Spherical annular nucleic acid for preventing and treating psoriasis and preparation method thereof

By developing a spherical cyclic nucleic acid material, using the assembly technology of gold nanoclusters and cyclic nucleic acid aptamers, the side effects of existing psoriasis treatment methods are solved, effective capture of TNF-α and VEGF and in-depth treatment of psoriasis are achieved, and good biocompatibility is achieved.

CN120189433APending Publication Date: 2025-06-24TONGJI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510304410.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-14
Publication Date
2025-06-24

AI Technical Summary

Technical Problem

Existing treatments for psoriasis have side effects such as skin atrophy, facial erythema, burning sensations, tingling sensations, erythema and rashes, as well as the risk of accumulated skin cancer, and biologics can cause immune responses to bypass lockdowns, leading to worsening of the disease.

Method used

A spherical cyclic nucleic acid material has a gold nanocluster with a cyclic anti-TNF-α and anti-VEGF nucleic acid aptamers to form a new nanonucleic acid material through nano-level assembly to prevent and treat psoriasis.

Benefits of technology

This material can effectively capture the overexpressed TNF-α and VEGF cytokines at psoriatic lesions, inhibit the IL-1β levels of the inflammatory factor, reduce the PASI score of psoriasis, reduce side effects, improve the depth of treatment, and have good biocompatibility.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120189433A_ABST
    Figure CN120189433A_ABST
Patent Text Reader

Abstract

The invention relates to a spherical annular nucleic acid for preventing and treating psoriasis and a preparation method thereof. Specifically, the invention provides a nano nucleic acid material for preventing and / or treating psoriasis, and the nano nucleic acid material comprises a nucleic acid aptamer and a nano material, the nucleic acid aptamer is adsorbed on the nano material, and the nucleic acid aptamer comprises an anti-TNF-alpha (tumor necrosis factor-alpha) and an anti-VEGF (vascular endothelial growth factor). The nano nucleic acid material provided by the invention can effectively inhibit the level of inflammatory factors IL-1beta, inhibit the excessive proliferation of psoriasis related cells, reduce the PASI score of psoriasis, and further effectively prevent and / or treat psoriasis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of nanomaterials and biomedical technology, and more particularly to a spherical circular nucleic acid for preventing and treating psoriasis and a preparation method thereof. Background Art

[0002] Psoriasis is an inflammatory skin disease. Psoriasis has different clinical phenotypes, but the most common and easily recognizable is chronic plaque psoriasis, or vulgaris. The typical morphology is characterized by well-defined salmon-pink plaques with silvery scales on white skin and gray plaques on black skin. Common sites of disease include the knee and elbow extensor muscles, the lower back, and the scalp.

[0003] Currently, the main treatment options for psoriasis include topical medications, phototherapy, systemic oral medications, and subcutaneous biologic injections. If psoriasis is limited to a small area (less than 3–5% of the body surface), the primary treatment approach is topical medications, including corticosteroids, vitamin D3 analogs, calcineurin inhibitors, keratolytics, and combination medications (such as corticosteroids plus vitamin D3). However, topical medications often carry certain side effects. For example, the use of glucocorticoids may cause skin atrophy and facial erythema, while the use of vitamin D3 derivatives may cause burning and stinging sensations, erythema, and rashes. Phototherapy typically uses ultraviolet radiation, which has a local immunosuppressive effect. It directly affects Langerhans cells, inhibiting epidermal hyperproliferation and angiogenesis, and induces a selective decrease in skin T cells through apoptosis. Different phototherapy modalities include narrowband (311-313 nm) UVB radiation, broadband (280-320 nm) UVB radiation, targeted phototherapy, and oral psoralen UVA (photochemotherapy). However, phototherapy also carries significant side effects, with patients often experiencing a burning sensation during treatment and a cumulative risk of skin cancer. Before the advent of biologics, oral systemic therapies were the mainstay of treatment for moderate to severe plaque psoriasis for decades. These oral agents vary widely in their mechanism of action, efficacy, and safety. Commonly used oral medications for psoriasis include methotrexate, cyclosporine, acitretin, fumarates, and apremilast. These oral medications often have significant side effects. For example, oral methotrexate can cause significant adverse hematopoietic and gastrointestinal effects, while oral cyclosporine often carries the risk of irreversible nephrotoxicity. Over the past 20 years, biologics have dramatically transformed our ability to treat psoriasis and psoriatic arthritis. Biologics are categorized into several different types based on the biological factors they target, including adalimumab, bevacizumab, etanercept, and infliximab for the anti-TNF-α drugs, and secukinumab, ixekizumab, and budalumab for the anti-IL-17 drugs. However, their biological targeting can also lead to side effects. The highly specific targeting of inflammatory mediators by biologics may allow the immune response to bypass blockade, leading to disease exacerbation and altered clinical and immunological characteristics.

