Related gene OsERF93 for improving resistance to rice sheath blight disease and application of related gene OsERF93

Abstract

The invention discloses a gene OsERF93 related to improvement of rice sheath blight resistance and application of the gene OsERF93. The CDS sequence of the gene OsERF93 is as shown in SEQ ID NO.1, and the full-length sequence of the gene OsERF93 is as shown in SEQ ID NO.2. The invention discovers that the OsERF93 gene is infected by rhizoctonia solani to induce expression, tissue specific expression discovers that the OsERF93 gene is mainly expressed in stalks and leaf sheaths, and the protein coded by the gene is positioned in a cell nucleus and has transcriptional activation activity. Experiments prove that the over-expression of the OsERF93 obviously enhances the resistance of the rice to the sheath blight disease, and the resistance of the rice to the sheath blight disease is obviously reduced after the gene is knocked out. The rice gene OsERF93 provided by the invention has a remarkable effect on improving the resistance of rice sheath blight disease, provides an important gene resource for cultivating rice sheath blight disease resistant germplasm, and has an important application value.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to a gene OsERF93 related to improving rice resistance to sheath blight and an application thereof. Background Art

[0002] Rice sheath blight is an important fungal disease caused by Rhizoctonia soalni Kühn. For a long time, the disease has occurred on a large scale in rice-producing areas, becoming one of the main obstacles to rice production and seriously threatening rice yield and quality. At present, the main means of preventing and controlling rice sheath blight is spraying chemical agents. Long-term reliance on chemical agents will not only lead to drug resistance in pathogens, but also have a negative impact on the ecological environment. Breeding sheath blight-resistant varieties is the most economical and effective measure to reduce the harm of sheath blight and protect the environment. However, there is a lack of available resistance gene resources, and people lack a deep understanding of the interaction mechanism between rice and sheath blight pathogens, and sheath blight resistance breeding is significantly lagging behind. Therefore, conducting research on rice sheath blight resistance breeding, exploring resistance resources, locating resistance quantitative trait loci, and cloning resistance genes are of great significance for improving rice disease resistance, breeding resistant varieties, and ensuring food security.

[0003] However, rice resistance to sheath blight is a quantitative trait controlled by quantitative trait loci (QTL) or multiple genes. Currently, multiple QTLs for sheath blight resistance have been identified, but near-isogenic lines and multi-environment experiments have shown that most QTLs have insignificant effects. The prior art discloses a gene OsERF7 related to rice resistance to sheath blight, its encoded protein, and its application. Overexpression of OsERF7 significantly reduces rice resistance to sheath blight, while knocking out the gene significantly enhances rice resistance to sheath blight. Exploring and cloning more genes involved in regulating sheath blight resistance will provide a basis for further studying the molecular mechanism of gene regulation of sheath blight resistance, which has important theoretical value. Summary of the invention

[0004] Purpose of the invention: In view of the deficiencies in the prior art, the present invention provides a gene OsERF93 related to improving rice resistance to sheath blight. The present invention identifies a new gene OsERF93 that regulates rice resistance to sheath blight. The rice gene OsERF93 involved in the present invention has a significant effect on improving rice resistance to sheath blight, provides an important gene resource for cultivating rice resistance to sheath blight, has important application value, and solves the problem of lagging breeding for sheath blight resistance.

[0005] The present invention also provides the application of the gene OsERF93 related to improving rice resistance to sheath blight.

[0006] Technical solution: To achieve the above object, the present invention relates to a gene OsERF93 related to enhancing the resistance of rice sheath blight. The CDS sequence of the gene OsERF93 is shown in SEQ ID NO.1; the full-length sequence of the gene OsERF93 is shown in SEQ ID NO.2.

[0007] The protein encoded by the gene OsERF93 related to enhancing the resistance of rice sheath blight according to the present invention, and the amino acid sequence of the protein is shown in SEQ ID NO.3.

[0008] Among them, the primer pair for amplifying the CDS sequence of the gene OsERF93 is:

[0009] F: ATGACGGCGCGAAGCATGTT, R: TTAGATGACGAGCTGCTCCA;

[0010] The gene knockout vector based on the gene OsERF93 related to enhancing the resistance of rice sheath blight according to the present invention.

[0011] Among them, the method for constructing the gene knockout vector is to design and synthesize the OsU3a-target fragment (CCGGACTCGTCGTCGTACGA) and gRNA (GTTTTAGAGCTAGAAATAGCAAGTTAA AATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGT GCTTTTTTT), connect them to the pYLCRISPR vector, and finally obtain the gene knockout vector through transformation and plasmid extraction.

