timing assays showed that both normal and mutant dsRNAs significantly reduced the expression level of the Mstn gene at 1d, 3d, and 5d (p < 0.05). At 7d, the Mstn expression level was significantly reduced in the mutant interference group (p < 0.05), while the expression level in the normal interference group decreased to 72.12%, with no significant difference. At 14d, there was no significant difference in Mstn expression levels among the groups (p > 0.05). Figure 3A) Dose-effect results showed that the expression level of Mstn was significantly reduced in high-dose interference groups (40 μg / g and 100 μg / g) and low-dose interference groups (5 μg / g, 10 μg / g and 20 μg / g) after injection of different concentrations of dsRNA into M. rosenbergii for 48 h (p<0.05), and the expression level of Mstn was reduced by 85.38% in the 5 μg / g group, which had the best interference effect Figure 3 B).

[0090] 2.4 Effect of interference of MrMstn on growth of different generations of M. rosenbergii

[0091] The results of 8W continuous interference growth of M. rosenbergii Mstn gene showed that there was no significant difference in body weight of M. rosenbergii among the mutant interference group, the normal interference group and the control group during 1W to 5W (p>0.05); the body weight of M. rosenbergii in the mutant interference group was significantly lower than that in the normal interference group and the control group from the 6th week (p<0.05); the body weight of the control group was significantly higher than that of the normal interference group (p<0.05) and extremely significantly higher than that of the mutant interference group (p=0.001) from the 7th week to the 8th week, and the body weight of the control group was 45.67% higher than that of the normal interference group and 66.67% higher than that of the mutant interference group at the 8th week Figure 4 A) The growth of M. rosenbergii normally fed to 24W showed that the body weight of M. rosenbergii in the control group was 23.80±3.24 g, and the body weight of M. rosenbergii in the mutant interference group and the normal interference group was 8.00±1.03 g and 8.94±2.14 g, respectively, and the body weight of M. rosenbergii in the control group was significantly higher than that in the two interference groups (p<0.05) Figure 4 B).

[0092] The results of 8W continuous interference growth of F2 generation larvae obtained from each group of F1 generation showed that there was no significant difference in body weight of M. rosenbergii among the three groups from 1W to 4W (p>0.05), and the body weight of M. rosenbergii in the normal interference group was higher than that in the control group and the mutant interference group at 2W and 3W; the body weight of M. rosenbergii in the control group was significantly higher than that in the mutant interference group (p<0.05) at 5W, and there was no significant difference in body weight of M. rosenbergii between the two interference groups (p>0.05); the body weight of M. rosenbergii in the non-interference group was significantly higher than that in the normal interference group and the mutant interference group (p<0.05) from 6W to 8W Figure 4 C) The results of liver-somatic index detection of 8W M. rosenbergii showed that the liver-somatic index of M. rosenbergii in the non-interference group was significantly higher than that in the normal interference group (p<0.05), and there was no significant difference in liver-somatic index of M. rosenbergii between the two interference groups (p>0.05) Figure 4 D).

[0093] 2.5 Effect of interference of MrMstn on muscle tissue of M. rosenbergii

[0094] The results of muscle tissue cross-section of three groups of shrimps showed that muscle fiber structure and its morphology were normal, muscle fibers were polygonal and arranged in parallel, and the boundary was clear; the cell nucleus was oval and located at the edge of muscle fiber Figure 5 A-C). In addition, the number of muscle fibers in the selected area was counted, and the results showed that the number of muscle fibers of non-interference group shrimp was 103±3.2, the number of muscle fibers of normal type interference group and mutant type interference group shrimp was 113±3.2 and 106±2.4 respectively, and there was no significant difference among the three groups (p>0.05) Figure 5 D); the muscle fiber area results showed that the muscle fiber area of non-interference group shrimp was 0.46±0.01 mm 2 , the muscle fiber area of mutant type interference group shrimp was 0.47±0.01 mm 2 , the muscle fiber area of normal type interference group shrimp was 0.44±0.01 mm 2 , and there was no significant difference among the three groups (p>0.05) Figure 5 E).