[0004] Currently, injections of antibody-based biological agents can cause wound infections and psychological discomfort in patients. Oral hormones can cause significant adverse reactions to hematopoiesis and the gastrointestinal tract, while topical hormones can cause hair follicle atrophy and other side effects.

[0005] Therefore, there is an urgent need in the art to develop a spherical circular nucleic acid that can reduce side effects and has good biocompatibility for preventing and treating psoriasis. Summary of the Invention

[0006] In view of the above problems, the object of the present invention is to provide a spherical circular nucleic acid for preventing and treating psoriasis that can reduce side effects and has good biocompatibility.

[0007] In a first aspect of the present invention, a nano nucleic acid material for preventing and / or treating psoriasis is provided, comprising a nucleic acid aptamer and a nano material; the nucleic acid aptamer is adsorbed on the nano material, and the nucleic acid aptamer comprises anti-TNF-α and anti-VEGF.

[0008] In another preferred embodiment, the nucleic acid aptamer is adsorbed on the nanomaterial.

[0009] In another preferred embodiment, the core of the nano-nucleic acid material is a gold nanocluster, and the surface layer is a ring-shaped nucleic acid aptamer.

[0010] In another preferred embodiment, the nucleic acid aptamer comprises at least one of the nucleic acids having nucleotide sequences shown in SEQ ID NOs: 1-3.

[0011] In another preferred embodiment, the nanomaterial comprises gold nanoclusters.

[0012] In another preferred embodiment, the particle size of the gold nanoclusters is distributed between 2 and 3 nm.

[0013] In a second aspect of the present invention, a method for preparing the nano-nucleic acid material according to the first aspect of the present invention is provided, comprising the following steps:

[0014] (1) chloroauric acid, glutathione and 4,6-diamino-2-mercaptopyrimidine are mixed and stirred, and then heated to prepare a gold nanocluster solution;

[0015] (2) reacting the gold nanocluster solution with the nucleic acid aptamer to obtain a nanonucleic acid material.

[0016] In another preferred embodiment, the molar ratio of chloroauric acid:glutathione:4,6-diamino-2-mercaptopyrimidine is 1:(1-200):(1-100).

[0017] In another preferred embodiment, the concentration of chloroauric acid is 5-40 mM, preferably 10-30 mM, and more preferably 10-20 mM.

[0018] In another preferred embodiment, the concentration of glutathione is 10-200 mM, preferably 20-150 mM, and more preferably 50-100 mM.

[0019] In another preferred embodiment, the concentration of 4,6-diamino-2-mercaptopyrimidine is 5-100 mM, preferably 10-80 mM, and more preferably 40-60 mM.

[0020] In another preferred embodiment, the heating comprises oil bath heating.

[0021] In another preferred embodiment, the heating temperature is 65-80°C.

[0022] In another preferred embodiment, the heating time is 20 to 30 hours.

[0023] In another preferred embodiment, the stirring speed is 800-1200 rpm.

[0024] In another preferred embodiment, in step (2), the nucleic acid aptamer comprises a cyclized anti-VEGF nucleic acid and a cyclized anti-TNF-α nucleic acid.

[0025] In another preferred embodiment, the nucleic acid aptamer comprises at least one of the nucleic acids having nucleotide sequences shown in SEQ ID NOs: 1-3.

[0026] In another preferred embodiment, in step (2), the nucleic acid aptamer comprises nucleic acids having nucleotide sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0027] In another preferred embodiment, the circularized anti-VEGF nucleic acid is prepared by combining the anti-VEGF nucleic acid with the nucleotide sequence shown in SEQ ID NO: 1 and the complementary nucleic acid with the nucleotide sequence shown in SEQ ID NO: 3.

[0028] In another preferred embodiment, the cyclized anti-TNF-α nucleic acid is prepared by combining the anti-TNF-α nucleic acid with the nucleotide sequence shown in SEQ ID NO: 2 and the complementary nucleic acid with the nucleotide sequence shown in SEQ ID NO: 3.

[0029] In another preferred embodiment, in step (2), the molar ratio of the gold nanocluster solution to the nucleic acid aptamer is 1:1-6.

[0030] In another preferred embodiment, the molar ratio of the gold nanocluster solution: the cyclized anti-VEGF nucleic acid: the cyclized anti-TNF-α nucleic acid is 1:(1-6):(1-6).