[0012] The overexpression vector containing the gene OsERF93 related to enhancing the resistance of rice sheath blight according to the present invention.

[0013] Among them, the method for constructing the overexpression vector is to connect the CDS sequence of OsERF93 with homologous arms to the pCAMBIA1300 vector, and finally obtain the overexpression vector through transformation and plasmid extraction.

[0014] The application of the gene OsERF93 related to enhancing the resistance of rice sheath blight according to the present invention, or the protein encoded by the gene OsERF93, or the gene knockout vector, or the overexpression vector in regulating the resistance of rice sheath blight.

[0015] Among them, overexpressing the OsERF93 gene in rice enhances the resistance of rice sheath blight, while knocking out the OsERF93 gene in rice reduces the resistance of rice sheath blight.

[0016] The application of increasing the expression level and / or activity of the OsERF93 gene in recipient rice in cultivating transgenic rice with enhanced sheath blight resistance.

[0017] Furthermore, the application of decreasing the expression level and / or activity of the OsERF93 gene in recipient rice in rice sheath blight resistance breeding.

[0018] Furthermore, the application of the protein encoded by the gene OsERF93 of the present invention in any one of the following:

[0019] (1) Regulating plant sheath blight resistance;

[0020] (2) A protein having the same function as that of SEQ ID No. 3 after substitution or addition of one or several amino acid residues and derived from rice.

[0021] When the expression level and / or activity of the OsERF93 protein of the present invention increases, the resistance of the plant to sheath blight enhances. When the expression level and / or activity of the OsERF93 protein of the present invention decreases, the resistance of the plant to sheath blight reduces.

[0022] The application of the related gene OsERF93 for enhancing rice sheath blight resistance, or the protein encoded by the gene OsERF93, or the gene knockout vector, or the overexpression vector of the present invention in cultivating rice germplasm resistant to sheath blight.

[0023] The present invention discovers that the OsERF93 gene is induced to express by infection with Rhizoctonia solani. Tissue-specific expression shows that it is mainly expressed in the stems and sheaths. The protein encoded by this gene is localized in the nucleus and has transcriptional activation activity. The present invention discovers that overexpression of OsERF93 significantly enhances the resistance of rice to sheath blight, while knocking out this gene significantly reduces the resistance of rice to sheath blight. The rice gene OsERF93 involved in the present invention has a significant effect on enhancing the resistance of rice to sheath blight, provides an important gene resource for cultivating rice germplasm resistant to sheath blight, and has important application value.

[0024] Beneficial effects: Compared with the prior art, the present invention has the following advantages:

[0025] The present invention identifies a positive regulatory gene OsERF93 for rice sheath blight resistance. Overexpression of this gene significantly enhances the resistance of rice to sheath blight, and knocking out this gene significantly reduces the resistance of rice to sheath blight, which is of great significance for providing gene resources for cultivating rice germplasm resistant to sheath blight.

[0026] The present invention utilizes molecular biology methods to clone the gene OsERF93 that regulates rice sheath blight resistance and demonstrates its function in rice sheath blight resistance. The operation steps of the gene mining and transgenic material acquisition methods described in the present invention are clear, highly replicable, and have good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 For the analysis of the tissue-specific and induced expression patterns of the rice OsERF93 gene, where A is the expression pattern of the OsERF93 gene in various tissues of rice, B is the expression pattern of the OsERF93 gene under ethylene (ET) and ethylene inhibitor (AOA) treatments, C is the expression pattern of the OsERF93 gene in the susceptible material Lemont in response to Rhizoctonia solani infection, D is the expression pattern of the OsERF93 gene in the resistant material YSBR1 in response to Rhizoctonia solani infection, and different capital letters represent the results of multiple comparisons at the P < 0.05 level. ** indicates a significant level of P < 0.01.

[0028] Figure 2 For the subcellular localization and transcriptional activity analysis of the OsERF93 protein, where A is the subcellular localization of OsERF93 in rice protoplasts, B is the transcriptional self-activation activity analysis of OsERF93 in yeast, and C is the transcriptional activation activity analysis of OsERF93 in rice protoplasts.

