Application of SlHDT3 gene in regulating drought resistance of tomato
Knocking out the tomato SlHDT3 gene through CRISPR/Cas9 technology solved the problem of poor growth of tomatoes under drought conditions and significantly improved their drought resistance.
Patent Information
- Application Number
- CN202510646530.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-20
- Publication Date
- 2025-06-20
- Estimated Expiration
- 2045-05-20
AI Technical Summary
Tomatoes grow slowly under drought conditions, wilt leaves and poor fruit development. There are few related research in the existing technology, especially in response to abiotic stress such as drought stress. The functions and regulatory mechanisms are not yet clear.
Knock out the SlHDT3 gene in tomatoes by CRISPR/Cas9 gene editing technology, reducing its expression and/or activity to improve drought resistance of tomatoes.
The effect of improving the drought tolerance of tomatoes was achieved, and the growth performance and survival rate under drought conditions was significantly improved.
Smart Images

Figure CN120173971A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of modern agricultural technologies, and specifically relates to SlHDT3 the application of a gene in regulating the drought resistance of tomatoes. Background Art
[0002] Tomato ( Solanum lycopersicum ) is one of the important economic crops widely cultivated globally. However, with the intensification of global climate change, drought has become one of the main limiting factors affecting tomato yields. Drought stress can cause slow growth of tomato plants, leaf wilting, poor fruit development, and even death. Therefore, studying methods to improve the drought resistance of tomatoes is of great significance for ensuring stable tomato production and supply.
[0003] In the natural environment, plants can adapt to various environmental conditions, which is attributed to the combined action of genetic variation and epigenetic variation (Grativol C, Hemerly A S, Ferreira P. 2012. Genetic and epigenetic regulation of stress responses in natural plant populations. Biochimica et Biophysica Acta (BBA) - Gene Regulatory Mechanisms, 1819: 176 - 185). Histone acetylation modification, as an important epigenetic mechanism, regulates gene expression and is involved in plant growth, development, and environmental stress responses. A large number of studies have shown that histone acetyltransferases (HATs) and histone deacetylases (HDACs) regulate the transcriptional level of genes by dynamically regulating histone acetylation and play a key role in the process of plants coping with drought stress (Kim J M, To T K, Ishida J, et al. 2012. Transition of chromatin status during the process of recovery from drought stress in Arabidopsis thaliana . Plant and Cell Physiology, 53: 847 - 856).
[0004] In Arabidopsis thaliana, HDA9 and ABI4 form a repressive complex that regulates the expression of CYP707A1 and CYP707A2 under drought stress (Baek D, Shin G, Kim M C, et al. 2020. Histone deacetylase HDA9 with ABI4 contributes to abscisic acid homeostasis in drought stress response. Frontiers in Plant Science, 11: 143). In Brachypodium distachyon, the homologous gene of AtHDA19 inhibits the expression of the drought-responsive gene BdWRKY24 through deacetylation, thereby regulating the resistance to drought stress mechanisms (Song J, Henry H A L, Tian L. 2019. Brachypodium histone deacetylase BdHD1 positively regulates ABA and drought stress responses. Plant Science, 283: 355-365). In tobacco, overexpression of the histone deacetylase gene HDA903 in the Populus trichocarpa genome can upregulate the expression of drought-responsive genes and enhance the drought resistance of plants (Ma X, Zhang B, Liu C, et al. 2017. Expression of a populus histone deacetylase gene 84KHDA903 in tobacco enhances drought tolerance. Plant Science, 265: 1-11). In Arabidopsis thaliana, overexpression of AtHD2C (a member of the HD2 subfamily) renders plants insensitive to ABA and improves their tolerance to drought stress (Sridha S, Wu KQ. 2006. Identification of AtHD2C as a novel regulator of abscisic acid responses in Arabidopsis. Frontiers Iin Plant Science, 46(1): 124-133).