[0031] In a third aspect of the present invention, a pharmaceutical composition is provided, comprising:

[0032] (a1) a first active ingredient for preventing and / or treating psoriasis, the first active ingredient comprising: the nucleic acid nanomaterial according to the first aspect of the present invention;

[0033] (a2) a second active ingredient for preventing and / or treating psoriasis, wherein the second active ingredient includes: other drugs for preventing and / or treating psoriasis; and

[0034] (b) a pharmaceutically acceptable carrier.

[0035] In another preferred embodiment, the pharmaceutical composition is used to prepare a drug or preparation for treating or preventing autoimmune diseases.

[0036] In another preferred embodiment, the preparation is in the form of tablets, powders, granules or capsules, or emulsions or syrups.

[0037] In another preferred embodiment, the dosage form of the drug is a non-oral dosage form, including: external liquid preparation, injection, transdermal patch or injection.

[0038] In another preferred embodiment, the external liquid preparation comprises a film-coating agent.

[0039] In a fourth aspect, the present invention provides use of the nano-nucleic acid material described in the first aspect of the present invention in the preparation of a drug for preventing and / or treating psoriasis.

[0040] In a fourth aspect of the present invention, a method for preventing and / or treating psoriasis is provided, comprising the steps of:

[0041] The nano-nucleic acid material described in the first aspect of the present invention or the skin lotion containing the nano-nucleic acid material, or the pharmaceutical composition described in the second aspect of the present invention is administered to a subject in need.

[0042] In another preferred embodiment, the applying is spreading.

[0043] In another preferred embodiment, the subject includes a human or a non-human mammal.

[0044] In another preferred embodiment, the non-human mammals include rodents and primates, preferably mice, rats, rabbits, and monkeys.

[0045] In another preferred embodiment, the administration dose of the nano-nucleic acid material is 0.0001-100 mg / kg body weight, preferably 1-50 mg / kg body weight, and most preferably 5-20 mg / kg body weight.

[0046] In another preferred embodiment, the administration frequency of the nano-nucleic acid material is 1-150 times / month, preferably ≥1 time / day, more preferably, 2 times / day.

[0047] In another preferred embodiment, the administration time of the nano-nucleic acid material is 1-100 days, preferably 1-50 days, and more preferably 1-10 days.

[0048] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features described in detail below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be listed here one by one.

[0049] Compared with the prior art, the present invention has the following technical effects:

[0050] (1) The nanonucleic acid material provided by the present invention cyclizes the surface nucleic acid, which is a new structural design. This design can effectively improve the nuclease tolerance of the spherical circular nucleic acid, thereby enabling the material to perform treatment more deeply.

[0051] (2) The surface nucleic acid aptamers of the nanonucleic acid material provided by the present invention are anti-TNF-α and anti-VEGF. These two aptamers can effectively capture the two cytokines TNF-α and VEGF that are overexpressed in psoriasis lesions, and can effectively prevent and / or treat psoriasis.

[0052] (3) The nanonucleic acid material provided by the present invention can effectively inhibit the level of the inflammatory factor IL-1β, as well as the excessive proliferation of psoriasis-related cells, reduce the psoriasis PASI score, and thus effectively prevent and / or treat psoriasis.

[0053] (4) The present invention uses transdermal administration of nano-nucleic acid materials, which can effectively prevent and / or treat psoriasis while avoiding problems such as injection wound infection.

[0054] (5) The nanonucleic acid material provided by the present invention has good biocompatibility and can avoid biological side effects such as liver and kidney toxicity and hair follicle atrophy to the greatest extent. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] Figure 1 A transmission electron microscopy (TEM) image showing the spherical circular nucleic acid prepared in one embodiment of the present invention.

[0056] Figure 2 Shown are the particle size distributions of the gold nanoclusters (A) and spherical circular nucleic acids (B) prepared in one embodiment of the present invention, as well as their potential results (C) in the presence of anti-VEGF DNA, anti-TNF-α DNA, and spherical circular nucleic acids, in millivolts (mV).

[0057] Figure 3Shown are mapping images of gold nanoclusters and spherical circular nucleic acids prepared in one embodiment of the present invention, as well as the ratio of the number of phosphorus and gold particles in the two materials.

[0058] Figure 4 The graph shows the capture rate detection results of VEGF cytokine and TNF-α cytokine by gold nanoclusters and spherical circular nucleic acids prepared in one embodiment of the present invention.

[0059] Figure 5 Shown are the test results of the inhibition rate of HaCaT cells and the cytokine IL-1β concentration of the gold nanoclusters and spherical circular nucleic acids prepared in one embodiment of the present invention.

[0060] Figure 6 Shown is a graph showing the PASI score results for the prevention of psoriasis by gold nanoclusters and spherical circular nucleic acids prepared in one embodiment of the present invention.

[0061] Figure 7 This figure shows the effect of gold nanoclusters and spherical circular nucleic acids prepared in one embodiment of the present invention on preventing psoriasis.

