Phytophthora parasitica MLY61 and application thereof

By accelerating the tobacco Phytophthora strain to adapt to survival pressure under nutritious and high humic acid conditions, a new strain MLY61 that grows fast and loses pathogenicity was screened out, and embedded it to form bacterial agent particles, which solved the long-term effectiveness of tobacco black tib disease prevention and control and achieved efficient and environmentally friendly prevention and control effects.

CN120192854APending Publication Date: 2025-06-24CHINA TOBACCO HUNAN IND CORP
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311781666.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-12-22
Publication Date
2025-06-24

AI Technical Summary

Technical Problem

The economic losses caused by tobacco black tibia are high and are often accompanied by other diseases. The existing biological control methods may lead to imbalance in the bacterial structure and are difficult to effectively prevent and control in the long term.

Method used

By accelerating the tobacco Phytophthora parasitic strain PpN03 under nutritious and high humic acid conditions, it was forced to adapt to survival pressure, and screened out the new strain MLY61 that lost its pathogenicity but grew fast, and embedded it to form bacterial agent particles for the prevention and control of tobacco black tibia.

Benefits of technology

Effective prevention and control of tobacco black tib disease has been achieved, with relative prevention efficiency reaching 37.2%-93.5%, and it does not damage the soil microecology and is long-term sustainable.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120192854A_ABST
    Figure CN120192854A_ABST
Patent Text Reader

Abstract

The invention provides tobacco phytophthora parasitica MLY61 and application thereof. The MLY61 strain is obtained by separating a wild tobacco phytophthora parasitica strain from soil, performing eutrophic culture in combination with habitat pressure domestication and directionally selecting an exocrine pectinase lost strain; the mycelial growth speed of the MLY61 strain is greatly increased compared with that of a wild strain, but the tobacco infection capability is seriously degraded and the pathogenicity to tobacco is lost. The tobacco phytophthora parasitica MLY61 has strong tobacco root shin occupation capability, can inhibit pathogenic wild tobacco phytophthora from infecting tobacco, and realizes a disease prevention effect of preventing tobacco black shank. The method has wide application potential in the field of agricultural biological control microbial agents.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of agricultural biological control agents, and mainly relates to a Phytophthora parasitica var. nicotianae MLY61 with rapid growth and no pathogenicity to tobacco and its application. Background Art

[0002] In recent years, in response to the call for green agriculture in China, to avoid the "3R" problems caused by the large-scale use of chemical pesticides, and to give play to the advantages of continuous control, protection of the ecological environment, and low toxicity and safety to humans and livestock, biological control methods have played an increasingly important role in the stage of plant disease control. Phytophthora parasitica is a serious plant pathogen with a wide host range and can cause diseases in at least more than 90 kinds of plants. Among them, Phytophthora parasitica var. nicotianae can infect the roots, stems and leaves of tobacco, causing tobacco black shank disease, which is one of the most destructive diseases in tobacco production. According to incomplete statistics, the economic loss caused by tobacco black shank disease in China averages more than 100 million yuan per year. And black shank disease often occurs concomitantly with bacterial wilt, which is likely to cause misjudgment in farmers' control and ultimately lead to serious production losses. The demand for developing efficient tobacco black shank disease control technology is very urgent.