[0005] It can be seen that histone deacetylases have been studied more in other species, while there are few related reports in tomatoes. Moreover, most of them focus on the regulation of fruit ripening, and their functions and regulatory mechanisms in abiotic stress responses such as drought stress are still unclear. Summary of the Invention
[0006] To solve the above technical problems, the technical solution adopted by the present invention is as follows: In the first aspect of the present invention, there is provided the use of inhibiting SlHDT3 gene in improving the drought tolerance of tomatoes, wherein SlHDT3 the nucleotide sequence of the
[0007] gene is as shown in SEQ ID NO: 1. SlHDT3 In some embodiments of the present invention, the method of inhibiting the SlHDT3 gene includes knocking out the SlHDT3 gene, knocking down the SlHDT3 gene, or a method of causing an inactivating mutation in the
[0008] In the second aspect of the present invention, there is provided the use of a biological material related to inhibiting the SlHDT3 gene in cultivating tomato varieties, wherein SlHDT3 the nucleotide sequence of the
[0009] gene is as shown in SEQ ID NO: 1. SlHDT3 In some embodiments of the present invention, the application is to construct a biological material related to inhibiting the
[0010] gene to obtain a tomato variety with improved drought tolerance.
[0011] In some embodiments of the present invention, the biological material does not include reproductive materials.
[0012] In some embodiments of the present invention, the biological material includes nucleic acid molecules, vectors, cells. SlHDT3 In some embodiments of the present invention, the nucleic acid molecule includes microRNA, siRNA, shRNA, dsRNA, sgRNA and / or antisense oligonucleotides that inhibit the
[0013] function.
[0014] In some embodiments of the present invention, the sequence of the sgRNA is as shown in SEQ ID NO: 2.
[0015] In some embodiments of the present invention, the sgRNA is used in combination with a CRISPR / Cas9 vector to achieve the purpose of gene knockout.
[0016] In some embodiments of the present invention, the CRISPR / Cas9 vector further includes an expression vector containing the sgRNA, and may of course also include Cas9 protein or an expression vector for expressing Cas9 protein.
[0017] In some embodiments of the present invention, the cells include at least one of Escherichia coli and Agrobacterium tumefaciens. Among them, Escherichia coli is a commonly used host cell for constructing vectors and plasmids in the art, and Agrobacterium tumefaciens is a common tool for delivering DNA molecules to plants in the art.
[0018] The third aspect of the present invention provides a method for cultivating tomato varieties with high drought tolerance, including the step of reducing the expression level and / or activity of SlHDT3 gene in tomatoes.
[0019] In some embodiments of the present invention, the tomato variety has the following characteristics: the drought tolerance is improved relative to a reference level; the reference level is the level of the wild type.
[0020] In some embodiments of the present invention, the step of reducing the expression level and / or activity of SlHDT3 gene in tomatoes is to introduce the biological material related to inhibiting SlHDT3 gene described in the second aspect of the present invention into tomato tissues or tomato cells.
[0021] In some embodiments of the present invention, the introduction method includes using at least one of Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, and electroporation.
[0022] In some embodiments of the present invention, the step of reducing the expression level and / or activity of SlHDT3 protein in tomatoes specifically includes: (1) Design the target sequence sgRNA of SlHDT3 gene, and construct a CRISPR / Cas9 vector for gene editing of tomatoes SlHDT3 gene.
[0023] (2) Transfer the CRISPR / Cas9 vector described in step (1) into Agrobacterium tumefaciens competent cells to obtain Agrobacterium tumefaciens containing the CRISPR / Cas9 vector.
[0024] (3) Infect the cotyledons of ordinary wild-type tomatoes with the Agrobacterium tumefaciens infection solution obtained in step (3), regenerate seedlings through tissue culture, and screen stable genetic mutant lines of tomatoes SlHDT3 gene mutation, without exogenous Cas9 protein, and with variant target sequences.
[0025] In some embodiments of the present invention, the vector is pCAMBIA1301.
[0026] In some embodiments of the present invention, the host cell is Agrobacterium tumefaciens GV3101.
[0027] In some embodiments of the present invention, the tomato variety is Condine Red (CR).
