Method for improving animal production traits based on transcription factor MYB binding motif

Through CRISPR/Cas9 technology, the gene point mutation of the transcription factor MYB binding motif is constructed in animal cells, which solves the problem that the existing technology is difficult to effectively combine MYB with the improvement of animal production traits, achieves the improvement of relevant gene expression, and promotes the high-quality development of animal husbandry.

CN120174010APending Publication Date: 2025-06-20JILIN UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510430323.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-08
Publication Date
2025-06-20

AI Technical Summary

Technical Problem

The existing technology is difficult to effectively combine the transcription factor MYB with the improvement of animal production traits, and it has not fully tapped the potential of related genes to cultivate new animal varieties with high economic value and high meat yield.

Method used

The sgRNA was designed and the expression vector was constructed through the CRISPR/Cas9 system. Gene point mutation was performed to target sequences with 1 bp different from the MYB binding motif in HEK293T cells, and the transcription factor MYB binding motif gene point mutation cell line was constructed.

Benefits of technology

The expression of the production trait-related genes KRT75, PPP2R5D, and HHEX has been successfully improved, and the understanding of the MYB transcriptional regulation network has been enhanced. It has provided important theoretical basis and technical support for the cultivation of animal husbandry varieties, and has helped my country's animal husbandry industry to develop high-quality.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120174010A_ABST
    Figure CN120174010A_ABST
Patent Text Reader

Abstract

The invention is applicable to the technical field of animal husbandry, provides a method for improving animal production traits based on a transcription factor MYB binding motif, and aims to construct a transcription factor MYB binding motif gene point mutation cell line in a target gene promoter region by utilizing a CRISPR / Cas9 technology so as to improve production trait related gene expression. According to the present invention, the SpRY-CBE gene editing technology is adopted to perform single base editing on the HEK293T cell so as to successfully construct the transcription factor MYB combined motif gene point mutation cell line; the cell line can effectively improve the expression quantity of production trait related genes KRT75, PPP2R5D and HHEX, is beneficial to exploring the action mechanism and influence factors of the introduction of an MYB transcription factor binding motif to the expression regulation of a target gene, enhances the understanding of an MYB transcriptional regulation network, provides important theoretical basis and technical support for the breeding of improved livestock breeds, and has a wide application prospect. High-quality development of animal husbandry in China is assisted.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of animal husbandry, and particularly relates to a method for improving animal production traits based on the transcription factor MYB binding motif. Background Art

[0002] A transcription factor (TF) is a protein that can bind to a specific DNA sequence and can act alone or form a complex with other proteins to enhance or block the recruitment of specific genes to RNA polymerase, thereby regulating gene expression. The key to its function lies in binding to the promoter region of the target gene by virtue of its unique DNA binding domain (DBD), and then regulating transcription using the trans-activation domain (TAD).

[0003] As the founding member of the MYB transcription factor family, MYB is highly conserved in vertebrates and humans. In vertebrates, the MYB family includes MYB itself and MYB-related genes such as MYBL1 and MYBL2. MYB-related genes also exist in the genomes of many invertebrates and plants. In plants, they form an extremely large and diverse gene family and play a crucial role in development, metabolism, and response to environmental stimuli. Currently, many binding sites in the promoter and other regulatory regions of MYB target genes have been discovered in the study of human leukemia cells. MYB can interact with the co-activator p300 / CBP. p300 and the related CREB binding protein (CBP), as acetyltransferases, are responsible for modifying lysine residues in histones and other proteins. At the same time, p300 and CBP have multiple surfaces that interact with various transcription factors, facilitating their recruitment to genomic action sites. The binding of p300 / CBP to MYB is promoted by the conserved LXXLL amino acid motif in the MYB transcriptional activation domain, interacts with the KIX domain of the co-activator, and then regulates the target gene to activate its expression.

