A snp molecular marker associated with sea island cotton fiber strength and application

By discovering and utilizing SNP molecular marker sequences in sea island cotton, the problem of fiber strength screening in sea island cotton has been solved, enabling early prediction of fiber strength and efficient breeding, and promoting the screening of superior parents and molecular marker-assisted breeding.

CN120174140BActive Publication Date: 2026-01-06ZHEJIANG UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510507450.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-22
Publication Date
2026-01-06
Estimated Expiration
2045-04-22

AI Technical Summary

Technical Problem

Existing technologies are insufficient for effectively screening and improving the fiber strength of sea island cotton, and the genetic base of Xinjiang sea island cotton is relatively narrow, making it difficult to screen for fiber strength-related genes.

Method used

A molecular marker sequence of SNP associated with the fiber strength of sea island cotton is provided, located at sites Gbar_D09_44519309 and Gbar_D09_44520064 in the gene Gbar_D09G018120. Specific primer pairs are designed for PCR amplification, and the genotype of the PCR amplification product is used to predict fiber strength. Early prediction and screening are performed using bioassay products.

Benefits of technology

This approach enables early prediction and efficient screening of Sea Island cotton fiber strength, facilitates rapid screening of superior parents and marker-assisted breeding, and improves the breeding efficiency of fiber strength.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120174140B_ABST
    Figure CN120174140B_ABST
Patent Text Reader

Abstract

The application provides a SNP molecular marker associated with fiber strength of island cotton and application, and belongs to the technical field of molecular markers. The application obtains a SNP molecular marker associated with fiber strength, and the fiber strength trait is mainly related to changes of Gbar_D09_44519309 (G>A) and Gbar_D09_44520064 (C>T) bases, and a gene Gbar_D09G018120 in the bases is taken as a SNP molecular marker significantly related to the fiber strength. It is found that the fiber strength of materials carrying AT bases is significantly higher than that of materials carrying GC bases, so the SNP molecular marker can be used for breeding and parent screening of the fiber strength trait of island cotton, and excellent parents can be rapidly and batch screened by using a specific primer PCR amplification method and taking whether the SNP base mutation is contained as the basis at each period of cotton development.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of molecular marker technology, specifically relating to an SNP molecular marker associated with the strength of Sea Island cotton fibers and its application. Background Technology

[0002] Cotton is one of the world's most important economic crops, providing 81% of global natural fiber and serving as a primary raw material for the textile industry. Currently, upland cotton and Sea Island cotton are the two most prevalent allotetraploid cultivated cotton varieties, accounting for over 97% of fiber production. Compared to upland cotton, Sea Island cotton fibers are longer, finer, and stronger, but its yield is lower. Developing high-quality and high-yield Sea Island cotton varieties is essential for the textile industry today. Therefore, identifying genes related to fiber quality in Sea Island cotton is of great significance.

[0003] Compared to upland cotton, Sea Island cotton has superior fiber quality but lower yield. Research on genes related to fiber quality and yield in Sea Island cotton is limited, and further functional validation is needed to identify truly effective selection sites or genes. Furthermore, the limited number of parent lines and narrower genetic base of Xinjiang Sea Island cotton makes gene screening related to cotton fiber strength even more challenging. Summary of the Invention

[0004] This invention provides an SNP molecular marker associated with the fiber strength of sea island cotton and its application, laying the foundation for marker-assisted selection and precision breeding to improve fiber strength and promoting the production of sea island cotton in Xinjiang.

[0005] This invention provides an SNP marker sequence related to the strength of Sea Island cotton fibers. The SNP marker sequence is located in the gene Gbar_D09G018120, and there is a polymorphism of G or A at the site Gbar_D09_44519309 in the gene Gbar_D09G018120, and a polymorphism of C or T at the site Gbar_D09_44520064.

[0006] In a preferred embodiment of the present invention, the dominant genotype of the gene Gbar_D09G018120 is AT.

[0007] The present invention also provides a primer pair for detecting the above-mentioned SNP marker sequence, including a first primer pair consisting of an upstream primer with nucleotide sequences as shown in SEQ ID No. 1 and a downstream primer with nucleotide sequences as shown in SEQ ID No. 2; and a second primer pair consisting of an upstream primer with nucleotide sequences as shown in SEQ ID No. 3 and a downstream primer with SEQ ID No. 4.