[0029] Figure 3 For the identification of the OsERF93 gene overexpression materials and knockout mutant materials. A is the detection of the expression level of the OsERF93 gene in the OsERF93 overexpression materials, B is the gene structure of OsERF93 and the knockout target sequence, C is the display diagram of the knockout types and sequencing results of the OsERF93 gene in two knockout mutants, and D is the positive detection gel diagram of the OsERF93 knockout mutant. ** indicates a significant level of P < 0.01.

[0030] Figure 4 For the in vitro and adult plant stage sheath blight phenotype identification of the OsERF93 gene transgenic materials and wild type, where A is the sheath blight phenotype of the OsERF93 transgenic materials' in vitro stem after 5 days of inoculation, B is the statistical analysis result of the lesion length of the in vitro stem shown in Figure A after inoculation, C is the stem disease condition of the OsERF93 transgenic materials in the field adult plant stage 14 days after inoculation with sheath blight, and D is the statistical data of the stem lesion length of the field adult plant stage shown in Figure C. ** indicates a significant level of P < 0.01; * indicates a significant level of P < 0.05. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0031] The present invention will be further described below in conjunction with the drawings and embodiments.

[0032] The materials, reagents, etc. used in the following examples can be obtained from commercial sources without special instructions.

[0033] For the experimental methods without specific conditions noted in the examples, they are usually carried out according to conventional conditions or according to the conditions recommended by the manufacturer.

[0034] Xudao 3: Xie et al., Molecular Plant Pathology, 2023; 24: 1535–1551.

[0035] Rhizoctonia solani strain RH-9: Zuo et al., Theoretical and Applied Genetics, 2013, 126: 1257-1272.

[0036] Lemont, YSBR1: Cao et al., Plant Biotechnol J, 2022, 20(2): 335-349

[0037] The above materials and strains were provided by Yangzhou University.

[0038] Example 1

[0039] Identification and cloning of OsERF93 gene

[0040] Design primers: F: ATGACGGCGCGAAGCATGTT,

[0041] R: TTAGATGACGAGCTGCTCCA,

[0042] Using the cDNA of the leaves of 4-5 leaf stage seedlings of Xudao 3 as a template, the CDS sequence of rice OsERF93 gene was amplified as shown in SEQ ID NO.1, the full length of OsERF93 gene was as shown in SEQ ID NO.2, and its amino acid sequence was as shown in SEO ID NO.3.

[0043] Example 2

[0044] Analysis of tissue specificity and induced expression pattern of OsERF93 gene

[0045] First, samples of different tissue parts (roots, stems, leaves, spikes, leaf sheaths) of the rice variety Xudao 3 at the adult stage were quickly taken and stored in liquid nitrogen; secondly, rice materials at the seedling stage were sprayed with ETH (1 mM) and AOA (1 mM) reagents, and rice samples were taken at 0 h before treatment and 3 h, 6 h, 9 h, and 12 h after treatment and stored in liquid nitrogen; the rice materials Lemont and YSBR1 at the late tillering stage were inoculated with the sheath blight pathogen strain RH-9 using the embedding method (He Min et al., Acta Botanica Sinica, 2020, 55: 577-587). A piece of wood bark with a thickness of 0.8 mm and a length of 1.0 cm attached with sheath blight mycelia was carefully embedded in the leaf sheath 1 cm - 2 cm below the second-to-last leaf of the rice. Rice leaf sheaths in the 1 cm section above and below the inoculum were cut at 0 h before inoculation and 24 h and 48 h after inoculation, and quickly stored in liquid nitrogen; according to the steps in the instruction manual (Trans Gen), total RNA of each rice sample was extracted using Trizol, and then reverse transcription experiments were carried out using a kit (HiScript III RT SuperMix) produced by Novoprotein to obtain the corresponding total cDNA. Using the cDNA of the above different tissues as templates, with the rice Actin gene as an internal reference (amplification primers F: CATAGGAATGGAAGCTGCGGGTA and R: CGACCACCTTGATCTTCATGCTG), real-time quantitative PCR was carried out using the OsERF93 gene-specific quantitative primers (ERF93-qF: TCGTACGACGGGTCCTCTTG, ERF93-qR: CCCTGTAGTGCTTCCCCCTC). The reaction conditions were: pre-denaturation at 95 °C for 5 min, and then entering the following cycle: 95 °C for 30 sec, 60 °C for 30 sec, 72 °C for 30 sec, and a total of 40 cycles were carried out.