[0004] At present, the livestock industry in China is undergoing a new stage of large-scale and intelligent development. Scientific and technological innovation has significantly improved production efficiency, and at the same time, the awareness of green environmental protection has been continuously enhanced. Looking ahead, refined management, green and sustainable development, and industrial structure optimization will be the key directions, and the intensity of food safety supervision will also continue to increase. However, the development of the livestock industry still faces problems such as limited resources, the pressure of disease prevention and control, and environmental pollution. In this context, it is particularly crucial to improve animal production traits from the root, as increasing the yield of hair and meat products of economic animals contains huge economic and production value. With the development of modern biotechnology, the breeding of excellent animal varieties has made a big step from the traditional breeding mode towards molecular breeding. The application of new gene editing technologies such as SpRY-CRISPR / Cas9 has achieved unrestricted PAM mutations, greatly expanding the scope of precise editing and providing a more effective tool for animal gene editing. For example, the KRT75 gene is expressed in the follicle companion layer, the upper germination matrix region, and the hair shaft medulla, and the encoded protein is crucial for hair and nail formation; there have been many reports on the PPP2R5D gene related to gigantism, which is closely linked to cell growth, division, and regulation; the HHEX gene encodes a member of the transcription factor homeobox family, and many members participate in the development process, and in pig body length breeding, point mutations in its promoter region will affect body length regulation. However, the existing technologies have deficiencies in deeply integrating these genes with the improvement of animal production traits and achieving efficient transformation, and have not fully explored the potential of these genes to breed new animal varieties with high economic value and high meat production rate, making it difficult to meet the urgent needs of the rapid development of the livestock industry for animal breeding optimization. Therefore, the present invention proposes a method for improving animal production traits based on the transcription factor MYB binding motif. Summary of the Invention

[0005] The purpose of the present invention is to provide a method for improving animal production traits based on the transcription factor MYB binding motif, aiming to solve the problems proposed in the above background technology.

[0006] The purpose of the present invention is achieved through the following technical solutions:

[0007] A method for improving animal production traits based on the transcription factor MYB binding motif, comprising the following steps:

[0008] Step 1: Design of sgRNA of the CRISPR / Cas9 system and construction of an expression vector;

[0009] sgRNA design: For the sequences in the promoter regions of KRT75, PPP2R5D, HHEX-1, and HHEX-2 in HEK293T cells that differ by 1 bp from the MYB binding motif, sgRNA target sequences are designed respectively, and a pair of oligonucleotide chains are synthesized;

[0010] Construction of sgRNA expression vector: A pair of synthesized oligonucleotides are annealed to form double-stranded DNA, which is then ligated to the linearized As-v1 Puro expression vector to complete the construction of the sgRNA vector. Then, competent cell transformation, sequencing verification, plasmid extraction, and clone expansion culture are carried out. The obtained plasmid is used as a template for in vitro transcription and stored for future use.

[0011] Step 2: Transfection of HEK293T cells;

[0012] One day before transfection, HEK293T cells are plated so that the cell density is 90 - 95% at the time of transfection. Then transfection is carried out, and the cells are collected.

[0013] Step 3: Identification of cell genome;

[0014] Cell genomic DNA is extracted, PCR amplification is carried out using designed PCR primers, electrophoresis identification is performed, and the PCR products are sequenced to obtain the genotype identification results.

[0015] Furthermore, in step 1, the oligonucleotide sequences are as follows:

[0016] KRT75:

[0017] sgRNA-F1: ACCGTCTAGCTTCAGAAACA, specifically as shown in SEQ ID NO.1;

[0018] sgRNA-R1: TGTTTCTGAAGCTAGACGGT, specifically as shown in SEQ ID NO.2;

[0019] PPP2R5D:

[0020] sgRNA-F2: TTGCCATTATGACACCAGTT, specifically as shown in SEQ ID NO.3;

[0021] sgRNA-R2: AACTGGTGTCATAATGGCAA, specifically as shown in SEQ ID NO.4;

[0022] HHEX-1:

[0023] sgRNA-F3: AACGATTGGCAGGGAGTGGT, specifically as shown in SEQ ID NO.5;

[0024] sgRNA-R3: ACCACTCCCTGCCAATCGTT, specifically as shown in SEQ ID NO.6;

[0025] HHEX-2:

[0026] sgRNA-F4: AACAGTGGCGCTGGCTGTCA, as shown in SEQ ID NO.7 specifically;

[0027] sgRNA-R4: TGACAGCCAGCGCCACTGTT, as shown in SEQ ID NO.8 specifically.

[0028] Furthermore, the principle for selecting the oligonucleotide chain is to select one oligonucleotide chain with the mutated base position at the 5th or 6th position.

