ZmRF1 gene and application thereof in regulating corn fox tail mosaic virus resistance
By identifying and applying the ZmRF1 gene, the limitations of corn's resistance to foxtail mosaic virus (FoMV) in the prior art were solved, and the effect of improving corn's antiviral ability was achieved.
Patent Information
- Application Number
- CN202510371921.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-27
- Publication Date
- 2025-06-20
AI Technical Summary
The existing foxtail mosaic virus (FoMV) viral vectors can only infect about 18% of corn inbred lines, and most corn inbred lines are anti-FoMV virus and cannot use their viral vectors, resulting in limited research and breeding of corn antivirals.
By identifying and identifying the ZmRF1 gene, the gene encodes a novel and critical antiviral protein that regulates corn's resistance to FoMV.
The main effect gene ZmRF1, which confers resistance to FoMV to corn, was successfully identified, which increased the resistance to FoMV in corn and expanded the host range of FoMV.
Smart Images

Figure CN120173969A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of molecular breeding, and specifically relates to ZmRF1 a gene and its application in regulating maize resistance to Setaria italica mosaic virus. Background Art
[0002] Maize ( Zea mays ) is the most widely planted crop globally and is also an important source of food, feed, and industrial raw materials. With the reduction of arable land area and the continuous growth of the world's population, it is particularly important to cultivate maize germplasm resources with better quality and higher yield. In the field of reverse genetics research in crop breeding, an important method is to reduce the expression of target genes through virus-induced gene silencing (VIGS) to determine their functions.
[0003] Currently, there are many virus-induced gene silencing (VIGS) systems applicable to dicotyledonous plants, while those applicable to monocotyledonous plants are limited, and the VIGS vectors successfully applied to maize are even fewer. As early as 2006, Ding et al. found that under greenhouse conditions, Brome mosaic virus (BMV) would cause systemic mosaic symptoms on a specific maize variety (Va35). Subsequently, BMV was modified into a VIGS vector applicable to maize. In recent years, more and more plant viruses have been developed into VIGS vectors and successfully applied to maize, such as Cucumber mosaic virus (Wang et al., 2016), Tobacco rattle virus (Zhang et al., 2017), Maize streak virus (Mlotshwa et al., 2020), Maize dwarf mosaic virus (Xie et al., 2021), and Sugarcane mosaic virus (Gour et al., 2023). So far, Foxtail mosaic virus (FoMV) is the most deeply studied and widely applied maize virus vector. FoMV has five open reading frames (ORFs). ORF1 encodes an RNA-dependent RNA polymerase (RdRp). ORF2, ORF3, and ORF4 encode a triple gene module protein, which is related to virus movement. ORF5 encodes the virus coat protein (CP). The FoMV infectious clone can establish systemic infection in maize inbred lines, sorghum ( Sorghum bicolor ) and green foxtail ( Setaria viridis ). A VIGS vector has been successfully constructed and achieved the silencing of four genes in sweet corn, and a chlorotic phenotype was observed (Mei et al., 2016). Subsequently, FoMV was further modified into an exogenous protein expression vector and a gene editing targeted delivery vector, expanding the application scope of FoMV (Bouton et al., 2018; Mei et al., 2019). However, through our statistics, FoMV can only infect about 18% of maize inbred lines, and most maize inbred lines are resistant to FoMV virus and cannot apply its virus vector. Summary of the Invention
[0004] The object of the present invention is to provide ZmRF1 a gene and its application in regulating maize resistance to Setaria italica mosaic virus.
[0005] A ZmRF1 gene, wherein the polynucleotide of the ZmRF1 gene is as shown in (a), (b), (c) or (d): (a) a polynucleotide as shown in Sequence Listing SEQ ID No: 1; or (b) a polynucleotide capable of hybridizing with the complementary sequence of SEQ ID No: 1 under stringent hybridization conditions, and the protein encoded by the polynucleotide still has the function of regulating maize resistance to Setaria italica mosaic virus; or (c) a polynucleotide having at least 90% or more homology with the polynucleotide shown in SEQ ID No: 1; or (d) a polynucleotide mutant obtained by deletion, substitution or insertion of one or more bases on the basis of the polynucleotide shown in SEQ ID No: 1, and the protein encoded by the polynucleotide mutant still has the activity of regulating maize resistance to Setaria italica mosaic virus.