[0095] 2.6 Expression detection of molting related genes of Macrobrachium rosenbergii

[0096] The expression level of molting related genes of Macrobrachium rosenbergii juvenile shrimp in the molting interval was detected, and the results showed that the expression level of Kr-h1 gene of the control group shrimp was significantly lower than that of the normal type interference group and the mutant type interference group (p<0.05) Figure 6 A), and the expression level of RXR gene was significantly higher than that of the two interference groups (p<0.05), in addition, the expression level of ECR gene of the control group shrimp was significantly higher than that of the mutant type interference group (p<0.05) and extremely significantly higher than that of the normal type interference group (p=0.001) Figure 6 B and C).

[0097] 2.7 Effect of MrMstn interference on molting cycle of Macrobrachium rosenbergii

[0098] The results of molting cycle change of Macrobrachium rosenbergii under the conditions of normal type and mutant type genotypes interference showed that the molting cycle days of non-interference group shrimp was 12.38±0.66d, the molting cycle days of mutant type interference group shrimp was 16.76±0.43d, and the molting cycle days of normal type interference group shrimp was 16.92±0.71d; the molting cycle days of mutant type interference group and normal type interference group were 4.6d and 4.5d slower than that of non-interference group respectively, and the two interference groups were significantly slower than the non-interference group (p<0.05) Figure 7 ).

[0099] In summary,

[0100] (1) This study first found that there was a 24 bp natural deletion in the Mstn promoter region of Macrobrachium rosenbergii, and RNAi experiments showed that its knockdown significantly inhibited growth and prolonged the molting cycle (about 4.5 days), while the expression of molting-related genes was abnormal. It is suggested that Mstn may affect the growth of crustaceans by regulating muscle development and molting pathways, providing a new direction for analyzing the multifunctional mechanism of Mstn.

[0101] (2) Ecdysone receptor (ECR) combines with retinoic acid X receptor (RXR) to form a heterodimer, and ecdysone exerts its molting function through the heterodimer it forms (Li et al., 2014). In this experiment, the down-regulation of ECR and RXR gene expression levels indicates that the molting of Macrobrachium rosenbergii may have been inhibited. Kr-h1 encodes a transcription factor containing a C2H2 zinc finger structure that regulates the synthesis of juvenile hormone (Jh) (Kayukawa et al., 2015), and Jh has similar functions to molting, metamorphosis, and diapause in crustaceans (Miyakawa et al., 2014). The significant changes in Kr-h1 indicate that Mstn affects the molting of Macrobrachium rosenbergii. In summary, the significant changes in these three molting-related genes indicate that although Mstn may not have a direct relationship with these genes, the differential expression between the control group proves that Mstn affects the molting process through molecular regulation.

[0102] (3) In mammals, both mutations and silencing of the Mstn gene can observe typical muscle fiber proliferation or hypertrophy (Bouyer et al., 2014; Qian et al., 2015; Crispo et al., 2015; Lv et al., 2016). In this study, two knockdown experiments were conducted on natural mutant genotypes and normal genotypes, and the results from three aspects of muscle fiber number, muscle fiber area, and muscle fiber density showed that Macrobrachium rosenbergii did not produce a "double muscle" phenomenon ( Figure 6 ), while the knockdown of both genotypes caused the growth of Macrobrachium rosenbergii to stop at a later stage ( Figure 4 ), which is similar to the results of the study on Litopenaeus vannamei (Ji-Hyun et al., 2015), but inconsistent with the results of the study on Fenneropenaeus chinensis (Yan et al., 2020); In addition, through the expression level detection of Kr-h1, RXR and ECR molting-related genes, it was found that the expression levels of the three genes changed significantly before and after the knockdown ( Figure 6 ), and the molting cycle of Macrobrachium rosenbergii after the knockdown was significantly prolonged ( Figure 7 ), indicating that the Mstn gene promoter mutation region plays a role in regulating the growth and molting of Macrobrachium rosenbergii.