[0029] Furthermore, the specific process of the step for constructing the sgRNA expression vector is as follows:

[0030] Use the BbsⅠ restriction endonuclease to linearize the As-v1 Puro expression vector. After the enzyme digestion is completed, purify and recover the product; anneal a pair of synthesized oligonucleotides to form a double strand, and then ligate the double strand with the linearized As-v1 Puro expression vector overnight at 16°C to complete the construction of the sgRNA vector; then, perform competent cell transformation, spread the transformed product on a medium with ampicillin resistance for culture, pick monoclonal colonies for shaking culture, and sequence the bacterial solution to verify whether the fragment ligation is correct; after the sequencing is correct, extract plasmid DNA from the bacterial solution using an endotoxin-free plasmid large extraction kit, clone and expand the extracted plasmid, and use the obtained plasmid as a template for in vitro transcription for standby;

[0031] The enzyme digestion system is: 20 μl of plasmid As-v1 Puro; 20 μl of 10× buffer; 1 μl of BbsⅠ; 159 μl of ddH2O;

[0032] The annealing treatment conditions are: anneal at 95°C for 5 min and cool to room temperature.

[0033] Furthermore, the specific process of the transfection step is as follows:

[0034] Dilute sgRNA, SPRY-CBE (within the group) and a liposomal nucleic acid transfection reagent with DMEM medium to prepare a complex, incubate at room temperature for 25 min to obtain a DNA-liposome complex; inject the DNA-liposome complex into each well of the cell culture plate and culture at 37°C and 5% CO2; perform a medium change once after 24 h of culture, and collect the cells 24 h after the medium change.

[0035] Furthermore, the specific steps of step 3 are as follows:

[0036] Extract DNA from the obtained cells using a blood / tissue / cell genomic DNA extraction kit;

[0037] After DNA extraction, PCR was performed using the designed PCR primers, followed by electrophoresis identification. The PCR products were then subjected to DNA sequencing to obtain the genotype identification results;

[0038] If the sequencing results show complete or incomplete mutations at the targeting sites designed for the primers of the KRT75, PPP2R5D, HHEX-1, and HHEX-2 genes, the sample is a gene mutation. If the sequencing results show double peaks near the targeting site designed for the KRT75 gene primer, the sample with double peaks was selected for re-PCR. After gel recovery of the product, it was ligated to the PGM-T vector. After transformation, positive clones were picked for re-sequencing. If base insertions or deletions occur near the KRT75 gene target site in the sequencing results, leading to a frameshift mutation in the reading frame, the sample is a gene knockout.

[0039] Furthermore, the designed PCR primers are as follows:

[0040] KRT75, HHEX-1, HHEX-2:

[0041] Forward primer: TGTCCCAGGCACTCTTCTA, specifically as shown in SEQ ID NO.9;

[0042] Reverse primer: CCTGAGCCATACTGAGCAAA, specifically as shown in SEQ ID NO.10;

[0043] PPP2R5D:

[0044] Forward primer: GCTCACTCTTCCACTCACTAAA, specifically as shown in SEQ ID NO.11;

[0045] Reverse primer: TGAGGCAGGATAATCCATTGAA, specifically as shown in SEQ ID NO.12;

[0046] The PCR reaction system is: 1 μL of template DNA; 1 μL of forward primer; 1 μL of reverse primer; 12.5 μL of 2×Taqplus; 9.5 μL of ddH2O;

[0047] The PCR reaction conditions are: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 40 s; 38 cycles; extension at 72°C for 5 min.

[0048] Compared with the prior art, the beneficial effects of the present invention are:

[0049] The present invention uses the SpRY-CBE gene editing technology to perform single-base editing on HEK293T cells, and successfully constructs a cell line with gene point mutations in the transcription factor MYB binding motif. This cell line can effectively increase the expression levels of genes related to production traits, such as KRT75, PPP2R5D, and HHEX, which helps to explore the mechanism of action and influencing factors of the introduction of the MYB transcription factor binding motif on the regulation of target gene expression, enhances the understanding of the MYB transcriptional regulatory network, provides an important theoretical basis and technical support for the cultivation of fine livestock breeds, and contributes to the high-quality development of China's livestock industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] Figure 1 Schematic diagram of the design of sgRNA for the KRT75, PPP2R5D, and HHEX (HHEX-1, HHEX-2) genes.

[0051] Figure 2 Sanger sequencing map for identifying the gene mutations in the cell line with point mutations in the promoter regions of KRT75, PPP2R5D, and HHEX (HHEX-1, HHEX-2) by PCR products.

[0052] Figure 3 Fluorescence quantitative results of the normal control group and the mutant group after the identification of the cell line with point mutations in the promoter regions of KRT75, PPP2R5D, and HHEX (HHEX-1, HHEX-2).

[0053] Figure 4 Western Blotting results of the normal control group and the mutant group after the identification of the cell line with point mutations in the promoter regions of KRT75, PPP2R5D, and HHEX (HHEX-1, HHEX-2). DETAILED DESCRIPTION OF THE INVENTION

[0054] In order to have a clearer understanding of the technical features, objectives, and beneficial effects of the present invention, the technical solutions of the present invention are described in detail below, but it should not be construed as a limitation on the scope of implementation of the present invention.