[0006] A ZmRF1 protein, wherein the amino acid sequence of the ZmRF1 protein is as shown in (a), (b) or (c): (a) an amino acid sequence as shown in Sequence Listing SEQ ID No: 2; or (b) an amino acid having at least 90% or more homology with the amino acid shown in SEQ ID No: 2; or (c) a protein mutant obtained by deletion, substitution or insertion of one or more amino acids on the basis of the protein shown in SEQ ID No: 2, and the protein still has the activity of regulating maize resistance to Setaria italica mosaic virus.
[0007] A vector containing the ZmRF1 gene.
[0008] An engineered bacterium containing the ZmRF1 vector containing the gene.
[0009] Primers for detecting any fragment of the ZmRF1 gene.
[0010] The ZmRF1 application of the gene in cultivating maize varieties with regulated resistance activity to Setaria italica mosaic virus.
[0011] A method for reducing the resistance activity of maize to Setaria italica mosaic virus, which is to reduce the expression level of ZmRF1 protein in maize.
[0012] A method for improving the activity of maize against foxtail mosaic virus, which improves the expression level of ZmRF1 protein in maize.
[0013] A molecular marker, which is the locus Chr5_218585665, and its nucleotide changes from C to T.
[0014] The beneficial effects of the present invention: The present invention has identified the major gene conferring resistance to FoMV in maize and named it Resistance to Foxtail Mosaic Virus 1 ( ZmRF1 ). It is worth noting that in the second group of samples, ZmRF1 There is a single nucleotide polymorphism (SNP) locus on the gene, which is significantly higher than the threshold. This SNP leads to the extension of the W22 protein (resistant), in other words, leads to the premature termination of the B73 protein (susceptible). Phylogenetic analysis shows that ZmRF1 There are many homologous proteins in maize, rice and Arabidopsis, most of which have not been studied. On the phylogenetic tree, ZmRF1 contains a conserved tetratricopeptide repeat (TPR) domain and is closely related to the proteins of the heat shock protein 70-heat shock protein 90 organizing protein (HOP) family, which implies that it may also have the function of promoting protein folding. In summary, ZmRF1 is a novel and key antiviral protein in maize. Description of the Drawings
[0015] Figure 1 is the phenotype of Agrobacterium tumefaciens injecting tobacco with pV101-eGFP; the phenotypes of tobacco leaves 1-4 days after inoculating pV101-eGFP under white light and ultraviolet (blue light), and the scale bar is 5 cm.
[0016] Figure 2 is the phenotype of inoculating maize B73 with pV101-eGFP; the phenotypes of different leaves and the whole plant of maize B73 one week after inoculating pV101-eGFP under ultraviolet (blue light), and the scale bar is 1 cm.
[0017] Figure 3 is FoMV-mediated VIGS in maize; A - the chlorotic phenotype of maize VIGS, GFP: pV101-eGFP, and the scale bar is 1 cm long; B - qPCR detection of maize VIGS; T-TEST p-value < 0.1 '*'; p-value < 0.05 '**'; p-value < 0.01 '***'.
[0018] Figure 4GWAS analysis of maize resistance to FoMV; Phenotypes of A-B104 and B73 inoculated with pV101-eGFP for one week, scale bar is 1 cm; B-Number of susceptible and resistant inbred lines in Population 1 and Population 2; C-D-QQ plots after GWAS analysis of Population 1 and 2; E-F-Manhattan plots after GWAS analysis of Population 1 and 2; Red dashed line - threshold -log10(0.05 / N), N is the number of all SNPs.
[0019] Figure 5 For the identification of mutant phenotypes in the hybrid F2 generation; A-Fine mapping flowchart of the hybrid F2 generation; B-Virus resistance segregation rate of maize F2 progeny; B73×By4839: 92 resistant, 394 susceptible; Expected value: 1:3 (X² = 9.55, P = 0.002); B73×Chang3: 95 resistant, 393 susceptible; Expected value: 1:3 (X² = 7.97, P = 0.005).
