Application of muskmelon CmOFP8L gene in regulation and control of muskmelon fruit elongation

Abstract

The invention discloses an application of a muskmelon CmOFP8L gene in regulation and control of muskmelon fruit elongation. The invention finds that CmOFP8L is knocked out by using a gene editing technology, mutant fruits with lost gene functions are remarkably lengthened, overexpressed fruits are remarkably shortened, and the overall growth vigor and other characters of plants are not influenced, so that the CmOFP8L gene has an important regulation and control effect in the growth and development process of muskmelons. Therefore, the method has a good application prospect in melon fruit length improvement.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to the application of the CmOFP8L gene in regulating the elongation of melon fruits. Background Art

[0002] Melon (Cucumis melo L., 2n = 2x = 24) is an important horticultural economic crop in the genus Cucumis of the Cucurbitaceae family and ranks among the world's top ten fruits. According to the statistics of the Food and Agriculture Organization of the United Nations (FAO), the world's melon production in 2021 was approximately 30 million tons (FAOSTAT 2021, http: / / fenix.fao.org / faostat / internal / en / #data / QCL), and China's production accounted for as high as 50%. The fruit shape of melons is diverse and is also an important appearance quality and trait, and fruit length is an important index affecting the fruit shape of melons (Diaz et al., 2014; Rodriguez et al., 2013; Zalapa et al., 2007; Fan Wenlin et al., 2018). The fruit diversity of melons is rich, with a nearly 40-fold difference in length (5 - 200 cm) (Cong et al., 2008; Wiley and Sons, 2011), making it an ideal material for studying fruit length.

[0003] OFPs (Ovate Family Protein) is a class of plant-specific protein families with an OVATE domain composed of 70 conserved amino acids at the C-terminus. Studies have found that OFP family proteins play important roles in regulating seed and fruit length in crops such as rice and tomatoes (Wang et al., 2016). Studies have also found that OsOFP19, OSH1, and DLT in rice form a protein complex that regulates BR signaling and determines the cell division pattern, regulating grain shape (Yang et al., 2018). In addition, OsOFP8 interacts with OsGSK2 and is phosphorylated by OsGSK2 to regulate rice grain morphology through the BR signaling pathway (Yang et al., 2016). In the study of tomato fruits, it was found that the OVATE protein is a key regulator of fruit shape and functions as a transcriptional repressor. At present, there are few reports on the role of OFP proteins in regulating the fruit length of melons. In addition, with the exploration of melon fruit regulatory genes, an individual related gene CmOFP13 has been identified, but its application prospects remain to be explored (Ma et al., 2022). Starting from genes, using genetic engineering means to improve fruit appearance has become an important part of variety improvement. Summary of the Invention

[0004] The object of the present invention is to overcome the deficiencies of the prior art and provide an application of the CmOFP8L gene in regulating the elongation of melon fruits, so as to overcome the deficiencies of the existing melon genetic transformation technology, use gene editing technology to discover genes that inhibit the elongation of melon fruits, and can be applied to the improvement of the appearance of melon fruits.

[0005] The present invention provides the application of any one of the following substances (1)-(6) in regulating the elongation of melon fruits;

[0006] (1) The upstream sequence of the start codon of the melon CmOFP8L gene, and its sequence is as shown in SEQ ID NO.1;

[0007] (2) The downstream sequence of the stop codon of the melon CmOFP8L gene, and its sequence is as shown in SEQ ID NO.2;

[0008] (3) The genomic sequence of the melon CmOFP8L gene, and its sequence is as shown in SEQ ID NO.3;

[0009] (4) The coding sequence of the melon CmOFP8L gene, and its sequence is as shown in SEQ ID NO.4;

[0010] (5) The protein sequence encoded by the melon CmOFP8L gene, and its sequence is as shown in SEQ ID NO.5;

[0011] (6) A recombinant vector, expression cassette or recombinant engineering bacteria containing melon CmOFP8L.

[0012] The present invention constructs a recombinant plasmid containing the target of the CmOFP8L gene. The target is designed on the CRISPR P2.0 website, constructs a U6p-Target-gRNA expression cassette, and uses a ligation reaction system while cutting to ligate it into the PTC binary vector. When constructing the recombinant vector, the PTC vector can be used as the binary vector (PTC-Cas9 plant dual-target sgRNA gene editing CRISPR-Cas9 plasmid vector), and the construction method is: amplify and ligate the target sequence of melon CmOFP8L to the intermediate vector, and recombine it into the final binary vector by the method of ligation while cutting. When using the recombinant vector, an enhanced promoter can be added before its transcription start nucleotide; in order to facilitate the identification and screening of gene-edited plants, the expression vector is processed with resistance genes such as kanamycin markers.