[0055] The present invention provides a method for improving animal production traits based on the transcription factor MYB binding motif, aiming to use the CRISPR / Cas9 technology to construct a cell line with gene point mutations in the transcription factor MYB binding motif in the promoter region of the target gene to increase the expression of genes related to production traits. The method specifically includes the following steps:

[0056] Step 1: Design of sgRNA for the CRISPR / Cas9 system and construction of the expression vector (as Figure 1 shown);

[0057] sgRNA Design: For the sequences that are 1 bp different from the MYB binding motif in the promoter regions of KRT75, PPP2R5D, and HHEX (HHEX-1, HHEX-2) in HEK293T cells, sgRNA target sequences were designed respectively, and a pair of oligonucleotide chains were synthesized. The oligonucleotide sequences are as follows:

[0058] KRT75:

[0059] sgRNA-F1: ACCGTCTAGCTTCAGAAACA (as shown in SEQ ID NO.1);

[0060] sgRNA-R1: TGTTTCTGAAGCTAGACGGT (as shown in SEQ ID NO.2);

[0061] PPP2R5D:

[0062] sgRNA-F2: TTGCCATTATGACACCAGTT (as shown in SEQ ID NO.3);

[0063] sgRNA-R2: AACTGGTGTCATAATGGCAA (as shown in SEQ ID NO.4);

[0064] HHEX-1:

[0065] sgRNA-F3: AACGATTGGCAGGGAGTGGT (as shown in SEQ ID NO.5);

[0066] sgRNA-R3: ACCACTCCCTGCCAATCGTT (as shown in SEQ ID NO.6);

[0067] HHEX-2:

[0068] sgRNA-F4: AACAGTGGCGCTGGCTGTCA (as shown in SEQ ID NO.7);

[0069] sgRNA-R4: TGACAGCCAGCGCCACTGTT (as shown in SEQ ID NO.8).

[0070] The principle for selecting the oligonucleotide chains of this sgRNA: Select one oligonucleotide chain with the mutated base position at the 5th or 6th position.

[0071] Construction of sgRNA expression vector: The As-v1 Puro expression vector was linearized using the BbsⅠ restriction endonuclease. The digestion system was as follows: 20 μl of plasmid As-v1 Puro; 20 μl of 10× buffer; 1 μl of BbsⅠ; 159 μl of ddH2O. After digestion, the product was purified and recovered. A pair of synthesized oligonucleotides were annealed (annealed at 95 °C for 5 min and then cooled to room temperature) to form double strands, and then the double strands were ligated overnight with the linearized As-v1 Puro expression vector at 16 °C to complete the construction of the sgRNA vector (As-v1 Puro-sgRNA). Subsequently, competent cell transformation was carried out, and the transformed product was spread on a medium with ampicillin resistance for culture. Single colonies were picked for shaking culture, and the bacterial liquid was sequenced to verify whether the fragment ligation was correct. After correct sequencing, plasmid DNA was extracted from the bacterial liquid using an endotoxin-free plasmid large-scale extraction kit. The extracted plasmid was cloned and expanded, and the obtained plasmid was used as a template for in vitro transcription and reserved.

[0072] Step 2: Transfection of HEK293T cells;

[0073] One day before transfection, HEK293T cells were plated so that the cell density was 90 - 95% at the time of transfection. sgRNA, SPRY-CBE (within the group), and liposomal nucleic acid transfection reagent were diluted with DMEM medium to prepare a complex, which was incubated at room temperature for 25 min to obtain a DNA-liposome complex. The DNA-liposome complex was injected into each well of the cell culture plate and cultured at 37 °C and 5% CO2. After culturing for 24 h, a medium change was performed once, and the cells were collected 24 h after the medium change.

[0074] Step 3: Identification of cell genome;

[0075] (1) Extraction of cell genome: DNA was extracted from the obtained cells using a Blood / Tissue / Cell Genomic DNA Extraction Kit (purchased from Tiangen Biotech Co., Ltd., Beijing, China), and the extraction method was operated according to the kit instructions.

[0076] (2) Identification of genotype mutation of cell line by DNA sequencing: After DNA extraction, PCR was carried out using the designed PCR primers, followed by electrophoresis identification, and the PCR product was sent to Sangon Biotech Co., Ltd. for DNA sequencing to obtain the genotype identification result.