[0062] Figure 8 Shown is the PASI score result of the spherical circular nucleic acid prepared in one embodiment of the present invention and calcipotriol-betamethasone ointment in the treatment of psoriasis.

[0063] Figure 9 This figure shows the effect of the spherical circular nucleic acid prepared in one embodiment of the present invention and calcipotriol-betamethasone ointment on the treatment of psoriasis.

[0064] Figure 10 Shown are the results of alanine aminotransferase and blood urea nitrogen in the blood of mice in each experimental group in one embodiment of the present invention. DETAILED DESCRIPTION

[0065] To make the purpose, technical solutions, beneficial effects, and significant improvements of the embodiments of the present invention more clear, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, all the embodiments described are only some embodiments of the present invention, not all embodiments; based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0066] As used herein, the terms "nanonucleic acid material," "spherical nucleic acid," and "spherical circular nucleic acid" are used interchangeably to refer to the anti-VEGF and anti-TNF-α spherical circular nucleic acids provided herein for the prevention and / or treatment of psoriasis. These spherical circular nucleic acids have a core composed of gold nanoclusters and a surface layer composed of circular nucleic acid aptamers.

[0067] This invention provides a uniquely structured, spherical circular nucleic acid for preventing and / or treating psoriasis, specifically targeting VEGF and TNF-α. The core of the spherical circular nucleic acid is composed of gold nanoclusters, while the surface layer is composed of a circular nucleic acid aptamer. These aptamers assemble at the nanoscale through mutual attraction between positive and negative charges, forming a novel nanonucleic acid material called a spherical circular nucleic acid.

[0068] Circularizing the surface nucleic acid is a novel structural design that effectively improves the ribozyme resistance of spherical circular nucleic acids, enabling the material to deliver a more in-depth therapeutic effect. To effectively prevent and treat psoriasis, the surface nucleic acid aptamers of the spherical circular nucleic acid are anti-TNF-α and anti-VEGF. These two aptamers can effectively capture TNF-α and VEGF, two cytokines overexpressed in psoriasis lesions. By capturing these two cytokines, psoriasis can be effectively treated from both the inflammatory and cellular overproliferation perspectives.

[0069] TNF-α is a cytokine closely associated with the immune inflammatory response in psoriasis. It not only induces the expression of adhesion molecules in the skin, promotes lymphocyte infiltration, accelerates the maturation of Langerhans cells, and enhances their activation capacity, but also promotes the proliferation of keratinocytes. Both TNF-α receptors are present in soluble form on the cell surface. TNF-α must bind to two to three cell surface receptors to activate cell signaling, which in turn produces numerous biological effects. TNF-α is found to be highly expressed in the skin lesions of psoriasis patients and exhibits higher immunoreactivity and biological activity than normal subjects. TNF-α is implicated in the pathogenesis of psoriasis, and its antagonists have demonstrated unique advantages in terms of symptom remission, prolongation of the relapse interval, and safety.

[0070] Phosphorylated ERK1 / 2 is highly expressed in the nuclei of keratinocytes in psoriatic lesions. Once translocated, phosphorylated ERK1 / 2 regulates the expression of downstream signaling molecules. Activation of VEGFR2 by VEGF induces ERK1 / 2 phosphorylation, promoting the mRNA expression of keratins K6, K16, and K17 and reducing the mRNA expression of K1 and K10. Abnormally high expression of K6, K16, and K17, along with significantly reduced expression of K1 and K10, is a characteristic hallmark of keratinocyte hyperplasia and abnormal differentiation. Furthermore, dysregulated proliferation of numerous keratinocytes in the basal layer can lead to significant epidermal thickening in patients. Vascular proliferation is a key pathological feature of psoriasis, and current research generally believes that vascular proliferation is mediated by VEGF. VEGF stimulates phosphorylation of tyrosine residues in VEGFR2, activating the downstream Raf-1 / MEK / ERK cascade and promoting angiogenesis. Dermatoscopy reveals significant subcutaneous vascular proliferation in patients with psoriasis. The VEGF content in the serum of psoriasis patients increased significantly. After treatment, the VEGF content in the serum of patients decreased, and the psoriasis symptoms were also significantly alleviated.