[0003] The field latency of Phytophthora parasitica var. nicotianae can be as long as 3 - 5 years. There is a high risk of subsequent outbreaks in local areas. Continuous use of pesticides for follow-up prevention and control is likely to lead to the emergence of drug-resistant bacteria, and the risk of effective subsequent prevention and control is relatively high. Compared with chemical control, biological control represented by the application of antagonistic bacteria can continuously improve the soil microbial community structure and reduce the pathogen population. The reported antagonistic bacteria mainly focus on endophytic bacteria and rhizosphere bacteria. Endophytic bacteria are commonly found in endogenously isolated strains of tobacco seeds, such as Bacillus spp., Pseudomonas spp., etc. Their mechanism of action is mainly to dissolve the hyphae of Phytophthora parasitica var. nicotianae by producing antibiotics. Feng Yunli et al. found that endophytic bacteria from flue-cured tobacco can come from the following 7 genera: Bacillus, Brevibacillus, Stenotrophomonas, Enhydrobacte, Erwinia; among which Bacillus is the dominant genus. The main idea for the development and utilization of rhizosphere antagonistic bacteria is to carry out applications based on the regional adaptability of indigenous microbial communities. The common microbial communities are mainly Gram-positive bacteria, such as Bacillus, Brevibacillus, Pseudomonas, etc. Biocontrol bacteria can improve the disease resistance of tobacco plants by regulating the content of endogenous hormones or increasing the activities of phenylalanine ammonia-lyase, polyphenol oxidase, peroxidase, and the content of malondialdehyde in leaves. In addition, there are reports that adjusting the soil environment, such as adding organic fertilizers, can also change the structure of indigenous microbial communities and ultimately achieve disease prevention and control. Antagonistic fungi mainly include Trichoderma spp., Penicillum spp., Gliocladium spp., etc. Among the antagonistic fungi against Phytophthora parasitica var. nicotianae that have been studied and applied, Trichoderma is the most common. Most Trichoderma can produce bioactive substances that have antagonistic effects on plant pathogenic fungi, bacteria, and insects, and can improve the stress resistance of crops, promote plant growth, and increase agricultural product yields. They are widely used in biological control, biological fertilizers, and soil conditioners. Trichoderma can decompose the cell walls of plant pathogenic fungi through the chitinase, β-glucanase, cellulase, and protease it produces, or secrete extracellular enzymes such as glucosidase to degrade the toxins produced by pathogens, secrete antibacterial proteins or lytic enzymes to inhibit the infection of plant pathogenic fungi. In addition, Trichoderma can also produce non-volatile antibiotics to inhibit hyphal growth, spore germination, and germ tube elongation, etc. There are also reports that non-pathogenic binucleate Rhizoctonia and Glomus can also inhibit the occurrence of Phytophthora parasitica var. nicotianae.

[0004] Although a large number of research reports and industrial applications theoretically indicate that a variety of antagonistic bacterial agents and products have achieved good disease prevention effects indoors or in the fields. However, some studies also suggest that the application of highly effective antagonistic bacteria can lead to an imbalance in the microbial community structure. While effectively suppressing the harm of target pathogenic bacteria, it makes the microecosystem become more vulnerable, creating opportunities for the outbreak of other new pathogenic bacteria. At the same time, a long-term study on soil microecology shows that the impact of early transient human intervention on soil microecology can last for up to 30 years. In addition, considering the intestinal flora imbalance in medicine and the emergence of superbugs under the administration of multiple antibiotics. Perhaps in addition to powerful and domineering antagonistic bacteria or chemical killing agents, the development of some biocontrol agents with relatively mild effects but high-targeted defenses may be more friendly to the soil environment and more environmentally friendly and sustainable from the perspective of long-term disease prevention and control.

[0005] In view of the above considerations, this invention combines the idea of the occupancy effect of intestinal microecological agents and the practical cases of the development and application of attenuated vaccine strains in agriculture. The research and development is carried out with the aim of obtaining a Phytophthora parasitica var. nicotianae strain that has lost its pathogenic ability to tobacco, grows rapidly, and has a significant occupancy effect. There is no relevant literature reporting such methods. Therefore, how to obtain such a rapidly growing and non-pathogenic occupancy strain is the key to this invention, and the elaboration of the corresponding molecular mechanism also provides a basis for the scientificity and originality of this invention.

[0006] This invention adopts a strategy that combines a nutrient-rich culture condition with a high content of organic carbon source and organic nitrogen source and the creation of a certain cell survival pressure by high humic acid, high nicotinamide, and high arginine. It prompts the starting strain PpN03 of Phytophthora parasitica var. nicotianae to adapt and domesticate in the direction of simultaneously adapting to nutrient-rich and high-humic acid survival pressures. During this process, pathogenicity degradation and rapid growth adaptation to nutrient-rich culture conditions may occur. Finally, through screening based on the loss of extracellular pectinase activity and pathogenicity, which are important markers related to disease, the strain of this invention is obtained. Summary of the Invention

[0007] The primary objective of this invention is to provide a new strain MLY61 of Phytophthora parasitica var. nicotianae that has lost its pathogenicity to tobacco and has an increased growth rate. Phytophthora parasitica var. nicotianae is active in the surface soil at a depth of 0 - 5 cm and invades by excreting pectinase to destroy the tissue of the tobacco root collar. At the same time, its excreted xyloglucan-specific endo-β-1,4-glucanase can inhibit the defense response of the tobacco host, facilitating infection. Under such circumstances, cultivating a new strain that has the same ecological niche as the wild-type pathogenic Phytophthora parasitica var. nicotianae but is non-pathogenic can achieve habitat competition in the same ecological niche, block the infection of pathogenic strains, and has practical application significance in the green prevention and control of tobacco black shank disease.