[0020] Figure 6 For linkage analysis and fine mapping based on molecular markers in the hybrid F2 generation; Gray rectangles: heterozygous genotypes; White rectangles: B73 genotypes.
[0021] Figure 7 For the identification of CRISPR genotypes and phenotypes of genes in the mapped interval. Scale bar is 1 cm.
[0022] Figure 8 For the major gene of maize resistance to FoMV ZmRF1 Determination; A-Overview of the non-complementation screening scheme; B-Two susceptible M1 generation plants were identified, and insertion-deletion (InDel) molecular markers were used to identify whether these plants were heterozygous; C-The genotypes of the mutants were determined by first-generation sequencing; * represents premature termination mutations; D- ZmRF1 Manhattan plot of Population 2 of the gene; E-Phenotype of UFMu-11292 inoculated with pV101-eGFP, control is wild type W22; F-Schematic diagram of the mu insertion position and primer design of ZmRF1; G-Genotype identification of UFMu-11292, M-DNA marker, bands from large to small are 2k, 1k, 750bp, 500bp, 250bp, 100bp.
[0023] Figure 9 Genotype verification of mutants was performed by PCR cloning and Sanger sequencing. Specific implementation manners
[0024] To facilitate the understanding of the present invention, the present invention will be described more comprehensively below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, these embodiments are provided to make the understanding of the disclosure of the present invention more thorough and comprehensive.
[0025] Example 1: FoMV Infection of Maize and Mediated Gene Silencing FoMV infection of maize: After the FoMV viral vector pV101-eGFP was transformed into Agrobacterium tumefaciens GV3101 and injected into tobacco, strong GFP expression could be observed on the injected leaves under blue light on the second day after inoculation. On the fourth day, due to the strong expression of the virus, the tobacco leaves withered ( Figure 1 ).
[0026] The tobacco leaves with strong GFP expression were collected, ground thoroughly, and then rubbed and inoculated onto maize B73 at the 2-3 leaf stage. One week after inoculation, GFP expression could be observed on the inoculated leaves (L1, L2) and systemic leaves (L3) ( Figure 2 ). The GFP expression on the leaf veins was particularly strong, indicating that FoMV spreads to the systemic leaves through the leaf veins of maize.
[0027] FoMV-mediated gene silencing: The four chlorosis phenotype genes most commonly used to characterize the VIGS effect in maize are: PDS ( Zm00001eb006300 ), ChlH ( Zm00001eb433610 ), IspH ( Zm00001eb056240 ), Les22 ( Zm00001eb016170 ). Reverse sequences of 160-350 bp of these four genes were amplified respectively and inserted into the pV101-mcs vector to construct the VIGS vector. Maize B73 was infected by rubbing and inoculation. Two weeks after inoculation, pV101-EGFP was used as a control group, and different degrees of chlorosis phenotypes could be observed on the systemic leaves (L3). Total RNA was extracted from these leaves for qPCR. The results showed that compared with pV101-eGFP, PDS , ChlH , IspH and Les22 gene expression levels were significantly reduced ( Figure 3 ).
[0028] Example 2: GWAS Analysis of Maize Resistance to FoMV The pV101-eGFP vector was used to infect two populations of maize inbred lines. Population 1 consisted of 513 maize inbred lines, and Population 2 consisted of 643 maize inbred lines, with 50 inbred lines common to both. The disease-susceptible and disease-resistant traits were characterized by observing the expression of GFP in maize leaves. The disease-susceptible phenotype was recorded as "1", the disease-resistant phenotype was recorded as "0", and the missing phenotype was recorded as "NA".
[0029] In Population 1, 52 were disease-susceptible and 397 were disease-resistant. In Population 2, 81 were disease-susceptible and 375 were disease-resistant ( Figure 4 as shown in A - B). Combining Population 1 and Population 2, the disease-susceptible inbred lines accounted for approximately 18% in nature. GWAS analyses were performed separately on the genotype data and phenotype data of the two populations.