[0077] ① The designed PCR primers are as follows:

[0078] KRT75:

[0079] Forward primer: TGTCCCAGGCACTCTTCTA (as shown in SEQ ID NO.9);

[0080] Downstream primer: CCTGAGCCATACTGAGCAAA (shown as SEQ ID NO.10);

[0081] PPP2R5D:

[0082] Upstream primer: GCTCACTCTTCCACTCACTAAA (shown as SEQ ID NO.11);

[0083] Downstream primer: TGAGGCAGGATAATCCATTGAA (shown as SEQ ID NO.12);

[0084] HHEX (HHEX-1, HHEX-2):

[0085] Upstream primer: TGTCCCAGGCACTCTTCTA (shown as SEQ ID NO.9);

[0086] Downstream primer: CCTGAGCCATACTGAGCAAA (shown as SEQ ID NO.10).

[0087] ② The PCR reaction system is as follows: template DNA 1 μL; upstream primer 1 μL; downstream primer 1 μL; 2×Taqplus 12.5 μL; ddH2O 9.5 μL;

[0088] ③ The PCR reaction conditions are: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 40 s; 38 cycles; extension at 72°C for 5 min;

[0089] (3) If complete mutation or incomplete mutation occurs at the target sites designed by the primers of KRT75, PPP2R5D, and HHEX (HHEX-1, HHEX-2) genes in the sequencing results, the sample is a gene mutation. If a double peak appears near the target site designed by the primer of KRT75 gene in the sequencing results, select the sample with the double peak for PCR again. After gel recovery of the product, it is ligated to the PGM-T vector. After transformation, pick positive clones for sequencing again. If base insertion or base deletion occurs near the target site of KRT75 gene in the sequencing results, resulting in a frameshift mutation, the sample is a gene knockout.

[0090] As Figure 2 shown, this figure shows the sanger sequencing results of identifying gene mutations in cell lines with point mutations in the promoter regions of KRT75, PPP2R5D, and HHEX (HHEX-1, HHEX-2) by PCR products. It can be seen from the results that single base mutations have occurred in the promoter regions of KRT75, PPP2R5D, and HHEX (HHEX-1, HHEX-2), thus forming MYB binding motifs.

[0091] Example 1: Measurement of the expression level of a cell line with point mutations in the MYB binding motif constructed in the promoter region of the target gene;

[0092] (1) Extract mRNA from the cell line with point mutations;

[0093] The cells were centrifuged at 1000 rpm for 5 min at room temperature (15 - 25 °C), then the supernatant was discarded or the medium was removed from the monolayer-grown cells, and the cells were washed once with pre-cooled PBS. For every 1×10 7 cells, 1 ml of TRIzol reagent was added.

[0094] a. Using a pre-cooled centrifuge at 4 °C, transfer the tissue or cell lysate to a 1.5-ml RNase-free EP tube. Let it stand on ice for 5 min.

[0095] b. Add 200 μl of chloroform to each tube, mix well, and let it stand on ice for 10 min to completely dissociate the nucleoprotein complex. Centrifuge at 13000 rpm for 15 min at 4 °C. During this period, take a new EP tube, add 500 μl of isopropanol, and pre-cool it on ice.

[0096] c. After centrifugation, transfer the upper aqueous phase (about 500 μl) to this new EP tube. Let it stand on ice for alcohol precipitation for 10 min. Centrifuge at 13000 rpm for 10 min.

[0097] d. Remove the supernatant, and wash the RNA precipitate once with 1 ml of 75% ethanol. Centrifuge at 12000 rpm for 5 min.

[0098] e. Remove the supernatant and air-dry the RNA precipitate for 5 - 10 min.

[0099] f. Dissolve the RNA in 30 - 50 μl of DEPC-treated deionized water, and perform spectrophotometric analysis to determine the sample concentration and purity.

[0100] (2) Measure the mRNA expression levels of the mutant group and the control group according to fluorescence quantification;

[0101] ① mRNA reverse transcription: Use the FastKing one-step method for removing genomic cDNA first-strand synthesis premix reagent (purchased from Tiangen Biotech Co., Ltd., Beijing, China) to reverse transcribe the obtained mRNA into cDNA, and operate according to the instructions.

[0102] ② Fluorescence quantification: Use the SuperReal fluorescence quantitative premix reagent enhanced version (SYBR Green) (purchased from Tiangen Biotech Co., Ltd., Beijing, China) for fluorescence quantitative PCR, and operate according to the instructions.

