Plant glandular trichome generation regulation gene NtWOX, encoding protein thereof, biological material and application

Abstract

The invention discloses a plant glandular trichome generation regulation gene NtWOX, an encoding protein thereof, a biological material and application, and aims to solve the technical problem that the current plant glandular trichome development is difficult to effectively regulate and control. According to the application, the NtWOX gene is cloned from tobacco, and by constructing a knockout strain and an overexpression strain of the NtWOX gene, long-stem glandular hairs and short-stem glandular hairs disappear completely and only protective hairs are left after the NtWOX gene is knocked out, and the glandular hair density is remarkably increased after overexpression, which indicates that the NtWOX gene can positively regulate the generation / development of the tobacco glandular hairs. The application has important significance for researching a molecular regulatory network and molecular assisted breeding of plant glandular hair generation.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular assisted breeding, and particularly relates to a gene for regulating the trichome development of plants NtWOX , its encoded protein, biological materials and applications. Background Art

[0002] Plant epidermal hairs are hair-like structures formed by the differentiation of epidermal cells and play various important functions in the growth, development and environmental adaptation of plants. In tobacco, epidermal hairs are mainly divided into three types: long-stalked glandular hairs, short-stalked glandular hairs and protective hairs; among them, long-stalked glandular hairs are composed of basal cells, stalk cells and head cells, and the head cells can synthesize and secrete various secondary metabolites; these secondary metabolites not only constitute an important chemical barrier for tobacco to resist external stresses, but also are closely related to the formation of tobacco leaf aroma.

[0003] One of the main functions of tobacco glandular hairs is to enhance the stress resistance of plants. In the natural environment, terpenoids, sucrose esters and polyphenols secreted by the glandular hair heads can effectively prevent the invasion of insects and pathogens. These compounds protect the plants from invasion by poisoning pests, interfering with their physiological activities or attracting natural enemies. In addition, the structural characteristics of glandular hairs, such as high-density distribution and hydrophobic surface, help to reduce water transpiration, improve the drought resistance of plants, and at the same time reduce the damage of ultraviolet rays to plants.

[0004] By molecular breeding or gene editing technology, the directed regulation of the development of glandular hairs and the synthesis of secondary metabolites can not only significantly enhance the disease and insect resistance of tobacco, but also reduce the use of pesticides, thereby improving the environmental adaptability and quality of tobacco, providing a new theoretical basis and practical direction for the resistance breeding and quality improvement of tobacco. In recent years, with the rapid development of modern biological technologies, multiple key genes regulating the development of the heads of tobacco long-stalked glandular hairs have been identified, such as NtHD9 and NtHD12 , the discovery of these genes provides important clues for the in-depth study of the development mechanism of tobacco glandular hairs. However, the molecular mechanism of tobacco glandular hair development has not been fully resolved, and the related gene resources for its regulation still need to be explored.

[0005] The information disclosed in this background art section is only used to deepen the understanding of the background art of the present disclosure, and should not be regarded as an admission or any form of implication that this information constitutes the prior art known to those skilled in the art. Summary of the Invention

[0006] In view of at least one of the above technical problems, the present disclosure provides a gene for regulating the trichome development of plants NtWOX , its encoded protein, biological materials and applications, aiming to solve the technical problem that it is difficult to effectively regulate the development of plant glandular hairs at present.

[0007] According to one aspect of the present disclosure, there is provided a gene for regulating the development of plant glandular hairs NtWOX , the nucleotide sequence of which is shown in SEQ ID NO.1.

[0008] According to the second aspect of the present disclosure, there is provided a coding protein of the gene for regulating the development of plant glandular hairs NtWOX , the amino acid sequence of which is shown in SEQ ID NO.2.

[0009] According to the third aspect of the present disclosure, there is provided a biological material containing the gene for regulating the development of plant glandular hairs NtWOX or a fragment thereof.