[0008] A strain of Phytophthora parasitica var. nicotianae MLY61 of the present invention has a deposit number of CGMCC No. 40348.

[0009] The Phytophthora parasitica var. nicotianae MLY61 does not have excreted pectin lyase activity, and the relevant DNA fragment has a deletion.

[0010] The xyloglucan-specific endo-β-1,4-glucanase gene PpN-xeg1 of the Phytophthora parasitica var. nicotianae MLY61 has a mutation, where Met119 mutates to Leu119, and this mutation causes the catalytic pocket of the enzyme to become narrower; specifically, it causes the catalytic pocket of the enzyme molecule to become narrower in the simulated 3D structure.

[0011] The Phytophthora parasitica var. nicotianae MLY61 has no pathogenic effect on tobacco, especially no observable pathogenic effect.

[0012] The Phytophthora parasitica var. nicotianae MLY61 has a mycelial extension growth rate on the plate that is 1.30 - 2.15 times faster than that of the starting wild-type strain PpN03, and the mycelial dry weight biomass accumulation rate increases by 1.67 - 2.58 times.

[0013] The purpose of the second aspect of the present invention is to provide the application of the Phytophthora parasitica var. nicotianae MLY61 for the prevention and control of tobacco black shank. The relative control efficacy reaches 37.2% - 93.5%.

[0014] Furthermore, the Phytophthora parasitica var. nicotianae MLY61 is embedded to form a microbial agent granule MLY61P for the prevention and control of tobacco black shank.

[0015] The composition of the microbial agent granule includes: 0.5 - 3.0 parts of ammonium alginate, 0.1 - 2.0 parts of high-ester pectin, 0.5 - 3.0 parts of polyvinyl alcohol, 0.1 - 1.0 parts of hydroxyethyl cellulose, 5.0 - 15.0 parts of diatomite, 5.0 - 10.0 parts of sawdust powder, 0.5 - 2.5 parts of wheat bran powder, 1.0 - 5.0 parts of potato powder, 1.0 - 10.0 parts of brown rice powder, 0.1 - 0.5 parts of yeast extract, 0.4 - 2.0 parts of soybean meal powder, 5.0 - 10.0 parts of MLY61 solid-state fermentation product, 0.1 - 1.0 parts of calcium nitrate, 0.1 - 0.4 parts of zinc borate, and 43.0 - 84.0 parts of sterile water.

[0016] The preparation method of the MLY61 solid-state fermented product is as follows: (1) Medium preparation: 4.5 - 8.0 parts of wheat bran, 20.0 - 32.0 parts of sawdust powder, 0.1 - 2.0 parts of sucrose, 0.1 - 2.0 parts of potato powder, 0.1 - 2.0 parts of soybean meal powder, 0.1 - 1.0 parts of corn steep liquor powder, 0.1 - 3.0 parts of humic acid, 50.0 - 75.0 parts of distilled water, and perform moist heat sterilization; (2) Cultivation method: Dig out the MLY61 strain block and inoculate it into the sterile medium, and statically cultivate it at 30 °C for 30 days to obtain it.

[0017] The preparation method of the microbial agent particles is as follows: First, dry and sterilize diatomaceous earth, sawdust powder, wheat bran powder, potato powder, brown rice powder, and soybean meal powder at 105 - 115 °C for 15 - 60 min. After cooling, mix them evenly with the MLY61 solid-state fermented product and zinc borate to obtain the standby material A; Mix ammonium alginate, high-ester pectin, polyvinyl alcohol, hydroxyethyl cellulose, and yeast extract with sterile water evenly, heat it to 85 - 100 °C and keep it warm for 20 - 60 min, and then cool it to obtain the standby material B; Add the material A to the material B in batches, mix them evenly, and then drop them into the calcium nitrate aqueous solution to solidify and form the microbial agent particles MLY61P.

[0018] The purpose of the third aspect of the present invention is to provide a control agent for tobacco black shank disease. The control agent for tobacco black shank disease is the tobacco Phytophthora parasitica MLY61 embedded to form the microbial agent particles MLY61P.