[0008] The present invention also provides a biological detection product comprising the above-mentioned SNP marker sequence or the above-mentioned primer pair.

[0009] In a preferred embodiment of the present invention, a detection kit or a gene chip is included.

[0010] The present invention also provides the application of the above-mentioned SNP marker sequences, primer pairs or biodetection products in the early prediction and / or screening of the strength of Sea Island cotton fibers.

[0011] This invention also provides the application of the above-mentioned SNP marker sequences, primer pairs, or biodetection products in marker-assisted breeding of cotton.

[0012] The present invention also provides a method for predicting the fiber strength of sea island cotton, comprising the following steps: using the genomic DNA of the sample to be tested as a template, mixing it with primer pairs designed according to the above-mentioned SNP marker sequence, the above-mentioned primer pairs or the above-mentioned biodetection products to form an amplification system, performing PCR amplification, and predicting the fiber strength of the sample to be tested based on the genotype of the PCR amplification product.

[0013] In a preferred embodiment of the present invention, the PCR amplification program includes: pre-denaturation at 94°C for 5 min; denaturation at 98°C for 10 s; annealing at (Tm-5)°C for 5 s; extension at 68°C for 1–10 s / kb; and 25–45 cycles.

[0014] In a preferred embodiment of the present invention, the fiber strength of individuals with the AT genotype of the SNP molecular marker is significantly higher than that of individuals with the GC genotype.

[0015] Beneficial Effects: This invention utilizes 240 Sea Island cotton varieties from around the world as materials. Through a 4-year experimental setup at one location, with two replicates per material, and employing the Illumina HiSeq PE150 sequencing platform for genome resequencing to detect variations, a total of 3,110,663 high-quality SNPs were obtained for genome-wide association analysis (GWAS). GWAS analysis identified SNP molecular markers associated with fiber strength that recurred in at least two environments. This invention found that fiber strength is primarily associated with variations in the base pairs of Gbar_D09_44519309 (G>A) and Gbar_D09_44520064 (C>T), and identified the gene Gbar_D09G018120, containing different haplotypes of Gbar_D09_44519309 and Gbar_D09_44520064, as a significantly associated SNP marker sequence with fiber strength. This invention also confirmed the results of 240 Sea Island cotton materials in 2018, 2022 and 2023. The fiber strength of materials carrying the AT base in the BLUE value was significantly higher than that of materials carrying the GC base. Therefore, the SNP marker sequence described in this invention can be used for aggregation breeding and parent screening of Sea Island cotton fiber strength traits. Superior parents can be screened rapidly and in batches at various stages of cotton development by using PCR amplification with specific primers based on whether or not the SNP base mutation is present. Attached Figure Description

[0016] Figure 1 Distribution density map of SNPs in 240 Sea Island cotton samples;

[0017] Figure 2 The Manhattan plot and qq plot of the 2017 FS-GWAS based on SNP;

[0018] Figure 3 The Manhattan plot and qq plot of the 2018 FS-GWAS based on SNP;

[0019] Figure 4 The Manhattan plot and qq plot of FS-GWAS based on SNP in 2022;

[0020] Figure 5 The Manhattan plot and qq plot of FS-GWAS in 2023 based on SNP;

[0021] Figure 6 Manhattan plot and qq plot of FS-GWAS based on SNP-based BLUE (breeding value);

[0022] Figure 7Local Manhattan plots and linkage maps for SNP sites Gbar_D09_44519309 and Gbar_D09_44520064;

[0023] Figure 8 Here is the structure diagram of the Gbar_D09G018120 gene;

[0024] Figure 9 The predicted protein structure of Gbar_D09G018120;

[0025] Figure 10 Plot showing the expression levels of Gbar_D09G018120 in different tissues of cotton;

[0026] Figure 11 The graph shows the relative expression levels of the Gbar_D09G018120 gene in materials H232 and H51.