[0010] In some embodiments of the present disclosure, the biological material is any one of a nucleic acid molecule, an overexpression vector, a host cell, an engineered bacterium, and a transformed plant cell.

[0011] According to the fourth aspect of the present disclosure, the gene for regulating the development of plant glandular hairs NtWOX , the coding protein or the biological material is applied in any one of the following (1) to (8): (1) Application in regulating the development of plant glandular hairs or preparing a reagent for regulating the development of plant glandular hairs; (2) Application in positively regulating the glandular hair density trait of plants or preparing a reagent for positively regulating the glandular hair density trait of plants; (3) Application in regulating the type of plant glandular hairs or preparing a reagent for regulating the type of plant glandular hairs; (4) Application in breeding / identifying varieties / lines related to the glandular hair density trait of plants; (5) Application in constructing / breeding transgenic plants with increased glandular hair density in plants; (6) Application in positively regulating the height of glandular hair stalks or preparing a reagent for positively regulating the height of glandular hair stalks; (7) Application in enhancing the stress resistance of plants or preparing a reagent for enhancing the stress resistance of plants; (8) Application in improving the aroma quality of plant leaves or preparing a reagent for improving the aroma quality of plant leaves.

[0012] In some embodiments of the present disclosure, overexpress or upregulate the expression of the NtWOX gene.

[0013] In some embodiments of the present disclosure, the plant glandular hairs include at least one of long-stalk glandular hairs, short-stalk glandular hairs, or protective hairs.

[0014] In some embodiments of the present disclosure, the plant includes tobacco.

[0015] In some embodiments of the present disclosure, the plant stress resistance includes at least one of insect resistance, drought resistance, and ultraviolet resistance.

[0016] One or more technical solutions provided in the embodiments of the present application have at least any one of the following technical effects or advantages: Excavated from tobacco NtWOX a gene with a full-length coding region of 681 bp, encoding 226 amino acids, which is expressed in roots, stems, leaves, flowers, and trichomes, with relatively high expression levels in stems and leaves and relatively low expression levels in roots and flowers. By constructing NtWOX knockout and overexpression vectors of the gene and transferring them into tobacco by Agrobacterium-mediated transformation, knockout and overexpression lines were obtained and it was found that NtWOX after gene knockout, all long-stalked glandular hairs disappeared, leaving only protective hairs (the density of protective hairs increased by 9.5 times), and the height of the glandular hair stalk decreased. After overexpression, the glandular hair density increased significantly (the long-stalked glandular hairs and short-stalked glandular hairs increased by 86.41% and 34.43% respectively compared with the wild type), indicating that NtWOX the gene can positively regulate the occurrence / development of tobacco glandular hairs. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Electrophoresis diagram of tobacco NtWOX gene cloning in an embodiment of the present application.

[0018] Figure 2 In an embodiment of the present application NtWOX Analysis map of the tissue expression pattern of the gene.

[0019] Figure 3 Schematic diagram of the overexpression vector pC2300-35S-GFP in an embodiment of the present application.

[0020] Figure 4 Electrophoresis diagram of the recombinant vector bacterial liquid PCR identification in an embodiment of the present application.

[0021] Figure 5 In an embodiment of the present application NtWOX Comparison diagram of the overexpression level detection of the gene.

[0022] Figure 6 In an embodiment of the present application NtWOX Schematic diagram of the gene knockout vector.

[0023] Figure 7 Electrophoresis diagram of the recombinant vector bacterial liquid PCR identification in an embodiment of the present application.

[0024] Figure 8 In an embodiment of the present application NtWOX Sequencing analysis map of the sgRNA region of the gene knockout line.

[0025] Figure 9 In an embodiment of the present application NtWOX Electron micrograph of the morphological observation of leaf surface glandular hairs of transgenic plants.

[0026] Figure 10 Statistical comparison chart of glandular hair density in an embodiment of the present application. Detailed implementation manners

[0027] In the following embodiments, the instrument and equipment involved are all conventional instrument and equipment unless otherwise specified; the biochemical reagents involved are all commercially available conventional reagents unless otherwise specified; the detection methods involved are all conventional methods unless otherwise specified.