[0019] The purpose of the fourth aspect of the present invention is to provide a method for screening non-pathogenic tobacco Phytophthora parasitica, including the following steps:

[0020] (1) Medium formula: 50.0 - 250.0 g of whole potato powder, 5.0 - 20.0 g of sucrose, 1.0 - 5.0 g of brown sugar, 2.0 - 10.0 g of yeast extract, 1.0 - 10.0 g of peptone, 1.0 - 10.0 g of calf extract, 1.0 - 10.0 g of gluten powder, 1.0 - 10.0 g of soy peptone, 2.0 - 10.0 g of aspartic acid, 1.0 - 10.0 g of arginine, 0.5 - 5.0 g of glutamic acid, 0.5 - 2.5 g of tyrosine, 5.0 - 50.0 mg of vitamin B1, 2.0 - 10.0 g of inositol, 0.1 - 1.0 g of nicotinamide, 0.5 - 2.0 g of magnesium sulfate, 1.0 - 5.0 g of potassium dihydrogen phosphate, 0.1 - 1.0 g of calcium carbonate, 0.1 - 0.5 g of zinc borate, 100.0 - 400.0 g of humic acid, 5.0 - 50.0 g of fulvic acid, 12.0 - 20.0 g of agar powder, 1.0 L of distilled water; The medium is sterilized by moist heat at 121 °C for 30 min, and then poured into a sterile petri dish. After cooling and solidifying, it is used for culturing the starting strain and subsequent subculture strains of tobacco Phytophthora parasitica; (2) Cultivation temperature is 25.0 - 35.0 °C;

[0021] (3) The relative humidity of the air in the incubator is 90.0 - 95.0%; (4) The culture time is 5.0 - 10.0 d; (5) Strain screening method: Cut 1.0 - 2.0 mm of mycelium from the edge where the colony grows fastest, and conduct subculture. After 20 subcultures, test the extracellular pectinase activity every 10 generations. Screen the strains with significantly reduced pectinase activity and continue subculturing until strains with lost extracellular pectinase activity are obtained; Use these strains without extracellular pectinase activity as materials for pathogenicity testing, and screen to obtain Phytophthora parasitica var. nicotianae strains that have no observable pathogenic effect on tobacco.

[0022] The purpose of the fifth aspect of the present invention is to provide a class of Phytophthora parasitica var. nicotianae without pathogenicity, which is screened by the above method.

[0023] Advantages of the present invention:

[0024] The strains of the present invention grow faster than the wild-type starting strains and do not have pathogenicity to tobacco plants. Under artificially intervened conditions, they can maintain the growth advantage over pathogenic wild-type strains in the same ecological niche, and have outstanding effects when applied to the green prevention and control of tobacco black shank disease. For development, it has outstanding beneficial effects and broad application prospects in the protection of plant diseases caused by Phytophthora.

[0025] The Phytophthora parasitica var. nicotianae strain MLY61 of the present invention, classification name: Phytophthora parasitica var. nicotianae MLY61, Latin name: Phytophthora parasitica var. nicotianae, deposit number: CGMCC No. 40348, deposit time: October 28, 2022, deposit unit: General Microbiology Center of China Committee for Culture Collection of Microorganisms, address: Institute of Microbiology, Chinese Academy of Sciences, No. 1, Yard 3, Beichen West Road, Chaoyang District, Beijing, China. Brief description of the drawings

[0026] Figure 1 For showing the difference in the growth trend of the colony edge during the domestication process (the arrow indicates the leading edge of the differentially growing colony).

[0027] Figure 2 For showing the situation of picking the faster-growing regenerated strains (the arrow indicates the faster-growing strains).

[0028] Figure 3 For showing the schematic diagram of the binding sites of the primers for amplifying the pectin lyase gene.

[0029] Figure 4 For showing the PCR amplification 3 of the pectinase DNA segment, and the target fragment length is 1.7 kp.

[0030] Figure 5 For showing the PCR amplification 1 of the pectinase DNA segment, and the target fragment length is 305 bp.

[0031] Figure 6 For the PCR amplification of the pectinase DNA segment 2, the length of the target fragment is 710 bp.

[0032] Figure 7 It is the 3D models of the wild type and mutants of the PpN_XEG1 protein generated by simulation on SWISS-MODEL Homology Modelling. A is the 3D model of the wild type PpN_XEG1 protein, and B is the 3D model of the PpN_XEG1 protein in the MLY61 strain (SWISS-MODEL based on 7drc.1.A, SMTL Version 2023-11-30; Trg-Tpl Seq Id91.70%. "Cryo-EM structure of plant receptor like protein RXEG1 in complex with xyloglucanase XEG1 and BAK1" G4ZHR2).