[0027] Figure 12 Phenotypic statistics of fiber strength in 240 Sea Island cotton samples in different years;

[0028] Figure 13 A statistical chart showing the average FS values ​​for AT and GC haplotype island cotton materials. Detailed Implementation

[0029] This invention provides an SNP marker sequence related to the strength of Sea Island cotton fibers. The SNP marker sequence is located in the gene Gbar_D09G018120, and there is a polymorphism of G or A at the site Gbar_D09_44519309 in the gene Gbar_D09G018120, and a polymorphism of C or T at the site Gbar_D09_44520064.

[0030] This invention used 240 Sea Island cotton varieties from around the world as materials, and adopted a four-year, one-site experimental approach with two replicates of each material planted in Sanya, Hainan. Genome resequencing was performed using the Illumina HiSeq PE150 sequencing platform to detect variants, yielding 3,110,663 high-quality SNPs for genome-wide association analysis (GWAS). GWAS analysis identified SNP molecular markers associated with fiber strength that were reproducible in at least two environments.

[0031] Table 1. Sea Island cotton varieties used in this invention for screening SNP molecular markers.

[0032]

[0033]

[0034]

[0035]

[0036]

[0037] In this invention, the fiber strength trait of Sea Island cotton is mainly related to the changes in the bases of Gbar_D09_44519309 (G>A) and Gbar_D09_44520064 (C>T), and SNP marker sequences that are significantly related to fiber strength are obtained. The two SNP sites mentioned in this invention are located at bases 44519309 and 44520064 on chromosome 9 of the D subgenome of Sea Island cotton, respectively, on the exon of the gene Gbar_D09G018120, and the dominant genotype of the gene Gbar_D09G018120 is AT.

[0038] The present invention also provides a primer pair for detecting the above-mentioned SNP marker sequence, including a first primer pair consisting of an upstream primer with nucleotide sequences as shown in SEQ ID No. 1 and a downstream primer with nucleotide sequences as shown in SEQ ID No. 2; and a second primer pair consisting of an upstream primer with nucleotide sequences as shown in SEQ ID No. 3 and a downstream primer with SEQ ID No. 4.

[0039] The sequence of the first primer pair (Gbar_D09_44519309 amplification primer) and the amplification product of this invention are shown below:

[0040] Gbar_D09_44519309_F(SEQ ID No.1):GTGACTACTTCATAACAAAACG;

[0041] Gbar_D09_44519309_R(SEQ ID No.2):GGAGAATATCAGTGTGCCTA;

[0042] The amplified product of Gbar_D09_44519309 (SEQ ID No. 5), and the degenerate base R in this sequence represents A / G:

[0043] GTGACTACTTCATAACAAAACGATAATATAAGTGATTAAAACGTAATATTTTAAACATAAGTGACTAAAATATAATTTRAGATAAATAAAAGTAATTATTTTTATAATTTAGCCTAAAATATTATGCAGACTACATCAACTCAACAGCTGCTTGTATATATCATGATAAACACGC ATCAAATTCAAAATTTTACGGTATATGGGAAAAGAAATCCCAGCTGAATGAATTACATATTTTTGAGGACCAAAACCAAAATTATATCAAAATTTTACCTCAACCCCATTAGATTTCTGCATAGCAGGCTGCGTGAACAAACTCCGAGAACTCCTTAGGCACACTGATATTCTCC;

[0044] The sequence of the second primer pair (Gbar_D09_44520064 amplification primer) and the amplification product of this invention are shown below:

[0045] Gbar_D09_44520064_F(SEQ ID No.3):TCCATTGTTCCGACTTG;

[0046] Gbar_D09_44520064_R(SEQ ID No.4):CGGTTACTGATGTGTTCAT;

[0047] The amplified product of Gbar_D09_44520064 (SEQ ID No. 6), and the degenerate base Y in this sequence represents C / T:

[0048] TCCATGTTCCGACTTGAACCCGTACACGTCAGCGCTCCCATCAAATTGACCTTGGCTCTCCGTTCTGTATCCACTCACCACCCAGAACTCCTCTTCCCCAATCACTACACCTTCACATTCGTCTCGCTCTTGACTCAACTCCCCAACTCAGCCCACTCGTCCGTTCTCA GATCGTAAACCCCAAGCGGTTCTTGACGCATTCTTGTTCTCGTCATGCCCGCCCGCAACAAAAACCCGACCTCCACATGCCCCGATTGCAAAGAAGGATCTTYTTGAAGGCATATCCTTCCCTTGTCTCCATTGCTGAGTCACGAAATCGTAGATGAACACATCAGTAACCG.