[0071] Example 1: Preparation of spherical circular nucleic acids

[0072] This example designs a special structure of spherical circular nucleic acid, whose core is a gold nanocluster and the surface is a circular nucleic acid aptamer. The specific steps are as follows:

[0073] 1. Prepare the gold nanocluster solution:

[0074] 1 mL of 20 mM chloroauric acid, 0.5 mL of 100 mM glutathione, 5 mL of 10 mM 4,6-diamino-2-mercaptopyrimidine, and 3.5 mL of ultrapure water were added to a reaction vessel and reacted in a 70°C oil bath for 24 hours with a stirring speed of 1000 rpm. The resulting product was filtered through a 0.22 μm filter to obtain a purified gold nanocluster solution. The gold nanocluster particle size distribution ranged from 2 to 3 nm. ( Figure 2 A)

[0075] 2. Preparation of anti-VEGF DNA, complementary DNA, and anti-TNF-α DNA:

[0076] Using a DNA synthesizer, anti-VEGF DNA, complementary DNA, and anti-TNF-α DNA were prepared according to the following nucleic acid sequences. The specific nucleic acid sequences (5'-3') are as follows:

[0077] Anti-VEGF DNA sequence:

[0078] TGTGCGTGTGTAGTGTGTGGGGGTGGACGGGCCGGGTAGAGGGATTTGGGCGGTT (SEQ ID NO: 1)

[0079] Anti-TNF-α DNA sequence:

[0080] TGTGCGTGTGTAGTGGCGCCACTACAGGGGAGCTGCCATTCGAATAGGTGGGCCGCGGGATTTGGGCGGTT (SEQ ID NO: 2)

[0081] Complementary DNA sequence:

[0082] CACTACACACGCACAAACCGCCCAAATCCC (SEQ ID NO: 3)

[0083] 3. Preparation of cyclized anti-VEGF nucleic acid and cyclized anti-TNF-α nucleic acid:

[0084] The anti-VEGF DNA, complementary DNA, and anti-TNF-α DNA prepared in step 2 were mixed in a buffer solution (50 mM Tris-HCl, 50 mM MgCl2, 10 mM DTT, 10 mM ATP, pH 7) and then annealed. The specific annealing steps are as follows:

[0085] Add 15 μL of the anti-VEGF DNA prepared in step 2 above, 15 μL of complementary nucleic acid, and 70 μL of buffer to a 200 μL EP tube. The molar ratio of anti-VEGF DNA (50 nmol / μL) to complementary DNA (100 nmol / μL) is 1:2.

[0086] The EP tube was then placed in a gradient PCR instrument and programmed as follows: heating at 95°C for 5 minutes and then decreasing the temperature by 0.5°C per minute to room temperature to obtain the circularized anti-VEGF nucleic acid.

[0087] Repeat step 3 above to prepare a circularized anti-TNF-α nucleic acid using the anti-TNF-α nucleic acid prepared in step 2 above and a complementary nucleic acid.

[0088] From the potential results, it can be seen that the gold nanoclusters prepared in step 1 are positively charged, and the anti-VEGF DNA and anti-TNF-α DNA prepared in step 2 are negatively charged, which provides conditions for the positive and negative charges of the two to combine. The spherical circular nucleic acid prepared in step 3 is negatively charged, indicating that the present invention has good biocompatibility ( Figure 2 C).

[0089] From the mapping image, it can be seen that the spherical ring-shaped nucleic acid prepared in step 3 above obviously contains phosphorus compared to the gold nanoclusters prepared in step 1, indicating that the nucleic acid successfully binds to the gold nanoclusters through positive and negative electrical attraction. ( Figure 3 )

[0090] 4. Purify the product obtained in step 3 to remove excess complementary nucleic acid in the reaction system.

[0091] 5. Preparation of spherical circular nucleic acids:

[0092] The gold nanoclusters (20 nmol / μL) prepared in step 1, the anti-VEGF DNA (60 nmol / μL) and the anti-TNF-α DNA (60 nmol / μL) cyclized in step 3 were added to a 2 mL EP tube at a molar ratio of 1:3:3. After standing at room temperature for 30 minutes, the final spherical circular nucleic acid was obtained. The transmission electron microscopy (TEM) image is shown below. Figure 1 As shown, the particle size distribution of spherical circular nucleic acids is 100~180nm. Figure 2 B)

[0093] 6. Preparation of skin lotion containing spherical circular nucleic acid:

[0094] The spherical circular nucleic acid (0.5 g) prepared in step 5 above was mixed with a commercially available lotion (Aquaphor Healing Ointment® (1.75 oz.)) (2.5 g) at a mass ratio of 1:5 to prepare a final lotion with a high therapeutic level.

[0095] Example 2: Cytokine capture experiment

[0096] Based on the spherical circular nucleic acid prepared in Example 1 above, this example uses an ELISA experiment to test its ability to capture two cytokines, VEGF and TNF-α. The specific process is as follows:

[0097] (1) VEGF cytokine capture

[0098] 1. Add 10 μL of 1 ng / mL VEGF to an 18-well ELISA plate (Biyuntian PV963). Add 10 μL of PBS to 6 wells (labeled wells 1 to 6). Add 10 μL of the gold nanocluster solution prepared in step 1 of Example 1 to 6 wells (labeled wells 7 to 12). This is the gold nanocluster set. Add 10 μL of the spherical circular nucleic acid prepared in step 5 of Example 1 to 6 wells (labeled wells 13 to 18). This is the spherical circular nucleic acid set. Cover with a film, gently shake to mix, and incubate at 37°C for 90 minutes.