[0033] Figure 8 It is the comparison of the growth of the MLY61 strain under two formulations of the bacterial agent particles. Figure 8 In Figure A, it shows the growth of MLY61 in common calcium alginate capsules during subsequent application. It can be seen that the outer edge of the capsule particles is smooth and no obvious hyphae grow out, and the number of hyphae visible inside the capsule is also small; Figure B shows the growth of the MLY61 strain in the preferred formulation of the present invention. The edge of the capsule particles is densely covered with hyphae, and a large number of filamentous hyphae can also be seen inside the capsule. Detailed implementation mode

[0034] The following details the embodiments of the present invention. These embodiments are implemented on the premise of the technical solution of the present invention, and detailed implementation methods and specific operation processes are given. However, the protection scope of the present invention is not limited to the following embodiments.

[0035] Example 1:

[0036] (1) Domestication culture of the wild type strain PpN03 of Phytophthora parasitica nicotianae:

[0037] The wild type strain PpN03 of Phytophthora parasitica nicotianae isolated from flue-cured tobacco plants with black shank disease in Qianxinan Prefecture was inoculated on domestication culture agar and cultured for 7.0 d at 30.0 °C and an air relative humidity of 92.0% as one generation, and continuous subculture was carried out.

[0038] The domestication and cultivation agar formula is as follows: 150.0 g of whole potato powder, 12.5 g of sucrose, 2.0 g of brown sugar, 6.0 g of yeast extract, 3.5 g of peptone, 5.5 g of calf extract, 4.0 g of gluten powder, 3.5 g of soy peptone, 6.0 g of aspartic acid, 7.0 g of arginine, 3.5 g of glutamic acid, 1.5 g of tyrosine, 20.0 mg of vitamin B1, 4.0 g of inositol, 0.5 g of nicotinamide, 1.5 g of magnesium sulfate, 3.0 g of potassium dihydrogen phosphate, 0.5 g of calcium carbonate, 0.5 g of zinc borate, 300.0 g of humic acid, 20.0 g of fulvic acid, 16.0 g of agar powder, and 1.0 L of distilled water; the culture medium is sterilized by moist heat at 121 °C for 30 min, then poured into a sterile petri dish, and used for the domestication and cultivation of the wild-type strain PpN03 of Phytophthora parasitica nicotianae after cooling and solidifying.

[0039] (2) Screening method for domesticated strains:

[0040] After 10 subcultures, the differential growth of the colony edge as shown in Figure 1 appears. Cut 1.5 mm of the mycelium at the front edge of the colony along the colony edge (as shown by the arrow), mix it, and shake it in 50 mL of 0.8% sterile physiological saline containing glass beads for 1 h, then dilute it again by gradient and spread it on the domestication and cultivation agar described in this example. Select a plate with an appropriate dilution degree as shown in Figure 1 Figure A, pick the strain with the most vigorous growth, and transfer it to obtain Figure 2 the new starting strain PpN03-2 as shown in Figure B in Figure 2 . Then, using the PpN03-2 strain as the starting strain, repeat the above-mentioned domestication and cultivation process. When it comes to the 20th subculture, start to screen for extracellular pectinase activity. Select strains with significantly reduced pectinase activity and continue the above-mentioned domestication and cultivation process until an extracellular pectinase-negative strain is obtained.

[0041] (3) Screening for extracellular pectinase-negative strains:

[0042] Using the liquid fermentation supernatant as the test sample, the pectinase activity is determined with reference to the reference method for determining pectinase activity described in the national standard (GB 1886.174-2016). The preparation method of the fermentation supernatant is as follows: Transfer the candidate strains screened in the previous step and the initial wild-type strain PpN03 to the liquid medium for domestication and cultivation described in this example respectively, and shake-culture them at 30 °C at 180 rpm for 10 d. Then centrifuge the bacterial liquid at 12,000 rpm for 10 minutes, and take the supernatant for pectinase activity determination.

[0043] (4) Analysis of the growth characteristics of the strain MLY61 of the present invention

[0044] After continuous screening in the steps (1)-(3) of the foregoing embodiment, a strain MLY61 negative for excreted pectinase was obtained at the 40th subculture. The growth rate of the mycelium in the plate of this strain on the domestication medium described in this embodiment was 2.15 times faster than that of the starting wild-type strain PpN03, and the accumulation rate of the dry weight biomass of the mycelium increased by 2.58 times. Moreover, after the strain was stab-inoculated on the mature leaves of Yunyan 85 for 5 days, no visible pathogenicity was observed, while visible lesions with a diameter of more than 1.8 cm appeared on the leaves inoculated with the wild-type strain PpN03 during the same period.