[0049] The present invention also provides a biological detection product comprising the above-mentioned SNP marker sequence or the above-mentioned primer pair.

[0050] Based on the SNP marker sequence or the primer pair described above, this invention can design primers, reagents, kits, and even gene chips containing the SNP molecular marker for the detection of corresponding traits.

[0051] The present invention also provides the application of the above-mentioned SNP marker sequences, primer pairs or biodetection products in the early prediction and / or screening of the strength of Sea Island cotton fibers.

[0052] The SNP marker sequence described in this invention can be detected at various stages of cotton development. For example, in the embodiments, it can be amplified by PCR amplification using the specific primers described above. Based on whether or not the SNP marker sequence contains two base mutations, superior single plants can be screened rapidly and in batches. For example, it can be used to screen parents with aggregated traits, or to screen individuals with corresponding high-strength fiber traits for subsequent experiments or research.

[0053] This invention also provides the application of the above-mentioned SNP marker sequences, primer pairs, or biodetection products in marker-assisted breeding of cotton.

[0054] The present invention does not specifically limit the method of molecular marker-assisted breeding. Molecular marker-assisted breeding can be carried out using the SNP marker sequence described in the present invention based on conventional operations.

[0055] The present invention also provides a method for predicting the fiber strength of sea island cotton, comprising the following steps: using the genomic DNA of the sample to be tested as a template, mixing it with primer pairs designed according to the above-mentioned SNP marker sequence, the above-mentioned primer pairs or the above-mentioned biodetection products to form an amplification system, performing PCR amplification, and predicting the fiber strength of the sample to be tested based on the genotype of the PCR amplification product.

[0056] The present invention does not specifically limit the method for extracting genomic DNA from the sample to be tested, including the use of conventional methods in the art to extract genomic DNA from the sample tissue, such as using leaves as tissue and using the CTAB method to extract genomic DNA.

[0057] This invention utilizes the above primer pairs and genomic DNA to prepare a PCR amplification system, comprising, in 50 μL: The PCR amplification system consists of 25 μL of Flash KOD DyeMix, 1.5 μL of 10 μM upstream primer, 1.5 μL of 10 μM downstream primer, ≥5 μL of DNA template, and the remainder ddH2O. After preparing the PCR amplification system, PCR amplification is performed. The PCR amplification program includes: 94℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s, (Tm-5)℃ annealing for 5 s, 68℃ extension for 1–10 s / kb, and 25–45 cycles.

[0058] In a preferred embodiment of the present invention, whether a gene belongs to the dominant genotype is determined based on whether the amplified product contains an AT sequence. The fiber strength of individuals with the AT genotype of the SNP molecular marker is significantly higher than that of individuals with the GC genotype.

[0059] To further illustrate the present invention, the following detailed description, in conjunction with embodiments, of an SNP molecular marker associated with the strength of Sea Island cotton fibers provided by the present invention, is provided but should not be construed as limiting the scope of protection of the present invention.

[0060] Example 1: Population Materials and Phenotypic Statistics

[0061] 1. Selection of population materials and design of field trials

[0062] This invention mainly collected 240 Sea Island cotton materials (Table 1) from Xinjiang, China and other countries and regions for fiber strength investigation. Among them, 220 are the main cultivated varieties independently developed in Xinjiang from the end of the 20th century to the present, 3 are perennial semi-wild Sea Island cotton germplasm, and 17 are varieties from abroad, covering representative varieties from Central Asia, the United States and Egypt.

[0063] This population was planted in Yazhou District, Sanya, Hainan (HN, 18.23°N, 109.50°E) in 2017, 2018, 2022, and 2023 according to a completely randomized block design with two replicates. Routine field management was carried out using local methods. Various genetic resources and field management methods have been published in the article, see: Yu J., Hui Y., Chen J., Yu H., Gao X., Zhang Z., Li Q., ​​Zhu S. & Zhao T. (2021) Whole-genome resequencing of 240gossypium barbadense accessions reveals genetic variation and genes associated with fiber strength and lint percentage. Theoretical and Applied Genetics 134(10):3249-3261. https: / / doi.org / 10.1007 / s00122-021-03889-w.