[0028] In order to better understand the technical solution of the present application, the above technical solution will be described in detail below in combination with the accompanying drawings of the specification and specific implementation manners. However, the following embodiments are only used to illustrate the present application in detail and do not limit the scope of the present application in any way.

[0029] Example 1. In tobacco NtWOX Obtaining of gene Through sequence alignment, a candidate gene with the highest homology rate to tomato in the tobacco genome database was obtained and named SlWOX ( NtWOX ). Using specific primers Nitab4.5_0002380g0130.1 (F: ATGTCTTTTCTGAAAAGAGAAAAAATGA, R: TTAACTTGAAAATGAAAGACTTAAAGTGG), PCR amplification was performed on the cDNA in the leaves of K326, and its CDS sequence was amplified. The size of the band was about 681 bp ( NtWOX ). The analysis of the sequencing results showed that Figure 1 the full length of the coding region was 681 bp, encoding 226 amino acids. NtWOX

[0030] NtWOX Example 2. Analysis of tissue expression characteristics of gene NtWOX In order to further explore NtWOX the gene expression of, qRT-PCR was used to analyze the expression pattern of Figure 2 gene in different tissues of K326. The results are as NtWOX shown, it was expressed in roots, stems, leaves, flowers, and glandular hairs (trichomes), with relatively high expression levels in stems and leaves and relatively low expression levels in roots and flowers, indicating that this gene has tissue expression specificity and is involved in the growth and development of tobacco stems and leaves.

[0031] NtWOX Example 3. NtWOX Creation and molecular identification of gene overexpression materials Using homologous recombination technology, homologous recombination primers (F: gagctcggtacccggggatccATGTCTTTTCTGAAAAGAGAAAAAATGA, R: cttgctcaccatggtgtcgacTTAACTTGAAAATGAAAGACTTAAAGTGG) were designed. After digesting the vector pC2300-35S-GFP Figure 3 , NtWOX with the CDS sequence of Figure 4 , it was then transferred into Escherichia coli for transformation. Colony PCR verification was carried out using hygromycin primers, and the detection results are as shown in NtWOX . The plasmid was extracted for sequencing verification

[0032] The leaves of tobacco variety K326 were infected by the Agrobacterium-mediated method, and 8 positive transgenic plants were successfully obtained. RNA of positive transgenic single plants was extracted, and specific primers (F: AACCACCACAAGCACCAACAC, R: TCCACCCTCTTGAAGAAGTCCAG) were designed. Real-time fluorescence quantitative PCR was used to detect NtWOX the expression level of the gene, and 8 transgenic plants with expression levels higher than the control were screened out ( Figure 5 ). Plants No. 3 and No. 5 with higher expression levels were selected for subsequent experiments.

[0033] Example 4 NtWOX Creation and molecular identification of gene knockout materials Construction of the knockout vector: Using an online design tool (https: / / zlab.bio / guide-design-resources), a gRNA target site sequence (Targeting Sequence: AATGACTTACCTATATCCAATGG, the underlined part is the PAM region, see NtWOX ) was designed in the coding region of the Figure 8 gene. The vector Cas-PF ( Figure 6 ) was digested with the restriction endonuclease BsaI at 37°C. After gel extraction and recovery, the target gene fragment was ligated, transferred into Escherichia coli, and the colony PCR detection results are as shown in Figure 7 . The plasmid was extracted for sequencing.

[0034] The NtWOX knockout vector was transformed into K326 sterile seedlings by the Agrobacterium-mediated method, and 15 positive transgenic plants were successfully obtained. Genomic DNA of each plant was extracted, and primers (F: GATCATCATTCCACGCAGTCT, R: GATCTGTTCCTTGAGGCCATT) were designed upstream and downstream of the target site forNtWOX Sequencing was performed on the target sites, and the results showed that mutations occurred in the sgRNA region of transgenic plants No. 3, No. 4, and No. 7 ( Figure 8 ).