[0028] The beneficial effects of the present invention are as follows: The present invention discovers that SlHDT3 genes play a significant role in regulating the drought tolerance of tomatoes. By using the CRISPR / Cas9 gene editing technology to knockout the tomato gene SlHDT3 , and obtaining the homozygous mutants with SlHDT3 knocked out. Through a series of experiments, it is proved that: compared with the wild type, SlHDT3 the gene knockout mutants have better drought tolerance phenotypes. Therefore, the present invention provides a new method for breeding drought-tolerant tomato varieties. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] The present invention will be further described below in conjunction with the drawings and embodiments, where: Figure 1 For SlHDT3 the detection results of gene knockout tomatoes and overexpressing tomatoes, where A is SlHDT3 the detection results of tomato plants with
[0030] Figure 2 gene knocked out, and B is the result of identifying the overexpressing transgenic positive lines of HDT3 protein by anti-HA protein immunoblotting. Ponceau S staining shows the protein loading amount. SlHDT3 For SlHDT3 the gene expression results of overexpressing,
[0031] Figure 3 gene knocked out, and wild-type tomatoes. hdt3 -1#, mutant line 1; hdt3 -2#, mutant line 2; OE- HDT3 -2#, overexpressing plant line 2; OE- HDT3 -5#, overexpressing plant line 5.
[0032] Figure 4 For
[0033] Figure 5 the survival rate and water loss rate results of different types of tomato plants, where A is the survival rate result after drought treatment, and B is the water loss rate result of detached leaves.
[0034] Figure 6 For DETAILED DESCRIPTION OF THE EMBODIMENTS
[0035] The concept of the present invention and the resulting technical effects will be clearly and completely described below in conjunction with embodiments to fully understand the purpose, features, and effects of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative efforts belong to the scope of protection of the present invention.
[0036] Example 1 SlHDT3 Obtaining of gene knockout plants Use CRISPR / Cas9 technology to construct gene knockout mutants. Search for the CDS sequence of tomato from the NCBI (http: / / www.ncbi.nlm.nih.gov / ) database. HDT3 The CDS sequence.
[0037] The nucleotide sequence of the SlHDT3 gene is as follows:
[0038] Using CRISPR-P ( https: / / www.genome.arizona.edu / crispr / CRISPRsearch.html) to design HDT3 the sgRNA sequence of the gene (CAAGCTCATTCATATTTCTC, SEQ ID NO: 2). With the help of a PCR instrument, this single-stranded sgRNA is annealed to form double-stranded sgRNA, and single digestion is carried out with Bpi1 restriction endonuclease. The digestion conditions are 37 °C for 30 min. The fragment is ligated to the CRISPR / sgRNA vector using T4 ligase. After successful plasmid ligation, the target fragment is ligated to the pCAMBIA1301 vector by double digestion with KpnI and HindIII.
[0039] After successful sequencing verification, the pCAMBIA1301-HDT3 vector is electrotransformed into Agrobacterium tumefaciens GV3101 for tomato genetic transformation. The cotyledons of the wild-type tomato variety CR (Condine Red) are infected with Agrobacterium tumefaciens, and the cotyledons are then cultured into complete transgenic tomato plants through plant tissue culture. Subsequently, primers are designed upstream and downstream according to the target position. The primers are cri-HDT3-F (GCAATTGTTTGCCAGATTTTAT, SEQ ID NO: 3) and cri-HDT3-R (ACATCATCTCCAGAGTCAATTTC, SEQ ID NO: 4).
[0040] After obtaining the transgenic plants, the DNA of the T0 generation leaves is extracted, and a genomic DNA fragment of about 800 bp including sgRNA is amplified using PCR technology and sent to the company for sequencing. The sequencing results are compared with the original genomic sequence through Snapgene software, and the mutant plants are screened. Subsequently, homozygous hdt3 mutants are obtained by self-crossing, and two lines with different mutant types are selected for the following experiments.
[0041] The knockout results are as shown in Figure 1 A below. Among them, compared with the ordinary tomato without gene editing, base deletions occur at the position of sgRNA in the gene-edited mutants. Hereinafter, the ordinary tomato without gene editing is referred to as the control. hdt3 #1 inserts a base A compared with the control, hdt3 #2 deletes 7 bases compared with the control.
[0042] Example 2 Construction of overexpressed OE- HDT3 transgenic materials Put HDT3The CDS sequence with the stop codon removed and the vector pAC004-HA were input into the software CE DesignV1.03 to generate specific amplification primers.
[0043] The pAC007-FLAG vector was mixed with restriction endonucleases (AscI and KpnI) for digestion, and then the vector was ligated to the fragment by homologous recombination.