[0064] 2. Identification of fiber strength properties and statistical analysis of phenotypic data

[0065] During the boll-opening period in March, 50 cotton bolls located in the middle of each plant and with normal and complete boll opening were randomly picked from each row. After drying, they were ginned using a ginning machine. 20g of fiber was randomly selected and sent to the Cotton Quality Supervision and Testing Center of the Ministry of Agriculture and Rural Affairs for testing of fiber strength characteristics according to GB / T 20392-2006 "HVI Test Method for Physical Properties of Cotton Fiber".

[0066] The best linear unbiased (BLUE) estimate of fiber strength for each year was performed using the lme4 package in R. The model is as follows:

[0067] FS=lmer(FS~Sample+(1|Rep)+(1|Year:Rep)+(1|Year)); Formula I;

[0068] In Equation I, the fixed factor is Sample, and the random factor is Year+Rep+Year:Rep.

[0069] Example 2: Obtaining SNP

[0070] 1. Library construction and sequencing

[0071] Tender leaf tissues were collected from various materials within the population. Genomic DNA was extracted from the samples using the CTAB method, and the purity and integrity of the DNA were determined using agarose gel electrophoresis and UV absorption. Qualified DNA samples were then used by Beijing Novogene Technology Co., Ltd. for library construction and sequencing. Using a Covaris fragmenter, the samples were randomly fragmented into approximately 350 bp fragments. Subsequently, a series of operations were performed, including end repair, addition of polyA tails, ligation of sequencing adapters, purification, and real-time PCR amplification, to complete the library preparation. The constructed library was sequenced using an Illumina HiSeq PE150 sequencing platform, achieving an average sequencing depth of 10.85×, generating a total of 6.3 Tb of raw data.

[0072] 2. Genotyping and filtering

[0073] Variation detection was performed using the high-quality sea island cotton genome (Gossypium barbadense(AD2)'3-79'genome HAU_v2_a1, https: / / www.cottongen.org / species / Gossypium_barbadense / HAU-AD2_genome_v2.0) as the reference genome.

[0074] First, the FastQ file was filtered using FastP with the parameters "-cn 15-u 50-q 15". The reference genome was indexed using BWA software. The filtered FastQ file was then aligned to the reference genome to obtain a SAM format file. The SAM file was converted to BAM format using SAMtools and Sambamba software, and then sorted and duplicate fragments were removed. SNPs and Indel variants were identified using Gatk software. SNP variants were filtered using the criteria "QUAL < 60, QD < 20.0, FS > 10.0, MQ < 30.0, MQRankSum < -1.65, and ReadPosRankSum < -8.0". Finally, VCFtools was used to filter and remove SNP sites with a minimum allele frequency less than 0.05 and a deletion rate greater than 20%, retaining 3,110,663 high-quality SNPs. Figure 1 (This information is used for subsequent genome-wide association analysis.)

[0075] Example 3: Genome-wide association analysis of fiber strength traits in Sea Island cotton

[0076] For the fiber strength phenotypic data of sea island cotton obtained in Example 1, the SNP variation information obtained in Example 2 was used to perform association analysis using a univariate linear mixed model of GEMMA (Genome-wide Efficient Mixed Model Association algorithm).

[0077] y = Wα + xβ + u + e; u ~ MVN n (0,λτ -1 K), e~MVN n (0,τ -1 I n Formula II;

[0078] In Equation II, y represents phenotypic data, W is the covariate matrix (such as a PCA matrix), α is the coefficient vector (including the intercept term) corresponding to the covariates, x is the marker genotype vector, and β represents the genotyping information of each material at each SNP locus. u is the random effects vector, which follows a mean of 0 and a covariance matrix of λτ. -1 K is a multivariate normal distribution, where K is the kinship matrix (used to consider genetic correlations between individuals and population structure, avoiding false positive associations due to factors such as population stratification) for population analysis, λ is the variance component ratio, and τ is the variance component ratio. -1 This is the residual variance. e is the error vector, with a mean of 0 and a covariance matrix of τ. -1 I n The multivariate normal distribution represents the influence of factors other than genotype, covariates, and random effects on the phenotype.