[0103] a. The designed qPCR primers are as follows:

[0104] KRT75:

[0105] Forward primer: GAGGCTGAGAGCTGAGATTG (as shown in SEQ ID NO.13);

[0106] Reverse primer: GCATCCTTGAGAGCCAGTT (as shown in SEQ ID NO.14).

[0107] PPP2R5D:

[0108] Forward primer: CACCTTCATCGAATCCCACA (as shown in SEQ ID NO.15);

[0109] Reverse primer: TTGGCTGGAAATCAGGAGAC (as shown in SEQ ID NO.16).

[0110] HHEX (HHEX-1, HHEX-2):

[0111] Forward primer: TCAGAATCGACGCGCTAAAT (as shown in SEQ ID NO.17);

[0112] Reverse primer: GATCACAGGAACTGTCCAAACT (as shown in SEQ ID NO.18).

[0113] b. The qPCR reaction system is as follows: 1 μL of template RNA; 0.6 μL of forward primer; 0.6 μL of reverse primer; 10 μL of 2×Taqplus; 7.8 μL of RNase-free ddH2O;

[0114] The reaction conditions are: pre-denaturation at 95°C for 15 min; denaturation at 95°C for 10 s, annealing / extension at 60°C for 30 s; 40 cycles; analyze the results of fluorescence quantitative PCR.

[0115] As Figure 3 shown, this figure shows the fluorescence quantitative results of the normal control group (WT) and the mutant group after the promoter region point mutation cell lines of KRT75, PPP2R5D, and HHEX (HHEX-1, HHEX-2) are identified. Comparing the data in the figure, it can be seen that the mRNA expression levels of the promoter region point mutation cell lines of KRT75, PPP2R5D, and HHEX (HHEX-1, HHEX-2) are all increased compared with the normal control group.

[0116] (3) Determine the protein expression levels of the mutant group and the control group by Western Blotting;

[0117] ① Cell lysis;

[0118] a. Collect cells and add RIPA (lysis buffer) and PMSF (protease inhibitor).

[0119] b. After lysing on ice for 30 min, pipette up and down several times until the cells are completely lysed.

[0120] c. Shake at 4°C for 30 min; centrifuge at 12,000 rpm at 4°C for 20 min.

[0121] d. Gently aspirate the supernatant and transfer it to a new pre-chilled centrifuge tube and place it on ice. This is the protein sample. Discard the pellet. If the protein sample is not to be processed immediately, it can be stored at -80°C.

[0122] ②BCA protein quantification;

[0123] a. Preparation of the standard curve: Take an ELISA plate and add reagents as required.

[0124] b. Prepare an appropriate amount of BCA working solution by mixing 50 volumes of BCA reagent A with 1 volume of BCA reagent B (50:1) according to the number of samples. Mix well.

[0125] c. Add 200 μL of BCA working solution to each well.

[0126] d. Place the ELISA plate on an oscillator and shake for 30 s, incubate at 37°C for 30 min, and then measure the absorbance at 562 nm. Plot the standard curve with the protein content (μg) as the abscissa and the absorbance value as the ordinate.

[0127] e. Dilute the sample to be measured to an appropriate concentration so that the total volume of the sample dilution is 20 μL. Add 200 μL of BCA working solution, mix well, incubate at 37°C for 30 min, and then use the 0th tube of the standard curve as a reference to measure the absorbance at a wavelength of 562 nm and record the absorbance value.

[0128] f. According to the absorbance value of the measured sample, the corresponding protein content (μg) can be obtained from the standard curve. Divide it by the total volume of the sample dilution (20 μL) and multiply by the sample dilution factor to obtain the actual concentration of the sample (unit: μg / μL).

[0129] ③SDS-PAGE polyacrylamide gel electrophoresis;

[0130] a. Gel preparation;

[0131] Preparation of the separating gel (5 ml / gel): Use a one-step PAGE rapid preparation kit (purchased from Jifu Company, Shanghai, China). The preparation method is operated according to the kit instructions. Carefully inject the separating gel, leaving about 2 cm of space (the lower edge of the red border of the gel rack) for the stacking gel. Cover the top layer with deionized water and let it stand for about 30 min.

[0132] Preparation of stacking gel (2 ml / gel): Prepared using a one-step PAGE rapid preparation kit (purchased from Jifu Company, Shanghai, China). The preparation method was carried out according to the kit instructions. Inject the stacking gel onto the upper end of the separating gel, taking care to avoid air bubbles. Insert the comb. Wait for the stacking gel to solidify (there is an obvious boundary between the gel and the comb, and the solidification time of the separating gel should be greater than 2 h). Wash the wells with double-distilled water, remove gel fragments, and then blot dry with filter paper. Place the gel in the electrophoresis tank, and add 1× electrophoresis buffer to both the upper and lower tanks (do not reuse more than 3 times).