[0013] The constructed binary vector is transformed into Agrobacterium tumefaciens EHA105, and positive clones are shaken and used to infect melon cotyledon explants. After a series of induction of bud formation and rooting culture, when the rooted seedlings grow to the bottle mouth, take the leaves to extract DNA for editing identification and transplanting, and conduct phenotypic observation and statistical analysis on the obtained homozygous mutants.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] The present invention discovers that by using gene editing technology to knockout CmOFP8L, the fruits of the mutants with loss of gene function are significantly elongated, and the fruits of the overexpression are significantly shortened, without affecting the overall growth and other traits of the plants. This indicates that the CmOFP8L gene plays an important regulatory role in the growth and development of melons. Therefore, the present invention has good application prospects in improving the fruit length of melons. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 It is a schematic diagram of the identification results of the target sites and mutant genotypes of the CRISPR / Cas9 targeting the CMOFP8L gene.

[0017] Figure 2 It is the phenotype and fruit length statistics of gene-edited melon fruits. Compared with the wild type, the fruits are significantly elongated after the mutation of CmOFP8L.

[0018] Figure 3 It is the phenotype and fruit length statistics of the fruits of CmOFP8L overexpression plants. Compared with the wild type, the overexpressed fruits at the same maturity stage are significantly shorter. (**, P≤0.01, ***, P≤0.001, two-tailed T-test). DETAILED DESCRIPTION OF THE INVENTION

[0019] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods. Unless otherwise specified, the materials, reagents, etc. used in the following examples can all be obtained from commercial channels.

[0020] Example 1: Preparation of the target site of the melon targeting the CmOFP8L gene

[0021] According to the CmOFP8L gene sequence, 20 bp was selected as the target in the coding regions of the two genes for directional knockout. The sgRNA target was selected using the CRISPR-P v2.0 online web tool (http: / / cbi.hzau.edu.cn / CRISPR2 / ). First, the pbs_SgRNA-Target-gRNA expression cassette was amplified using the pbs_SgRNA vector as a template, and the target primers such as CMOFP8L-g1-F containing the target and Bsal1 restriction site and the common primers PBS-T-F and PBS-T-R were used to identify the gRNA fragment (the primer sequences are as follows). The fragment of sgRNA_Target was amplified using TPC-spe1-F and TPC-spe1-R and ligated into the PTC-Cas9 vector through the GoldenGate reaction system. The positive clone was identified using the TPC-spe1-F / CmOFP8L_T-R primers; the clone with the correct band was transformed into DH5a competent cells, and the positive clone was screened by colony PCR using the TPC-spe1-F / CmOFP8L_T-R primers. The coding sequence of CmOFP8L was ligated into the PRI101 plasmid through homologous recombination, and the detection primers were 35S-F / M13R. The above-mentioned knockout and overexpression plasmids with correct sequencing were transferred into the Agrobacterium tumefaciens strain EHA105.

[0022] The primer sequences are as follows:

[0023] CmOFP8L-T1_F (such as SEQ ID NO.6):

[0024] ATTGGAATGAAGACGGCTTTATGG CmOFP8L_T1-R (such as SEQ ID NO.7):

[0025] AAACCCATAAAGCCGTCTTCATTC CmOFP8L-T2_F (such as SEQ ID NO.8):

[0026] ATTGGGGAAGTCGGAGGGCAAGTA CmOFP8L_T2-R (such as SEQ ID NO.9):

[0027] AAACTACTTGCCCTCCGACTTCCC

[0028] PBS-T-F (such as SEQ ID NO.10): GGCCGCTCTAGAACTAGTG

[0029] PBS-T-R (such as SEQ ID NO.11): TCGAGGTCGACGGTATCGA TPC-spe1-F (such as SEQ ID NO.12):

[0030] CGCTCTAGAACTAGT GAATGATTAGGCATCGAACCTT TPC-kpn1-R (such as SEQ ID NO.13):

[0031] ACAAAAGCTGGGTACCTCACTAAAGGGAACAAAAGCT

[0032] 35S-F (such as SEQ ID NO.14): CTATCCTTCGCAAGACCCTTC M13-R (such as SEQ ID NO.15): CAGGAAACAGCTATGAC

[0033] The specific steps are as follows:

[0034] 1. Genetic transformation of melon. The detailed steps are as follows:

[0035] (1) Take out the Agrobacterium strain from the refrigerator at -80°C, streak it on the resistant LB solid medium, and culture it overnight in an incubator at 28°C; scrape the bacteria into 5 mL of liquid LB medium containing the resistance, and culture it overnight at 28°C with shaking at 200 rpm; (2) Select plump seeds, soak them in sterile water for 30 min, remove the outer seed coat, and make a small cut along the ventral suture at the distal end of the hypocotyl; first disinfect with 75% alcohol for 30 s, then disinfect with 2% NaClO for 15 min, rinse with sterile water 3 - 5 times, wrap the seeds with a wet gauze overnight; (3) Add 500 μL - 2 mL of the overnight cultured bacterial solution to 100 mL of 1 / 2 MSO + AS (AS working solution 100 μM) medium without resistance, and culture it overnight at 28°C with shaking at 200 rpm until the OD value reaches 0.3 - 0.6; this bacterial solution is directly used for explant infection; (4) After removing the inner seed coat of the seeds with forceps, plant them in 1 / 2 MS medium; when the seeds grow for 1 day, remove the cotyledons, radicles and growing points, leave the proximal end of the hypocotyl, and place the explants in the MSO resuspension containing the bacteria; in the laminar flow hood, pour the resuspended bacterial solution containing the explants into a 50 mL syringe, and manually pull and push the syringe 10 - 20 times, with a 5 - 10 s pause between each time; (5) Then pour out the bacterial solution, blot the bacterial solution on the surface of the explants with a sterile dry filter paper, and place it on the co-culture medium covered with a layer of sterilized filter paper, and co-culture it in the dark at 28°C for 2 days. (6) Adventitious bud induction: Inoculate the co-cultured explants in the selection medium and culture them at a temperature of 26 ± 1°C with a photoperiod of 16 h / 8 h. Observe the growth of the buds and subculture every 2 - 3 weeks; when the explants differentiate into clustered buds, cut off the explants and continue to use a new medium for adventitious bud induction until the adventitious buds grow a growing point; (7) Cut the adventitious buds on the explants that have grown to 0.5 - 1.0 cm and transfer them to the elongation medium, and culture them under the conditions of a temperature of 26 ± 1°C and a photoperiod of 16 h / 8 h, and subculture every 2 - 3 weeks. (8) When the buds grow to 2 - 3 cm, carry out rooting culture; cut a small amount of the leaves of the regenerated seedlings for grinding, and detect the positive rate with a Basta test strip; when the positive seedlings grow to 4 - 5 leaves and the root length is 1 - 2 cm, take out the seedlings, wash the roots, and plant them in a sterile substrate; culture them in a light incubator for one to two weeks, and then carry out routine management.

[0036] 2. Extraction of DNA from gene-edited seedlings, the specific steps are as follows: (1) Take an appropriate amount of plant leaves and put them into a 2 mL centrifuge tube. Put one 3 mm steel bead into each tube, and sample after sufficient freezing in liquid nitrogen; (2) Add 500 μL of 2% CTAB buffer to the centrifuge tube containing the crushed sample, and gently invert and mix; (3) Place it in an oven at 65 °C for lysis for 1 h, then take it out and cool it to room temperature; (4) Add an equal volume of chloroform / isoamyl alcohol (24:1), and invert and mix; (5) Centrifuge at 12000 g at room temperature for 10 min; (6) Take the supernatant and transfer it to a new 1.5 mL centrifuge tube, add an equal volume of isopropanol and mix well, and let it stand at room temperature for 10 min; (7) Centrifuge at 12000 g at room temperature for 10 min; (8) Discard the supernatant, add 1 mL of 70% alcohol, and repeat the washing twice; (9) Pour out the alcohol and dry it at room temperature or in an oven; (10) Add an appropriate amount of ddH2O to dissolve it completely, and detect the concentration and quality of DNA with a spectrophotometer.

[0037] 3. After the DNA extraction is completed, PCR identification is carried out on the gene-edited seedlings.

[0038] 4. Compared with the wild type, the fruits of the mutants with the loss of CmOFP8L function become longer, and the fruit length is statistically analyzed.

[0039] As Figure 1 shown, it is identified at the DNA level that the CmOFP8L gene knockout lines have respectively undergone base deletions and insertions, resulting in loss of function. Phenotypic observation and statistics are carried out on the mutants. Compared with the wild type, the fruits of CR-Cmofp8l melons are elongated ( Figure 2 ), and compared with the control, the fruits of the overexpressed CmOFP8L lines are significantly shorter ( Figure 3 ). The knockout of this gene makes the melon fruits longer, expanding the gene resources for melon trait improvement.

Claims

1. Use of any one of the following substances (1)-(6) in regulating the length of melon fruit; (1) the upstream sequence of the start codon of the melon CmOFP8L gene, the sequence of which is shown in SEQ ID NO.1; (2) the sequence downstream of the stop codon of the melon CmOFP8L gene, the sequence of which is shown in SEQ ID NO.2; (3) melon CmOFP8L genome sequence, the sequence of which is shown in SEQ ID NO.3; (4) the coding sequence of the melon CmOFP8L gene, the sequence of which is shown in SEQ ID NO.4; (5) The protein sequence encoded by the melon CmOFP8L gene, the sequence of which is shown in SEQ ID NO.5; (6) A recombinant vector, expression cassette or recombinant engineered bacteria containing melon CmOFP8L.

2. The use according to claim 1, characterized in that These gene sequences also include all allelic mutations produced therefrom.

3. The use according to claim 1, characterized in that Inhibits the elongation of melon fruit. Gene deletion causes the fruit to become longer, while overexpression causes the fruit to become shorter, without changing the plant shape and other traits.

4. The use according to claim 1, characterized in that The recombinant vector is obtained by amplifying the target sequence of melon CmOFP8L and connecting it to the PTC-Cas9 binary vector.

5. The use according to claim 1, characterized in that The recombinant vector is obtained by amplifying the coding sequence of melon CmOFP8L and connecting it to the PRI101 binary vector.

6. The use according to claim 1, characterized in that The recombinant engineering bacteria are obtained by transferring an Escherichia coli plasmid containing the target sequence of melon CmOFP8L into Agrobacterium tumefaciens EHA105.

Images