[0046] The results of RT-qPCR detection showed that the OsERF93 gene was mainly expressed in the stem and leaf sheath tissues ( Figure 1 A), which was consistent with the characteristic that sheath blight of rice mainly harms the leaf sheath. The expression of this gene was inhibited by ethylene signal and induced by AOA ( Figure 1 B). Further, it was found that OsERF93 was continuously induced by the sheath blight pathogen in the susceptible material Lemont ( Figure 1 C), while in the resistant material YSBR1, the induced expression level first increased and then decreased ( Figure 1 D)

[0047] Example 3

[0048] Subcellular localization and transcriptional activity analysis of the OsERF93 protein

[0049] First, prepare 10 ml of enzyme solution. After preparation, incubate it in a water bath at 55 °C for 10 min and then let it cool naturally at room temperature. Then, take the seedlings of Xudao 3 that have germinated and grown on the medium for 10 - 15 days. Cut the leaf sheath tissue of the rice into pieces of 0.5 - 1 mm with a sharp blade and immerse them in the enzyme solution. Then, evacuate the air for 30 min at room temperature and shake it in the dark for 4 - 5 h to fully enzymatically digest the components of the tissue cell wall. Next, filter the enzyme solution through a 300-mesh metal sieve and slowly centrifuge to collect the enzyme solution. Add 10 ml of W5 solution, slowly centrifuge and remove the supernatant, and resuspend the protoplasts. Centrifuge again slowly to collect the protoplasts, discard the supernatant, add W5 to resuspend the protoplasts, and place them in the dark for later use. Construct a plasmid vector for subcellular localization containing the OsERF93 gene. Mix 5 μg of the plasmid with 100 μL of protoplasts, add 110 μL of PEG-CaCl2, gently mix well, and let it stand at room temperature for 12 min. Then, add 800 μL of W5 solution to terminate the reaction, slowly centrifuge and discard the supernatant. Add 1 mL of WI solution to resuspend the protoplasts and transfer them into a cell culture plate, and culture them under dark conditions at 26 - 28 °C for 12 - 16 h. Finally, observe the fluorescence using a laser confocal microscope, and finally confirm that its subcellular localization is in the nucleus( Figure 2 A).

[0050] For yeast two-hybrid assay, use the vector pGBKT7 (BD) and the OsERF93 gene to construct the vector BD-OsERF93. Co-transform the constructed BD-OsERF93 yeast vector with the pGADT7 vector, using yeast cell competent as the host. Spread the transformed yeast cells on Leu / Trp-deficient medium and culture them at 28 °C for 2 - 3 days. Further, select monoclonal yeast cells from the Leu / Trp-deficient medium, perform serial dilutions at different concentration gradients, and spot the diluted yeast cells on Leu / Trp / His / Ade-deficient medium to observe their growth. The experimental results show that OsERF93 has transcriptional self-activation activity( Figure 2 B).

[0051] Construct an effector plasmid driven by the 35S promoter to express the OsERF93 gene, and co-transform it into rice protoplasts with the 4×UAS-LUC vector. The vector driven by the 35S promoter to express Renilia (REN) is used as an internal reference. The experimental operation is carried out according to the instructions of the Dual-Luciferase Reporter Assay Kit (Beyotime, product number RG027). Analyze the transcriptional activity of OsERF93 by calculating the ratio of the activities of LUC luciferase and REN luciferase. The experimental results show that OsERF93 has transcriptional activation activity( Figure 2 C).

[0052] Example 4

[0053] Vector construction and genetic transformation to construct OsERF93 transgenic materials