[0133] b. Loading: The loading volume is generally 15 - 25 μl. First, boil for 5 - 10 min, shake once during this period, then centrifuge quickly and load the sample for gel running;

[0134] c. Electrophoresis: Start at a constant voltage of 60 - 80 V. When it has run through the stacking gel, increase the current to 100 - 120 V. The electrophoresis time is determined according to the size of the target protein and the position of the marker. Generally, it is sufficient when the target protein has run to two-thirds of the position of the separating gel.

[0135] d. Membrane transfer: Cut the gel, cut the gel according to the Marker indication and the position of the target band (note to mark the cut corner of the gel), and immerse the eluted gel in the transfer buffer for 15 min. After marking the PVDF membrane, first immerse it in methanol for 1 min, then immerse it together with 4 pieces of 3 mm filter paper and the sponge in the transfer buffer for 15 min. Prepare the "sandwich cake": In the following order: fiber pad - filter paper - PVDF membrane - gel - filter paper - fiber pad. Note that when adding each item, align them to ensure there are no air bubbles.

[0136] e. Membrane transfer: The membrane transfer time is determined according to the protein size. One side of the PVDF membrane is connected to the positive electrode (red), and one side of the gel is connected to the negative electrode (black).

[0137] f. Membrane blocking and antibody incubation: After membrane transfer, wash the membrane with 10 ml of 1× TBS at room temperature for 10 min. Incubate with 5 ml of milk powder blocking solution at room temperature for 2 h or gently shake overnight at 4°C. Wash the membrane 3 times with 10 ml of TBS / T, 5 min each time. Add 5 ml of primary antibody dilution buffer (dilute the antibody according to the instructions), incubate at room temperature for 2 h or gently shake overnight at 4°C. Recover the primary antibody, wash the membrane 3 times with 10 ml of TBS / T, 5 min each time. Add the secondary antibody (generally diluted 1:2000), gently shake at room temperature for 1 h. Wash the membrane 3 times with 10 ml of TBS / T, 5 min each time. Develop and fix the film.

[0138] Such as Figure 4As shown, this figure shows the Western Blotting results of the normal control group and the mutant group after the identification of cell lines with point mutations in the promoter regions of KRT75, PPP2R5D, and HHEX (HHEX-1, HHEX-2). By observing the protein bands in the figure, it can be found that in the cell lines with point mutations in the promoter regions of KRT75, PPP2R5D, and HHEX (HHEX-1, HHEX-2), the signal intensities of the corresponding protein bands are significantly higher than those in the normal control group, indicating that the protein expression levels in the point mutation cell lines have increased.

[0139] The above are only the preferred embodiments of the present invention. It should be noted that for those skilled in the art, without departing from the concept of the present invention, several modifications and improvements can be made, which should also be regarded as the protection scope of the present invention, and these will not affect the implementation effect of the present invention and the practicality of the patent.

Claims

1. A method for improving animal production traits based on the transcription factor MYB binding motif, characterized in that: The following steps are involved: Step 1: CRISPR / Cas9 system sgRNA design and expression vector construction; sgRNA design: Targeting the sequences with a 1 bp difference between the promoter regions of KRT75, PPP2R5D, HHEX-1, and HHEX-2 and the MYB binding motif in HEK293T cells, sgRNA target sequences were designed and a pair of oligonucleotide chains were synthesized; Construction of sgRNA expression vector: A pair of synthesized oligonucleotides are annealed to form a double strand, which is then connected to the linearized As-v1 Puro expression vector to complete the construction of the sgRNA vector. Competent transformation, sequencing verification, plasmid extraction, and cloning and expansion culture are then performed. The resulting plasmid is used as an in vitro transcription template for later use. Step 2: HEK293T cell transfection; One day before transfection, HEK293T cells were plated to keep the cell density at 90-95% during transfection, and then transfection was performed and the cells were collected; Step 3: Cell genome identification; The cell genomic DNA was extracted, PCR amplification and electrophoresis identification were performed using the designed PCR primers, and the PCR products were sequenced to obtain the genotype identification results.