[0079] The CMplot package in R is used to draw Manhattan plots and qq plots (quantile-qualtile plots) to represent the p-values ​​and correlation effects of each SNP. Figures 2-6 ).

[0080] Using -log(P) > 4 in at least two environments as the threshold, analysis revealed two SNPs (P0) closely linked to the same LD region on the Gbar_D09 chromosome. Figure 7 The values ​​of Gbar_D09_44519309 (G>A) and Gbar_D09_44520064 (C>T) are significantly correlated with the fiber strength of Sea Island cotton. The P values ​​of SNPs for each year are shown in Table 2.

[0081] Table 2. GWAS values ​​of SNP loci in each year

[0082] -log10(Pvalue) 2017 2018 2022 2023 BLUE Gbar_D09_44519309 0.11 3.72 4.37 0.87 5.09 Gbar_D09_44520064 0.12 1.5 2.55 0.19 3.39

[0083] The two SNPs described in this invention are located at bases 44519309 and 44520064 on chromosome 9 of the D subgenome of cotton sea island, on the exon of the gene Gbar_D09G018120. Figure 8 The Gbar_D09_44520064 non-synonymous mutation, which changes G to A, results in the amino acid arginine (ARG, R) changing to lysine (LYS, K). Figure 9 The protein structure was predicted online using the I-TASSER website (https: / / zhanggroup.org / I-TASSER / ). The results showed that non-synonymous mutations led to changes in the structure of the Gbar_D09G018120 protein. Figure 9 Gbar_D09_44519309 is a synonymous mutation, changing from C to T. Its homolog in Arabidopsis is AT2G44130 (KMD3), which encodes a member of the F-box protein family and controls phenylpropane biosynthesis. A search at http: / / cotton.zju.edu.cn indicates that the expression level of Gbar_D09G018120 peaks on day 20 of fiber development. Figure 10 ).

[0084] Furthermore, among the 240 samples of island cotton, the fiber strength of materials carrying the AT base group was significantly higher than that of materials carrying the GC base group in both BLUE values ​​in 2018, 2022, and 2023. Figure 12 ).

[0085] Example 4: Validation of SNP sites Gbar_D09_44519309 and Gbar_D09_44520064

[0086] 1. The expression levels of the gene Gbar_D09G018120, containing different haplotypes of Gbar_D09_44519309 and Gbar_D09_44520064, were identified. Two Sea Island cotton materials, H237 (REF-GC, low fiber strength) and H51 (ALT-AT, high fiber strength), were selected. Tags were attached one day before flowering, and fiber samples were collected at 15, 20, and 25 days after flowering, with three replicates at each time point, for quantitative fluorescence analysis.

[0087] RNA was extracted from cotton fibers using the Plant Tissue RNA Extraction Kit (DP452) from TIANGEN. The RNA concentration was determined using a UV spectrophotometer. If the 260 / 280 ratio of the sample was between 1.9 and 2.1, and the 260 / 230 ratio was greater than 2, the RNA quality was considered suitable for the next step of analysis.

[0088] cDNA was synthesized using the TIANGEN FastKing cDNA First-Strand Synthesis Kit (Genomic De-generated) (KR116-02), and then YEASEN HieffqPCR SYBR Green Master Mix (No Rox) (11201ES08) qPCR enzyme was added. qPCR was performed using a real-time PCR instrument. The primers used for quantitative analysis in this invention are shown below:

[0089] F (SEQ ID No. 7): GAACAAGAATGCGTCAAGAACC;

[0090] R (SEQ ID No. 8): TTGAACCCGTACACGTCAGC;

[0091] Internal reference gene GbUBQ7 primers:

[0092] GbUBQ7_F(SEQ ID No.9):GAAGGCATCCACCTGACCAAC;

[0093] GbUBQ7_R (SEQ ID No. 10):CAAGCACAAGAAGAAGAAGGTCAAG.

[0094] qPCR results as follows Figure 11 As shown, the relative expression level of the gene in the fibers of the low-fiber-strength material H232 25 days after flowering was significantly higher than that in the high-fiber-strength material H51. This indicates that the SNP marker sequences Gbar_D09_44519309 and Gbar_D09_44520064 are closely related to the expression level of the gene Gbar_D09G018120 during the thickening stage of fiber development, and that Gbar_D09G018120 may be an important candidate gene involved in regulating cotton fiber strength.