[0044] The successfully sequenced recombinant plasmid was electrotransformed into the Agrobacterium competent GV3101. This expression vector would express and produce the HDT3-HA protein in plants.
[0045] T0 generation plants were obtained after tomato genetic transformation, and Western Blot was used for verification. HDT3 For the overexpressing transgenic plants, the primary antibody was the HA antibody.
[0046] The Western Blot results of overexpression were as Figure 1 shown in B.
[0047] In this example, the RNA expression of transgenic plants was further detected.
[0048] The qPCR primers were as follows (5’-3’): SlHDT3-RT-F: GAAAGCAGGACAAACACTAAAGG (SEQ ID NO: 5); SlHDT3-RT-R: CCTCAGCAGATAGAGTTCCAATG (SEQ ID NO: 6).
[0049] The results were as Figure 2 shown. In the overexpressing materials, SlHDT3 the expression level was about 2 times that of CR, while in the mutants, SlHDT3 the expression level was about 10% of CR. The lowercase letters a, b, c represent significant differences at the 5% level among the RNA expression levels of different plants.
[0050] Example 3 SlHDT3 Results of the regulation of genes on tomato drought resistance 1. Experimental method Drought stress treatment: Tomato seeds were soaked in warm water at 50 °C for 15 min and then placed in a constant speed shaker at 28 °C (200 rpm) for germination for 3 d, changing the water every 12 h. When the radicles of the seeds showed white and reached about 1 cm, they were sown in 72-well trays. The substrate type was a 3:1 mixture of peat and vermiculite and cultured in a plant factory with the temperature set at 21 / 19 °C (day / night), a photoperiod of 12 h light / 12 h dark, and a light intensity of 200 μmol m -2s -1 When the tomato seedlings had grown one true leaf, the seedlings were transplanted into planting pots, and an appropriate amount of Hoagland nutrient solution was irrigated every 3 days.
[0051] When the tomatoes grew to three leaves and one heart, healthy plants with similar growth states were selected for water withholding treatment. Each treatment had three replicates, and each replicate used 20 seedlings. After 12 days of drought treatment, rewatering was immediately carried out, and the survival rate was calculated 3 days later.
[0052] Detection of water loss: To measure the water loss of fresh leaves of different genotypes, healthy leaves of plants grown under control conditions were picked and immediately weighed to measure their fresh weight. The leaves were weighed at 60-minute intervals for a total of 600 minutes. The calculation result was the ratio of the percentage of water loss to the fresh weight of the leaves.
[0053] DAB staining: (1) Take the leaves of the plant to be detected, rinse the surface dirt with clean water, and put them into a petri dish containing 5 mg / mL DAB solution.
[0054] (2) Incubate in the dark for 12 h.
[0055] (3) Boil the plant material in 95% ethanol for 10 min.
[0056] (4) Transfer the boiled material to fresh 95% ethanol. After cooling to room temperature, take a photo for recording.
[0057] Determination of electrical conductivity: (1) Take the leaves at the same leaf position, mix them evenly and cut them into uniform strips. Weigh 0.2 g and place it in a 50 mL centrifuge tube containing 20 mL of ddH2O, so that the ultrapure water completely submerges the leaves. Each treatment has 5 replicates.
[0058] (2) Place the above samples on a shaker at 28 °C and shake at 200 rpm for 1 - 2 h. Measure the value EC1 with a digital conductivity meter (DDS-11A, Hangzhou Aolilon Instrument Co., Ltd.).
[0059] (3) Then place the samples in a water bath at 95 °C for 15 - 20 min. After cooling to room temperature, measure the total conductivity value EC2.
[0060] (4) Calculate the relative conductivity according to the following formula: REL(%) = EC1 / EC2 × 100%.
[0061] Determination of hydrogen peroxide content and MDA malondialdehyde content: Drought stress can induce a series of physiological and biochemical changes in plants. For example, hydrogen peroxide (H2O2) accumulates under drought stress, which will further exacerbate the degree of membrane lipid peroxidation in cells, leading to the leakage of cellular ions. Therefore, the content of H2O2 and the ion permeability are common physiological indicators for evaluating the drought resistance of plants.