[0099] 2. Remove the film, aspirate or shake off the liquid in the ELISA plate, and tap the plate 2-3 times on clean absorbent paper. Add 300-400 μL of wash buffer to each well. Without soaking, discard the liquid in the well and tap the plate 2-3 times on absorbent paper. Repeat this washing step 2-3 times.

[0100] 3. Add 100-150 μL of biotin-antibody working solution (Biyuntian PV963-5) to each well, apply the film, and incubate at 37°C for 60-90 minutes.

[0101] 4. Remove the film, aspirate or shake off the liquid in the ELISA plate, and tap the plate 2-3 times on clean absorbent paper. Add 300-400 μL of wash buffer to each well. Without soaking, discard the liquid in the well and tap the plate 2-3 times on absorbent paper. Repeat this washing step 3-5 times.

[0102] 5. Add 100-150 μL of HRP-streptavidin working solution to each well, apply the film, and incubate at 37°C for 30-45 minutes.

[0103] 6. Refer to step 3 and repeat this plate washing step 5 to 7 times.

[0104] 7. Add 90 μL of TMB colorimetric substrate to each well, apply the film, and incubate at 37°C in the dark for 10-20 minutes.

[0105] 8. Add 40-60 μL of reaction stop solution to each well. The color will immediately change from blue to yellow.

[0106] 9. Immediately read the OD450 value at 450 nm using a microplate reader. Convert the sample OD value to cytokine concentration according to the standard curve. The PBS solution group in wells 1-6 serves as a blank control, i.e., the PBS control group has a capture rate of 0%. Using the following cytokine capture rate formula, calculate the relative capture rates of the gold nanoclusters in wells 7-12 and the spherical circular nucleic acid group in wells 13-18 to quantitatively characterize the VEGF cytokine capture efficiency of the present invention.

[0107] (2) TNF-α cytokine capture

[0108] For the capture of TNF-α cytokine, the above experimental steps for capturing VEGF cytokine were repeated to quantitatively characterize the capture efficiency of the present invention for TNF-α cytokine.

[0109] The calculation formula of cytokine capture rate is:

[0110] Capture rate (%) = (total input cytokines - cytokines in supernatant) / total input cytokines × 100%

[0111] The results are as follows Figure 4 As shown, compared to the gold nanocluster solution, the spherical circular nucleic acid of the present invention achieved a capture efficiency of nearly 90% for the TNF-α cytokine and nearly 60% for the VEGF cytokine. This indicates that the spherical circular nucleic acid of the present invention has excellent capture capabilities for both VEGF and TNF-α cytokines, and by capturing both VEGF and TNF-α, it can achieve the purpose of treating psoriasis (**** P < 0.001).

[0112] Example 3: Spherical circular nucleic acids inhibit epidermal cell proliferation and suppress inflammatory factor IL-1β levels

[0113] This example uses cell experiments to test the ability of the spherical circular nucleic acid of the present invention to inhibit epidermal cell proliferation and the level of the inflammatory factor IL-1β. The specific experimental process is as follows:

[0114] (1) Detection of cell inhibition rate:

[0115] HaCaT cells were seeded into 24-well plates, with a cell number per well (approximately 2 × 10 5 ) were plated to 60%-70% of the visual field. 50 μL of 1 ng / mL VEGF cytokine was added to 18 wells (labeled wells 1 to 18). Normal cells were used in the remaining 6 wells as blank controls, representing the normal group. Simultaneously, 50 μL of the gold nanocluster solution prepared in step 1 of Example 1 was added to wells 1 to 6 (representing the gold nanocluster group). 10 μL of the spherical circular nucleic acid prepared in step 5 of Example 1 was added to wells 7 to 12 (representing the spherical circular nucleic acid group). Wells 13 to 18 remained untreated, representing the blank control group, indicating an inhibition rate of 0%. After 72 hours of culture, the cell count in each well was observed under a microscope, and the cell viability in each well was determined using the CCK8 assay.

[0116] The CCK8 assay involves adding 10 μL of CCK-8 solution to each well. The cells are then incubated at 37°C, 5% CO2, and 90% humidity for 4 hours. The absorbance is measured at 450 nm using a microplate reader.