[0054] The main steps for constructing the overexpression vector are as follows: Using high-fidelity DNA polymerase to amplify the cDNA of the booting stage leaf sheath tissue of Xudao 3 as the template, the amplification primers are F: ATTTACGAACGATAGCCggtaccATGACGGCGCGAAGCATGTT, R: ATCATGATCTTTGTAATCggatccGATGACGAGCTGCTCCACGC, to obtain the CDS sequence of OsERF93 with homologous arms. The overexpression vector pCAMBIA1300 is digested with restriction enzymes KpnI and BamHI (Thermo Scientific TM , FD0524, ER0051) to linearize it, and the target gene is introduced into the overexpression vector pCAMBIA1300 through homologous recombinase. The specific operation method is as follows. First, the amplified CDS sequence and the digested vector are subjected to homologous recombination for 2 hours through homologous recombinase (ClonExpress II One Step Cloning Kit reagent from Novoprotein Scientific Inc.) to perform homologous recombination on the obtained CDS sequence of OsERF7 and the above-mentioned digested linear pCAMBIA1300 vector. Then, it is introduced into Escherichia coli competent cells by heat shock transformation, and then 500 uL of LB solution is added and cultured on a shaker at 37°C for 30 minutes for resuscitation. Finally, it is spread on a kanamycin-resistant culture dish and placed in a 37°C incubator for 12 h. Single colony colonies on the culture dish are picked for culture, plasmids are extracted and subjected to restriction enzyme digestion detection, positive plasmids are picked for sequencing, and finally, a successfully recombined plasmid without mutations is obtained. Secondly, the overexpression vector pCAMBIA1300-OsERF93 is transferred into Xudao 3 through Agrobacterium EHA105 mediation to obtain OsERF93 overexpression materials. The genetic transformation of the transgenic in the present invention is obtained by Wuhan Boyuan Biotechnology Co., Ltd. according to conventional transgenic technology experiments. Two transgenic lines are selected therefrom and named OsERF93OE-1 and OsERF93OE-2. Through expression level detection, the OsERF93 gene is significantly overexpressed in these two families ( Figure 3 A).

[0055] The main steps for constructing the knockout vector are as follows: (1) Design gene knockout targets, such as Figure 3as shown in B; (2) Amplification of the sgRNA cassette: Using the OsU3 plasmid as a template (Ma et al., Molecular Plant, 2015, 3: 1274-1284), design and synthesize the OsU3-target fragment (CCGGACTCGTCGTCGTACGA) and gRNA (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATC AACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT). (3) Recombine the above two synthesized products with the pYLCRISPR / Cas9-MH vector digested with BsaI (Ma et al., Molecular Plant, 2015, 3: 1274-1284) through a homologous recombinase (ClonExpress II One Step Cloning Kit reagent from Novoprotein) to construct its knockout vector; (4) Transform Escherichia coli and select monoclonal colonies for culture; (5) After plasmid extraction, perform sequencing to verify positive clones (vector primer R: CGGAGGAAAATTCCATCCAC); (6) Transfer the recombinant positive plasmid into Agrobacterium tumefaciens EHA105; (7) Verify and preserve positive Agrobacterium tumefaciens monoclonal. Transfer the constructed knockout vector plasmid into Xudao 3 through Agrobacterium-mediated rice genetic transformation. After the rice genetic transformation is completed, amplify the target sequence by PCR (primers F: CTCGACACCATCCGGCAG, R: CTGTAGTGCTTCCCCCTCG). Two transgenic lines with mutant types were identified by sequencing the target, named oserf93-1 and oserf93-2 respectively. The genetic transformation of the transgenic plants of the present invention was obtained by Wuhan Boyuan Biotechnology Co., Ltd. according to conventional transgenic technology experiments. The sequencing results showed insertions near the knockout target. The specific insertion situation is as shown in ( Figure 3 C), and bases such as T and A were inserted into the two families respectively.

[0056] Specific CAPS markers for detecting these two knockout mutants were further developed. Specifically, the wild-type OsERF93 gene has a recognition motif "GTAC" of the restriction endonuclease RsaI at the insertion mutation position. However, in the knockout mutants oserf93-1 and oserf93-2, bases T (GTAT) and A (GTAA) were inserted into this recognition motif respectively, resulting in that the PCR fragments covering this recognition site in the mutants could not be cut by the endonuclease RsaI, and there was only one band after electrophoresis ( Figure 3 D), while the PCR fragment in the wild type could be cut to generate 2 bands ( Figure 3 D). Therefore, based on this insertion mutation base, the oserf93 mutant can be detected by using the method of PCR combined with enzyme digestion.

[0057] Example 5

[0058] Identification of sheath blight resistance

[0059] The overexpression lines (OsERF93OE1 and OsERF93OE2), knockout lines (oserf93-1 and oserf93-2) of this gene, and the wild-type material Xudao 3 were identified for sheath blight resistance using two methods: in vitro stem inoculation and field inoculation.