[0062] In addition, malondialdehyde (MDA) is the product of membrane lipid peroxidation in plant tissues under stress conditions, and its content can determine the degree of membrane lipid peroxidation. The determination of hydrogen peroxide content refers to the instruction manual of the biological kit from Suzhou Keming. The determination of MDA content is carried out according to the instruction manual of the kit (Solarbio, China).
[0063] 2. Experimental results The results of plant growth phenotypes in different groups are as Figure 3 shown. Before and after water withholding treatment, compared with the wild type, hdt3 the drought-resistant phenotype of the mutant is obvious.
[0064] The results of plant survival rate and water loss rate in different groups are as Figure 4 shown. After the completion of drought stress and rehydration, the survival rate of the wild type is 50%, hdt3 the survival rate of the -1# mutant plants is about 71%, hdt3 the survival rate of the -2# mutant plants is about 77%, and the survival rate of the OE- HDT3 -2# overexpressing plants is about 15%, and the survival rate of the OE- HDT3 -5# overexpressing plants is about 26%. Lowercase letters a, b, c represent significant differences between the values of different plants at the 5% level. Among them, the leaf water loss rates of overexpressing plants, wild type and mutant plants show a linear relationship from high to low.
[0065] DAB staining is as Figure 5 shown in A. Among them, the darker the color, the more H2O2 content accumulates in the leaves, indicating that the plant is more severely stressed by drought. The DAB staining degrees of overexpressing plants, wild type and mutant plants show a linear relationship from high to low. The conductivity results are as Figure 5 shown in B. The more severely stressed by drought, the higher the relative conductivity value; the relative conductivity degrees of overexpressing plants, wild type and mutant plants show a linear relationship from high to low. Lowercase letters a, b, c represent significant differences between the relative conductivity values of different plants at the 5% level.
[0066] The detection results of hydrogen peroxide and propylene glycol are as Figure 6As shown. The H2O2 and MDA content levels of overexpressing plants, wild-type plants, and mutant plants showed a linear relationship from high to low. The lowercase letters a, b, and c represent significant differences at the 5% level among the relative conductivity values of different plants.
[0067] The embodiments of the present invention have been described in detail above in conjunction with the accompanying drawings. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those of ordinary skill in the art, various changes can be made without departing from the gist of the present invention. In addition, without conflict, the embodiments of the present invention and the features in the embodiments can be combined with each other.
Claims
1. Inhibition SlHdT The use of genes to improve drought tolerance in tomatoes; Said SlHdT The nucleotide sequence of the gene is shown in SEQ ID NO: 1; The inhibition SlHdT Genetic approaches include using the CRISPR / Cas9 system to SlHdT the method by which inactivating mutations occur; The CRISPR / Cas9 system includes a vector and sgRNA; The sequence of the sgRNA is shown in SEQ ID NO:
2.
2. With inhibition SlHdT The use of genetically related biological materials in breeding tomato varieties; Said SlHdT The nucleotide sequence of the gene is shown in SEQ ID NO: 1; The application is to construct and inhibit SlHdT Genetically related biomaterials to obtain tomato varieties with improved drought tolerance; The biological material does not include propagation material; The biological materials include nucleic acid molecules, vectors, and cells; The nucleic acid molecule comprises an inhibitory SlHdT Functional sgRNA; The sequence of the sgRNA is shown in SEQ ID NO:
2.
3. The use according to claim 2, characterized in that: The vector includes a CRISPR / Cas9 vector.
4. The use according to claim 2, characterized in that: The cells include at least one of Escherichia coli and Agrobacterium.
5. A method for cultivating a tomato variety with high drought tolerance, comprising reducing SlHdT The step of measuring the expression level and / or activity of a gene; The tomato variety comprises the following characteristics: drought tolerance is improved relative to a reference level; the reference level is the level of the wild type; The reduction in tomato SlHdT The step of increasing the expression level and / or activity of a gene is to increase the expression level and / or activity of a gene according to any one of claims 2 to 4 and inhibit SlHdT The genetically related biological material is introduced into tomato tissue or tomato cells.
6. The method according to claim 5, characterized in that: The introduction method includes using at least one of Ti plasmid, Ri plasmid, plant virus vector, microinjection, and electroporation.
Citation Information
Patent Citations
Cultivation method for enhancing drought resistance of tomatoes
CN116254294A