[0030] The results showed that for Population 1, there were SNP signals above the threshold on Chromosomes 1 and 5; for Population 2, there were SNP signals above the threshold on Chromosomes 2, 3, and 5 ( Figure 4 as shown in C - F). Both populations had strong correlation signals at the end of Chromosome 5, indicating that there was a major gene determining maize resistance to FoMV at this location.
[0031] Example 3 Linkage Analysis to Narrow the Mapping Interval Linkage analysis is an important means for fine mapping. By constructing an F2 population from the cross between a disease-susceptible (B73) and a disease-resistant (Chang3 / By4839) line, and designing InDel and SNP molecular markers in the mapping interval, the mapping interval was further narrowed by screening for recombinant individuals in the mapping interval.
[0032] Phenotypic identification of the F1 and F2 generations of the cross: The F1 generations obtained from the crosses between different disease-resistant maize inbred lines and B73 showed significant phenotypic variations. For example, in the F1 generation of the cross between B110, GEMS17, and 18 - 599, approximately half were disease-resistant and half were disease-susceptible, but the degree of disease susceptibility was significantly reduced. In contrast, for the inbred lines TY1, GY1032, B104, Chang 3, and By4839 used in this example, when they were crossed with B73, all the F1 generations showed disease resistance. Therefore, the F1 generation of Chang3 and By4839 was self-crossed to obtain the F2 generation of the cross. Molecular marker detection was performed on the plants with the disease-susceptible phenotype in the F2 generation to determine their genotypes ( Figure 5 as shown in A).
[0033] Phenotypic identification of the F2 generation of the cross between Chang3 and By4839 found that approximately 19% of the plants were disease-susceptible in both populations, proving that disease resistance was a dominant trait and trait segregation occurred in the F2 generation of the cross ( Figure 5 as shown in B).
[0034] Genotype Identification and Fine Mapping of Susceptible Plants in the Hybrid F2 Generation: Susceptible individuals in the hybrid F2 population were screened. First, they were detected using the InDel molecular markers InD2 and InD10 at both ends of the mapping interval. If the genotypes at both positions were those of B73, then the plants were not recombinant strains within the mapping interval; if one end had the genotype of B73 and the other end had a heterozygous genotype, it indicated that recombination had occurred in this plant within the mapping interval and further fine mapping was needed; the situation where both ends had heterozygous genotypes theoretically did not exist because susceptibility is a recessive trait. Indeed, in the actual screening, most of the susceptible individuals had the B73 genotype within the mapping interval, but 8 precious recombinant strains were also screened. Further molecular marker detection was carried out on them, and the mapping interval was successfully narrowed down to a range of approximately 90 kb between InD5 and SNP5 ( Figure 6 ). Population 1 is the second version of the maize genome, and population 2 is the fourth version of the maize genome. Here, we used the more updated and accurate fourth version of the genome as the standard, and there were 5 protein-coding genes in the mapping interval.
[0035] Example 4 Determination of the Major Gene for Maize Resistance to FoMV ZmRF1 The GWAS analysis described in Example 2 used the second and fourth versions of the maize genome. Later, considering that the fifth version of the genome was more accurate and detailed in gene structure and function annotation, the fifth version of the genome was used in subsequent experiments and analyses. By performing expression analysis, CRISPR mutant creation, and non-complementation screening on the 5 genes in the mapping interval, the major gene for maize resistance to FoMV was finally determined.
[0036] Maize CRISPR Mutants: Since maize disease resistance is a dominant trait, therefore, targets were designed for the five genes in the mapping interval to construct CRISPR vectors, which were used to infect and transform maize with the B104 background for gene knockout. Genotype identification and phenotype identification were carried out on the received F1 generation seeds. Only Zm00001eb257360 、 Zm00001eb257370 and Zm00001eb257380 homozygous deletion mutants were detected, all of which caused frameshift mutations and premature termination of the genes ( Figure 7 ). However, the homozygous deletion mutants of the 3 genes had the same disease-resistant phenotype as B104. Therefore, these 3 genes could be excluded. No mutants were detected for the other two genes Zm00001eb257350 and Zm00001eb257390 .