[0103] Application Example 1

[0104] I. Preparation of the Phase Growth Regulator

[0105] Raw materials: mutant dsRNA (5 μg / g), DEPC water.

[0106] Process: T7 RNA polymerase in vitro transcription, dissolved in PBS buffer after purification.

[0107] Application: Inject once a week for 4 weeks during the shrimp fry stage; stop injection 2 weeks before marketing.

[0108] Effect: The weight decreased by 45.67% compared with the control group after 8 weeks, but the growth efficiency increased by 18% after 12 weeks Figure 4 A).

[0109] II. Molting Synchronization Management System

[0110] Process: Divide the shrimp group into an experimental group (injected with mutant dsRNA) and a control group.

[0111] Record the molting rate every 7 days, and the experimental group delays molting for 4.5 days.

[0112] Harvest the experimental group shrimp 5 days before the control group enters the molting period Figure 7 ).

[0113] Benefit: Increase the delivery frequency by 50% and reduce the mortality rate by 18%.

[0114] Finally, it should be noted that the terms "comprising", "including", or any other variant thereof, are intended to cover a non-exclusive inclusion, such that a process, method, article, or apparatus that comprises a list of elements does not include only those elements, but can also include other elements not expressly listed or inherent to such process, method, article, or apparatus.

[0115] Although the preferred embodiments of the present application have been described, those skilled in the art who understand the basic inventive concept can make further changes and modifications to the embodiments. Therefore, the appended claims are intended to cover the preferred embodiments and all changes and modifications falling within the scope of the present application. Obviously, those skilled in the art can make various modifications and variations to the present application without departing from the spirit and scope of the present application. Thus, if these modifications and variations of the present application fall within the scope of the claims of the present application and their equivalents, the present application is also intended to include these modifications and variations.

Claims

1. The use of knocking down the Mstn gene of Daphnia pulex in slowing down the growth and prolonging the molting cycle of Daphnia pulex, characterized in that, The sequence of the Mstn gene of Macrobrachium rosenbergii is shown as SEQ ID NO.

1.

2. Use according to claim 1, characterized in that, The substance for knocking down the Mstn gene of Macrobrachium rosenbergii comprises dsRNA1, and the nucleotide sequence of the dsRNA1 is shown as SEQ ID NO.

3.

3. A mutant of Mstn gene of Macrobrachium rosenbergii, characterized in that, The sequence of the gene of the mutant of the Mstn gene of Macrobrachium rosenbergii is shown as SEQ ID NO. 2, and compared with the Mstn gene of Macrobrachium rosenbergii shown as SEQ ID NO. 1, the mutant has a 24 bp deletion in the 5'UTR region.

4. Use of the mutant of the Mstn gene of Macrobrachium rosenbergii for claim 3 in slowing down the growth of Macrobrachium rosenbergii and prolonging the molting cycle.

5. Use according to claim 4, characterized in that, The substance for knocking down the mutant of the Mstn gene of Macrobrachium rosenbergii comprises dsRNA2, and the nucleotide sequence of the dsRNA2 is shown as SEQ ID NO.

4.

6. A method of slowing the growth and prolonging the molting cycle of Macrobrachium rosenbergii, characterized in that, Injecting the RNA interference agent of the Mstn gene of Macrobrachium rosenbergii or the mutant of the Mstn gene of Macrobrachium rosenbergii into Macrobrachium rosenbergii, wherein the sequence of the Mstn gene of Macrobrachium rosenbergii is shown as SEQ ID NO. 1, and the sequence of the mutant of the Mstn gene of Macrobrachium rosenbergii is shown as SEQ ID NO.

2.

7. The method of claim 6, wherein, The RNA interference agent comprises dsRNA, and the concentration of the dsRNA is 5 µg / g, and the injection cycle is once a week.