2. The method for improving animal production traits based on the transcription factor MYB binding motif according to claim 1, characterized in that: In step 1, the oligonucleotide sequence is: KRT75: sgRNA-F1: ACCGTCTAGCTTCAGAAACA, as shown in SEQ ID NO.1; sgRNA-R1: TGTTTCTGAAGCTAGACGGT, as shown in SEQ ID NO.2; PPP2R5D: sgRNA-F2: TTGCCATTATGACACCAGTT, as shown in SEQ ID NO. 3; sgRNA-R2: AACTGGTGTCATAATGGCAA, as shown in SEQ ID NO.4; HHEX-1: sgRNA-F3: AACGATTGGCAGGGAGTGGT, as shown in SEQ ID NO.5; sgRNA-R3: ACCACTCCCTGCCAATCGTT, as shown in SEQ ID NO.6; HHEX-2: sgRNA-F4: AACAGTGGCGCTGGCTGTCA, as shown in SEQ ID NO.7; sgRNA-R4: TGACAGCCAGCGCCACTGTT, as shown in SEQ ID NO.

8.

3. The method for improving animal production traits based on the transcription factor MYB binding motif according to claim 2, characterized in that: The oligonucleotide chain selection principle is to select an oligonucleotide chain with a mutant base at position 5 or 6.

4. The method for improving animal production traits based on the transcription factor MYB binding motif according to claim 1, characterized in that: The specific process of the sgRNA expression vector construction step is as follows: The As-v1 Puro expression vector was linearized using BbsⅠ restriction endonuclease, and the product was purified and recovered after enzyme digestion. A pair of synthesized oligonucleotides were annealed to form a double strand, and then the double strand was connected to the linearized As-v1Puro expression vector at 16°C overnight to complete the construction of the sgRNA vector. After that, competent transformation was performed, the transformation product was spread on an ampicillin-resistant culture medium for culture, a single clone was picked for shaking, and the bacterial solution was sequenced to verify whether the fragment connection was correct. After sequencing was correct, the plasmid DNA was extracted from the bacterial solution using an endotoxin-free plasmid extraction kit, the extracted plasmid was cloned and expanded, and the obtained plasmid was used as an in vitro transcription template for standby use. The enzyme digestion system was: plasmid As-v1 Puro 20 μl; 10× buffer 20 μl; BbsⅠ1 μl; ddH2O 159 μl; Annealing conditions are: annealing at 95°C for 5 min and cooling at room temperature.

5. The method for improving animal production traits based on the transcription factor MYB binding motif according to claim 1, characterized in that: The specific process of the transfection step is as follows: The complex was prepared by diluting sgRNA, SPRY-CBE and liposome nucleic acid transfection reagent with DMEM medium, and incubated at room temperature for 25 minutes to obtain a DNA-liposome complex; the DNA-liposome complex was injected into each well of the cell culture plate and cultured at 37°C and 5% CO2; the medium was changed after 24 hours of culture, and the cells were collected 24 hours after the medium change.

6. The method for improving animal production traits based on the transcription factor MYB binding motif according to claim 1, characterized in that: The specific steps of step 3 are as follows: Extract DNA from the obtained cells using a blood / tissue / cell genomic DNA extraction kit; After DNA extraction, PCR was performed using the designed PCR primers, electrophoresis was performed for identification, and DNA sequencing was performed on the PCR products to obtain the genotype identification results; If the sequencing results show complete mutation or incomplete mutation at the target sites designed by the primers of KRT75, PPP2R5D, HHEX-1, and HHEX-2 genes, the sample is a gene mutation; if the sequencing results show double peaks near the target sites designed by the primers of KRT75 genes, select the samples with double peaks for PCR again, and connect the products to the PGM-T vector after gel recovery. After transformation, pick the positive clones for sequencing again. If base insertion or base deletion occurs near the target site of KRT75 gene in the sequencing results, resulting in a reading frame shift mutation, the sample is a gene knockout.

7. The method for improving animal production traits based on the transcription factor MYB binding motif according to claim 6, characterized in that: The designed PCR primers are as follows: KRT75, HHEX-1, HHEX-2: Upstream primer: TGTCCCAGGCACTCTTCTA, as shown in SEQ ID NO.9; Downstream primer: CCTGAGCCATACTGAGCAAA, as shown in SEQ ID NO.10; PPP2R5D: Upstream primer: GCTCACTCTTCCACTCACTAAA, as shown in SEQ ID NO.11; Downstream primer: TGAGGCAGGATAATCCATTGAA, as shown in SEQ ID NO.12; The PCR reaction system was as follows: template DNA 1 μL; upstream primer 1 μL; downstream primer 1 μL; 2×Taq plus 12.5 μL; ddH2O 9.5μL; The PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 40 s; 38 cycles; extension at 72°C for 5 min.