[0117] The calculation formula of cell inhibition rate:

[0118] Cell inhibition rate (%) = (absorbance of untreated group - absorbance of nanoparticle-treated group) / number of cells in untreated group × 100%

[0119] The results are as follows Figure 5 As shown in the results of the HaCaT cell inhibition rate, the spherical circular nucleic acid of the present invention has a good effect of inhibiting the excessive proliferation of HaCaT cells, and can control the excessive proliferation of HaCaT cells induced by VEGF cytokine to a level close to that of normal cells.

[0120] (2) Detection of IL-1β cytokine:

[0121] HaCaT cells were plated in 24-well plates, with the number of cells per well reaching 80%-90% of the visual field. 50 μL of 1 ng / mL TNF-α cytokine was added to 18 wells (labeled wells 1 to 18). The remaining 6 wells served as blank controls, with the IL-1β concentration in the blank control group being 0. 50 μL of the gold nanocluster solution prepared in step 1 of Example 1 was added to wells 1 to 6 (the gold nanocluster group). 10 μL of the spherical circular nucleic acid prepared in step 5 of Example 1 was added to wells 7 to 12 (the spherical circular nucleic acid group). Wells 13 to 18 remained untreated (the untreated group). After 72 hours of culture, the IL-1β cytokine concentration in the supernatant was measured using an ELISA assay.

[0122] The ELISA detection method was performed according to the method in the cytokine capture experiment in Example 2.

[0123] The calculation formula of IL-1β cytokine concentration is:

[0124] First, draw a standard curve based on the concentration of the gradient diluted standard and the corresponding OD value; GraphPad Prism , perform standard curve fitting, and obtain the regression equation Y = 0.001188*X + 0.01220 (Y is the OD value; X is the IL-1β concentration of the sample); substitute the OD value of each group of samples into the regression equation to calculate the concentration of the sample.

[0125] The results are as follows Figure 5 As shown, compared with the untreated group, the spherical circular nucleic acid of the present invention significantly inhibited the content of inflammatory factor IL-1β in HaCaT cells induced by TNF-α cytokine (**** P < 0.001).

[0126] Example 4: Preventive and therapeutic effects of spherical circular nucleic acids on psoriasis

[0127] Based on Example 1, this example uses animal experiments to test the preventive and therapeutic effects of the spherical circular nucleic acid of the present invention on psoriasis. The specific experimental process is as follows:

[0128] (1) Prevention experiment

[0129] Balb / c mice were divided into three groups of 4 to 6 mice each. The mice were shaved on their backs, with the shaved area measuring 2 x 2 to 3 x 3 cm. A mouse psoriasis model was established using 5% imiquimod ointment. 20 to 30 mg of 5% imiquimod ointment was applied daily to the shaved area on the mice's backs for 7 consecutive days. Simultaneously, 20 to 30 mg of a skin lotion containing gold nanoclusters and a skin lotion containing spherical circular nucleic acids were applied daily to the shaved area on the mice's backs for 7 consecutive days.

[0130] The mice were divided into the following groups:

[0131] 1. Untreated group: only 5% imiquimod ointment was applied;

[0132] 2. Gold nanocluster group: 5% imiquimod ointment was applied and a moisturizer containing gold nanoclusters was applied simultaneously;

[0133] 3. Spherical circular nucleic acid group: Apply 5% imiquimod ointment and spherical circular nucleic acid moisturizing lotion at the same time.

[0134] During the experiment, the extent of scaling, infiltration, erythema and skin lesions of mice in each group were examined and photographed every day.

[0135] The results are as follows Figure 6-7 As shown, the psoriasis PASI score shows that mice treated with imiquimod (untreated group) will develop psoriasis symptoms; compared with the untreated group and the gold nanocluster group, the degree of skin lesions in mice smeared with the spherical circular nucleic acid of the present invention, including scales, infiltration, erythema and finishing of skin lesions, are significantly lower.

[0136] In summary, compared with the untreated group and the gold nanocluster group not loaded with anti-VEGF DNA and anti-TNF-α DNA, the spherical circular nucleic acid of the present invention has excellent psoriasis prevention function.

[0137] (2) Treatment experiments

[0138] Balb / c mice were divided into three groups of 4 to 6 mice each. The mice were shaved on their backs, covering an area of ​​2 x 2 to 3 x 3 cm. 20 to 30 mg of 5% imiquimod ointment was applied daily for 7 days to the shaved area on the mice's backs. This established a mouse psoriasis model. On the 7th day, 20 to 30 mg of calcipotriol-betamethasone ointment (Saimeier H20150372) and 20 to 30 mg of the prepared spherical circular nucleic acid-containing lotion were applied to the psoriasis lesions of the mice for 2 consecutive days.