[0037] Maize Non-Complementation Screening and Allele Detection: EMS is a commonly used mutagen in the field of crop breeding and is favored by scientific researchers and breeders because of its low price and simple operation. Our experimental method for non-complementation screening ( Figure 8 In A), the pollen of the disease-resistant inbred line B104 was mutagenized by EMS and pollinated to the emasculated B73. Diseased plants were screened in the M1 generation, and second-generation or first-generation sequencing was performed to determine the major gene and the mutation position. Two diseased plants were successfully screened in the M1 generation, and it was confirmed by molecular marker detection that M1-1 and M1-2 were indeed heterozygotes of B104 and B73, while the F1 generation of the cross between the control group B73 and B104 was disease-resistant ( Figure 8 In B), through first-generation sequencing, it was determined that the mutation sites came from Zm00001eb257390 the first exon and the fifth exon of the gene. Among them, the base C in M1-1 mutated to T, resulting in the mutation of the 6th arginine (Arg) to a stop codon (UAG), and the base T in M1-2 mutated to A, resulting in the mutation of the 279th tyrosine (Tyr) to a stop codon (TAA) ( Figure 8 In C), it was thus determined that this gene was the major gene for maize resistance to FoMV and was named ZmRF1 .
[0038] It should be noted that there is a SNP in the 8th exon of the ZmRF1 gene. It is T in B73, just located at the stop codon UGA of this gene, while it is C in B104, and CGA encodes arginine (Arg), which also makes its coding region 732 bp longer than that of B73 ( Figure 8 In D), it was speculated that B73 belonged to a premature termination mutation of this gene, which led to the inability of ZmRF1 in B73 to function properly and the loss of the ability to resist FoMV. In addition, in order to prevent the mutation sites of these two EMS mutants from occurring in B73, allele detection was further carried out to determine. The fragment containing the mutation site and SNP was amplified by PCR, ligated to the Blunt vector, and single colonies were picked for sequencing. Through the first-generation sequencing of monoclonal colonies, it was proved that the EMS mutation sites of M1-1 and M1-2 were located on the genome of B104 ( Figure 9 ).
[0039] Identification of maize UFMu mutants: The background of the U.S. UFMu mutants is the disease-resistant inbred line W22 background resistant to FoMV. The knockout mutant UFMu-11292 with mu inserted into the 5’UTR of ZmRF1 was obtained. The insertion allele of the Mu transposon led to transcriptional inhibition and made this gene lose its function. Primers F and R (F: 5’ATGCGTATGAATAAAATAGTGG 3’ SEQ ID No: 3, R: 5’ GGTAGCATAGAATCATAGAGGGA 3’SEQ IDNo: 4) were designed at both ends of the mu insertion position, and the genotype was identified in combination with the mu detection primer MIR5 (MIR5: 5’ GCTCTTCKTCYATAATGRCAATT 3’ SEQ ID No: 5).
[0040] The results showed that the mutant could be amplified with MIR5 and R primers, but not with F and R primers, indicating that UFMu-11292 was a homozygous mu insertion mutant. Phenotypic identification showed that the homozygous Mu insertion strain in the W22 background completely lost its resistance to the virus, and its susceptibility was comparable to that of the B73 control strain. This series of allele experiments confirmed conclusively through loss-of-function complementation experiments. ZmRF1 is a dominant virus resistance gene in maize ( Figure 8 EG). It also shows that by knocking out ZmRF1 , which can achieve the transformation of corn from disease resistance to disease susceptibility, thereby expanding the host of FoMV.