[0095] 2. Use published articles (Zhao N., WangW., Grover CE, Jiang K., Pan Z., Guo B., Zhu J., Su Y., Wang M., Nie H., Xiao L., Guo A., Yang J., Cheng C., Ning X., Li B., Xu H., Adjibolosoo D., Aierxi A., Li P., Geng J.,Wendel JF,Kong J.&Hua J.(2022)Genomic and GWAS analyzes demonstrate phylogenomic relationships of gossypiumbarbadense in china and selection for fiber length,lint percentageandfusarium wilt resistance.Plant Biotechnology Journal SNP variation data from 20(4):691-710.https: / / doi.org / 10.1111 / pbi.13747) and fiber strength phenotypic data from 282 Sea Island cotton samples were analyzed. Among them, 199 samples contained Gbar_D09_44519309(G) and Gbar_D09_44520064(C), and 83 samples contained Gbar_D09_44519309(A) and Gbar_D09_44520064(T) (Table 3).

[0096] Table 3. Haplotype and fiber strength phenotypes of 282 materials

[0097]

[0098]

[0099]

[0100]

[0101] Phenotypic results are as follows Figure 13As shown, the average fiber strength of varieties containing Gbar_D09_44519309(G) and Gbar_D09_44520064(C) is 37.82 cN / tex, while the average fiber strength of varieties containing Gbar_D09_44519309(A) and Gbar_D09_44520064(T) is 42.89 cN / tex. The fiber strength of ALT-AATT is significantly higher than that of REF-GGCC (p = 1.8 × 10⁻⁶). -22 ).

[0102] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A primer pair for detecting a SNP marker sequence, characterized in that, a first primer pair comprising an upstream primer of a nucleotide sequence as shown in SEQ ID No. 1 and a downstream primer of a nucleotide sequence as shown in SEQ ID No. 2; and a second primer pair comprising an upstream primer of a nucleotide sequence as shown in SEQ ID No. 3 and a downstream primer of a nucleotide sequence as shown in SEQ ID No. 4; The SNP marker sequence is an SNP marker sequence related to fiber strength of Gossypium barbadense, the SNP marker sequence is located in gene Gbar_D09G018120, and there is polymorphism G or A at site Gbar_D09_44519309 and polymorphism C or T at site Gbar_D09_44520064 of the gene Gbar_D09G018120; with Gossypium barbadense (AD2) '3-79' genome HAU_v2_a1 as a reference genome, the dominant genotype of the gene Gbar_D09G018120 is AT.

2. A biological detection product comprising the primer pair for detecting the SNP marker sequence of claim 1, which is used for detecting fiber strength of Gossypium barbadense.

3. The biological test product according to claim 2, wherein It comprises a detection kit or a gene chip.

4. Use of the primer pair for detecting the SNP marker sequence of claim 1 or the biological detection product of claim 2 or 3 in early prediction and / or screening of fiber strength of Gossypium barbadense.

5. A method of predicting strength of sea island cotton fiber, characterized by, It comprises the following steps: taking genomic DNA of a sample to be tested as a template, mixing the primer pair for detecting the SNP marker sequence of claim 1 or the biological detection product of claim 2 or 3 into an amplification system, performing PCR amplification, and predicting fiber strength of the sample to be tested according to genotypes of PCR amplification products, wherein the fiber strength is significantly higher when the SNP marker sequence is of AT genotype than when it is of GC genotype.

6. The prediction method of claim 5, wherein, The procedure of the PCR amplification comprises: 94℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s, (Tm-5) ℃ annealing for 5 s, 68℃ extension for 1~10 s / kb, 25~45 cycles. The procedure of the PCR amplification comprises: 94℃ pre-denaturation for 5 min; 98℃ denaturation for 10 s, (Tm-5) ℃ annealing for 5 s, 68℃ extension for 1~10 s / kb, 25~45 cycles.

Citation Information

Patent Citations

  • Molecular markers from sea island cotton Hai 1 and related to cotton fiber strength and application of molecular markers

    CN103497949A

  • Fiber strength related molecular mark from gossypium barbadense and application thereof

    CN105483248A