[0035] Example 5 NtWOX Observation of glandular hair morphology and density analysis of transgenic plants The trichomes on the leaf surface of the transgenic plants in Examples 3 and 4 were observed using a super-depth-of-field microscope ( Figure 9 ), and it was found that NtWOX only protective hairs and short-stalked glandular hairs remained on the leaf surface of the knockout lines, and all long-stalked glandular hairs disappeared, and the height of the glandular hair stalk was significantly lower than that of the control; while in the overexpression lines, the density of glandular hairs on the leaf surface increased significantly, and the increase in long-stalked glandular hairs was the most obvious. The statistical results of glandular hair density are as Figure 10 shown. All long-stalked glandular hairs on the leaf surface of the knockout lines disappeared, and the density of protective hairs increased by 9.5 times; while the long-stalked glandular hairs and short-stalked glandular hairs in the overexpression lines increased by 86.41% and 34.43% respectively compared with the wild type.

[0036] The above research results show that NtWOX the gene can control the development of the glandular head and glandular hair stalk of long-stalked glandular hairs in tobacco plants. After overexpression, the density of glandular hairs increases, NtWOX and it is a positive regulatory factor for regulating the development of tobacco trichomes.

[0037] Although some preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications once they learn the basic creative concepts. Therefore, the appended claims are intended to be construed to include the preferred embodiments as well as all changes and modifications falling within the scope of the present invention application.

[0038] Obviously, those skilled in the art can make various changes and modifications to the present invention application without departing from the spirit and scope of its inventive concept. Thus, if these modifications and variations to the present disclosure fall within the scope of the claims of this application and their equivalent technologies, the present invention also intends to include these changes and modifications.

Claims

1. A plant glandular hair growth regulatory gene NtWOX , whose nucleotide sequence is shown in SEQ ID NO.

1.

2. The plant glandular hair growth regulating gene according to claim 1 NtWOX The encoded protein has an amino acid sequence as shown in SEQ ID NO.

2.

3. A biological material containing the plant glandular hair growth regulating gene according to claim 1 NtWOX or fragments thereof.

4. The biomaterial according to claim 3, characterized in that: It is any one of nucleic acid molecules, overexpression vectors, host cells, engineered bacteria, and transformed plant cells.

5. The plant glandular hair growth regulating gene according to claim 1 NtWOX , Use of the encoded protein according to claim 2 or the biological material according to claim 3 in any of the following (1) to (8): (1) Application in regulating the occurrence / development of plant glandular hairs or in preparing reagents for regulating the occurrence / development of plant glandular hairs; (2) Application in positively regulating the density of plant glandular hairs or in preparing reagents for positively regulating the density of plant glandular hairs; (3) Application in regulating the type of plant glandular hairs or in preparing reagents for regulating the type of plant glandular hairs; (4) Application in breeding / identifying varieties / lines with traits related to plant glandular hair density; (5) Application in the construction or breeding of transgenic plants with increased glandular hair density; (6) Application in positively regulating the height of glandular hair stalk or in preparing reagents for positively regulating the height of glandular hair stalk; (7) Application in enhancing plant stress resistance or in preparing agents for enhancing plant stress resistance; (8) Application in improving the aroma quality of plant leaves or in preparing reagents for improving the aroma quality of plant leaves.

6. The use according to claim 5, characterized in that: Overexpression or upregulation of the NtWOX Gene.

7. The use according to claim 5, characterized in that: The plant glandular hairs include at least one of long-stalked glandular hairs, short-stalked glandular hairs or guard hairs.

8. The use according to claim 5, characterized in that: The plants include tobacco.

9. The use according to claim 5, characterized in that: The plant stress resistance includes at least one of insect resistance, drought resistance, and ultraviolet resistance.

Images