[0139] The mice were divided into the following groups:

[0140] 1. Untreated group: only 5% imiquimod ointment was applied;

[0141] 2. Calcipotriol-betamethasone ointment group: 5% imiquimod ointment was applied continuously for 7 days, and calcipotriol-betamethasone ointment was applied on the 7th day;

[0142] 3. Spherical circular nucleic acid group: 5% imiquimod ointment was applied continuously for 7 days, and a moisturizing lotion containing spherical circular nucleic acid was applied on the 7th day.

[0143] During the experiment, the extent of scaling, infiltration, erythema and skin lesions of mice in each group were examined and photographed every day.

[0144] On the last day of the experiment, blood was collected from mice in each group, and alanine aminotransferase and blood urea nitrogen were tested in the blood.

[0145] The results are as follows Figure 8-9 As shown, the PASI score for psoriasis showed that the severity of skin lesions in each group of mice continued to worsen over the first seven days, reaching the deepest level on the seventh day. After applying calcipotriol-betamethasone ointment and a lotion containing the spherical circular nucleic acid of the present invention on the seventh day, all symptoms of psoriasis were alleviated, and the therapeutic effect of the present invention was superior to that of the commercially available calcipotriol-betamethasone ointment.

[0146] And from Figure 9 The results show that the treatment with calcipotriol-betamethasone ointment showed obvious symptoms of hair follicle atrophy; compared with the mice treated with calcipotriol-betamethasone ointment, the spherical circular nucleic acid treatment group of the present invention did not show obvious symptoms of hair follicle atrophy, and its side effects were much smaller than those of calcipotriol-betamethasone ointment.

[0147] from Figure 10 The results show that the alanine aminotransferase and blood urea nitrogen levels of the mice in each experimental group were within the normal range. The spherical circular nucleic acid of the present invention had no hepatotoxicity or renal toxicity during the treatment process and showed good biocompatibility.

[0148] The above describes the preferred embodiments of the present invention. It should be understood that the present invention is not limited to the above-mentioned specific embodiments, and the devices and structures that are not described in detail should be understood to be implemented in a common manner in the art; any technician familiar with the art can use the above-mentioned disclosed methods and technical contents to make many possible changes and modifications to the technical solutions of the present invention without departing from the scope of the technical solutions of the present invention, or modify them into equivalent embodiments of equivalent changes, which does not affect the essential content of the present invention. Therefore, any simple modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention that do not depart from the content of the technical solutions of the present invention are still within the scope of protection of the technical solutions of the present invention.

Claims

1. A nano nucleic acid material for preventing and / or treating psoriasis, characterized in that: It comprises nucleic acid aptamers and nanomaterials; the nucleic acid aptamers are adsorbed on the nanomaterials, and the nucleic acid aptamers include anti-TNF-α and anti-VEGF.

2. The nano nucleic acid material according to claim 1, characterized in that: The inner core of the nano-nucleic acid material is a gold nanocluster, and the outer layer is a ring-shaped nucleic acid aptamer.

3. The nano nucleic acid material according to claim 1, characterized in that: The nucleic acid aptamer includes at least one of the nucleic acids with nucleotide sequences shown in SEQ ID NOs: 1-3.

4. The nano nucleic acid material according to claim 1, characterized in that: The nanomaterials include gold nanoclusters.

5. A method for preparing the nano nucleic acid material as claimed in claim 1, characterized in that: The following steps are involved: (1) mixing chloroauric acid, glutathione and 4,6-diamino-2-mercaptopyrimidine, and heating to prepare a gold nanocluster solution; (2) reacting the gold nanocluster solution with a nucleic acid aptamer to obtain a nano-nucleic acid material.

6. The preparation method according to claim 5, characterized in that: The molar ratio of chloroauric acid: glutathione: 4,6-diamino-2-mercaptopyrimidine is 1: (1-200): (1-100).

7. The preparation method according to claim 5, characterized in that: In step (2), the nucleic acid aptamer includes a cyclized anti-VEGF nucleic acid and a cyclized anti-TNF-α nucleic acid.

8. A pharmaceutical composition, characterized in that include: (a1) a first active ingredient for preventing and / or treating psoriasis, the first active ingredient comprising: the nucleic acid nanomaterial according to claim 1; (a2) a second active ingredient for preventing and / or treating psoriasis, wherein the second active ingredient comprises: other drugs for preventing and / or treating psoriasis; and (b) a pharmaceutically acceptable carrier.

9. The pharmaceutical composition according to claim 8, characterized in that The dosage form of the pharmaceutical composition is a non-oral dosage form, including: external liquid preparations, injections, transdermal patches or injections; the external liquid preparations include film coatings.

10. Use of the nano nucleic acid material according to claim 1 in the preparation of a drug for preventing and / or treating psoriasis.