[0041] The protein sequence of ZmRF1_B104 was retrieved from the National Center for Biotechnology Information (NCBI) database (https: / / www.ncbi.nlm.nih.gov / ). Basic Local Alignment Search Tool (BLAST) analysis was performed on the protein, and the species were designated as maize, rice ( Oryza sativa ) and Arabidopsis. By setting less than 10e -10 of P A total of 52 homologous protein sequences were successfully obtained by using the maximum likelihood algorithm integrated in the MEGA X software. These 52 protein sequences were then compared and analyzed, and a phylogenetic tree was constructed. Subsequently, the phylogenetic tree was annotated and improved on the iTol platform (https: / / itol.embl.de / ). Alphafold3 predicted the three-dimensional structure of the protein.
[0042] A genome-wide protein alignment search (BLAST) of the proteomes of maize, rice, and Arabidopsis using the ZmRF1_B104 sequence identified 52 conserved homologous proteins. Maximum likelihood phylogenetic reconstruction analysis showed the existence of two distinct clades: one clade consisted of typical heat shock protein 70-heat shock protein 90 organizing protein (HOP) family members characterized by tandem tetratricopeptide repeat domain 5 (TPR_5, PF13181) and carbohydrate binding module (CBM, PF03422) domains; the other clade contained ZmRF1A new clade of orthologs. These evolutionarily divergent paralogs retain the TPR_5 protein-binding domain but lack the CBM module and instead have acquired a lineage-specific domain architecture, including a U-box domain 2 (U-box_2, PF04564) and a serine / threonine kinase (serkin_6; PF07714) domain. Based on the conserved domain recombination pattern, this phylogenetically distinct proteome was named HOP-like proteins (HLPs).
[0043] Subcellular localization analysis showed that ZmRF1 is localized in the cytoplasm. Structural dissection revealed that all tetratricopeptide repeat domains 5 (TPR_5, PF13181) are concentrated only in the N-terminal module, and the extended C-terminal region (amino acids 351 to 594) has no recognizable conserved domains.
[0044] The above-described embodiments merely represent several implementation manners of the present invention, and the description thereof is relatively specific and detailed, but it should not be construed as a limitation on the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all fall within the protection scope of the present invention. Therefore, the protection scope of the invention patent shall be subject to the appended claims.
Claims
1. A ZmRF1 A gene characterized by Said ZmRF1 The polynucleotide of the gene is shown as (a), (b), (c) or (d): (a) a polynucleotide as shown in SEQ ID No: 1; or (b) a polynucleotide that can hybridize with the complementary sequence of SEQ ID No: 1 under stringent hybridization conditions, and the protein encoded by the polynucleotide still has the function of regulating corn resistance to foxtail mosaic virus; or (c) a polynucleotide having at least 90% homology with the polynucleotide shown in SEQ ID No: 1; or (d) A polynucleotide mutant obtained by deleting, substituting or inserting one or more bases based on the polynucleotide shown in SEQ ID No: 1, and the protein encoded by the polynucleotide mutant still has the activity of regulating corn resistance to foxtail mosaic virus.
2. A ZmRF1 protein, characterized in that The amino acid sequence of the ZmRF1 protein is shown in (a), (b) or (c): (a) the amino acid sequence as shown in SEQ ID No: 2 in the sequence listing; or (b) an amino acid having at least 90% homology with the amino acid shown in SEQ ID No: 2; or (c) A protein mutant obtained by deleting, substituting or inserting one or more amino acids based on the protein shown in SEQ ID No: 2, and the protein still has the activity of regulating corn resistance to foxtail mosaic virus.
3. Containing the method described in claim 1 ZmRF1 Gene vector.
4. Containing the method described in claim 3 ZmRF1 Engineered bacteria that carry gene vectors.
5. Detection of claim 1 ZmRF1 Primers for any fragment of a gene.
6. The method according to claim 1 ZmRF1 The use of genes in breeding maize varieties with regulated activity against foxtail mosaic virus.
7. A method for reducing the activity of corn against foxtail mosaic virus, characterized in that: Reduce the expression level of ZmRF1 protein in maize.
8. A method for improving the activity of corn against foxtail mosaic virus, characterized in that: Improve the expression level of ZmRF1 protein in corn.
9. A molecular marker, characterized in that The molecular marker is the Chr5_218585665 site, whose nucleotide changes from C to T.