[0060] The identification of sheath blight resistance and the inoculation method were carried out according to the existing described method (He Min et al., Acta Botanica Sinica, 2020, 55: 577-587). Rice was inoculated with the highly pathogenic sheath blight fungus strain RH-9 (Zuo et al., Theoretical and Applied Genetics, 2013, 126: 1257-1272). The sheath blight fungus was first cultured on potato dextrose agar medium at 28 °C for 3 days, and then the fungal blocks (about 0.5 cm in diameter) were transferred to potato dextrose broth medium containing a 0.8-mm-thick and 1.0-cm-long wood bark, and grown at 28 °C for about 3 days until the mycelium completely covered the wood bark. The wood bark colonized with mycelium was used as the inoculum.

[0061] For field inoculation, when the rice plants reached the booting stage, the leaf sheath tissues of the four main tillers of each plant were inoculated. The inoculation method was artificial inoculation by the embedding method. The above-mentioned cultured wood bark with sheath blight mycelium was carefully placed at 1 cm below the tissue of the second leaf from the top of the sheath. Three seedlings were inoculated, and 4 stems with relatively consistent growth stages were inoculated for each seedling. The lesion length was measured 14 days after inoculation, and the average value of three replicates was calculated.

[0062] For in vitro stem material inoculation, in vitro stem samples were taken when the rice plants reached the early booting stage. After cutting the rice stems of each plant and the wild-type plants, only the flag leaf and the second leaf from the top were left, and they were left standing in water overnight to allow the rice to adapt to the climate chamber environment and prevent the rice from losing water. The next day, the inoculation was also carried out by the embedding method. The cultured wood bark with sheath blight mycelium was carefully placed at 1 cm below the second leaf from the top of the sheath. After inoculation, the stems were inserted into a test tube rack embedded with floral foam and then transferred into the nutrient solution, and then placed in a light incubator, with 14 h of light (30 °C), 10 h of darkness (26 °C), and the humidity set at 90%. There were 8-10 in vitro stems for each family, and the lesion length was investigated 5 days after inoculation.

[0063] The results of phenotypic identification showed that the phenotypic display of inoculated in vitro stems showed that the overexpression materials of OsERF93 significantly enhanced the sheath blight resistance of rice, while the resistance of the knockout materials to sheath blight decreased significantly ( Figure 4A, B). The phenotypes of transgenic materials in the field further confirmed that the overexpression materials of OsERF93 enhanced the resistance to sheath blight, while the knockout materials reduced the resistance of rice to sheath blight( Figure 4 C, D).

Claims

1. A gene OsERF93 related to improving rice sheath blight resistance, characterized in that: The CDS sequence of the gene OsERF93 is shown in SEQ ID NO.1; the full-length sequence of the gene OsERF93 is shown in SEQ ID NO.

2.

2. A protein encoded by the gene OsERF93 related to improving rice sheath blight resistance according to claim 1, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO.

3.

3. The gene OsERF93 for improving rice sheath blight resistance according to claim 1, characterized in that: The preferred primer pair for amplifying the CDS sequence of the gene OsERF93 is: F:ATGACGGCGCGAAGCATGTT, R:TTAGATGACGAGCTGCTCCA.

4. A gene knockout vector of the gene OsERF93 related to improving rice sheath blight resistance according to claim 1.

5. The gene knockout vector according to claim 4, characterized in that The gene knockout vector construction method comprises the following steps: designing and synthesizing an OsU3a-target fragment (CCGGACTCGTCGTCGTACGA) and a gRNA (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTT ATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT), connecting the fragment to a pYL CRISPR vector, and finally obtaining a gene knockout vector by transforming and extracting a plasmid. An overexpression vector containing the gene OsERF93 for improving rice sheath blight resistance according to claim 1.

7. The overexpression vector according to claim 4, characterized in that The overexpression vector is constructed by connecting the CDS sequence of OsERF93 with homology arms to the pCAMBIA1300 vector, performing transformation, extracting the plasmid, and finally obtaining the overexpression vector.

8. Use of the gene OsERF93 for improving rice sheath blight resistance according to claim 1, or the protein encoded by the gene OsERF93 according to claim 2, or the gene knockout vector according to claim 4, or the overexpression vector according to claim 6 in regulating rice sheath blight resistance.

9. The use according to claim 8, characterized in that: Overexpression of rice OsERF93 gene enhanced rice resistance to sheath blight, while knockout of rice OsERF93 gene reduced rice resistance to sheath blight.

10. Use of the gene OsERF93 for improving rice sheath blight resistance according to claim 1, or the protein encoded by the gene OsERF93 according to claim 2, or the gene knockout vector according to claim 4, or the overexpression vector according to claim 6 in cultivating rice germplasm resistant to sheath blight.

Images