[0045] (5) Preparation of the biocontrol agent granule MLY61P of the strain MLY61 of the present invention and evaluation of the biocontrol effect

[0046] Preparation of the solid-state fermentation product of MLY61: Mix 6.0 parts of wheat bran, 25.0 parts of sawdust powder, 1.0 part of sucrose, 1.0 part of potato powder, 0.5 part of soybean meal powder, 0.3 part of corn steep liquor powder, 2.0 parts of humic acid, and 64.2 parts of distilled water, and sterilize by moist heat at 121 °C for 1 h. When the temperature of the material drops below 35 °C, dig out the MLY61 strain block and inoculate it into the sterile material, and statically culture it at 30 °C for 30 d to obtain the solid-state fermentation product of MLY61.

[0047] Preparation of the biocontrol agent granule MLY61P: First, dry and sterilize 10.0 parts of diatomite, 8.0 parts of sawdust powder, 1.0 part of wheat bran powder, 3.0 parts of potato powder, 4.0 parts of brown rice powder, and 1.2 parts of soybean meal powder at 110 °C for 30 min. After cooling, mix them evenly with 8.0 parts of the solid-state fermentation product of MLY61 and 0.2 part of zinc borate to obtain the standby material A; mix 2.0 parts of ammonium alginate, 0.5 part of high-ester pectin, 1.0 part of polyvinyl alcohol, 0.4 part of hydroxyethyl cellulose, 0.3 part of yeast extract with 60.1 parts of sterile water, heat to 92.0 °C and keep warm for 40 min, and then cool to obtain the standby material B; add the material A to the material B in batches, mix evenly, and then drop it into 0.3 part of calcium nitrate aqueous solution to solidify and form the biocontrol agent granule MLY61P.

[0048] Refer to the "Grading and Investigation Methods for Tobacco Diseases and Insect Pests" (GB 23222-2008) to investigate the disease occurrence degree, and calculate the disease index and the disease prevention effect.

[0049] Disease index = [∑(number of plants at each disease level x disease level number) / (highest disease level x total number of plants)] x 100

[0050] Relative control efficacy / % = [(control disease index - treatment disease index) / control disease index] x 100

[0051] Under the condition of greenhouse potting of the flue-cured tobacco variety Yunyan 85, when the application rate of the bacterial agent granule MLY61P was 10.0 g / plant, the relative control effect of the plot test reached 93.5% (the control group was the adjacent plot sample without biological control bacteria and chemical control treatment).

[0052] After the bacterial agent granule MLY61P was cultured on a sterile water agar plate at 30 °C for 3 days, a large number of hyphae could be seen growing on the surface of the granule, and at the same time, the inside of the granule was also densely covered with mycelium. In contrast, the granule embedded with 2% sodium alginate and solidified had a smooth surface, no hyphae grew on it, and few mycelia were found inside the granule. See Figure 8 。

[0053] (6) PCR amplification detection of the pectinase gene fragment of the tobacco Phytophthora parasitica strain MLY61 of the present invention.

[0054] According to Figure 3 the order relationship shown, 3 pairs of primers were designed for amplifying the pectinase DNA fragment. The sequences of the 3 pairs of primers are as follows:

[0055] PF1: CAGTCAGAGTGTGTCCTAC

[0056] PR1: GATTCCTGTGCCGAGTTGAC

[0057] PF2: ATCCAGAATCTCTGTTACTGT

[0058] PR2: CACTCACGACACAGTCTAC

[0059] PF3: GTATGACCACATGCAAAGT

[0060] PR3: CCTTCGTGAACAGGTTC

[0061] The amplification conditions were as follows: Using common commercial kits, genomic DNA of Phytophthora parasitica nicotianae strain MLY61, strain PpN03, strain PpN03-2-1, PpN03-2-2, PpN03-2-3 obtained from the 10th subculture screening at the same time, and strain PpN03-3-1, PpN03-3-2, PpN03-3-3 obtained from the 20th subculture were picked. Ensure that OD260 / OD280 was between 1.8 - 2.0, and adjust the DNA concentration to 100 ng / μl. The PCR amplification reaction system was: 12.5 μl of 2×PCR premix, 0.5 μl each of primer pairs (PF1, PR1 or PF2, PR2 or PF3, PR3, all at a concentration of 10 μM), 2.0 μl of genomic DNA, and 10.5 μl of sterile ddH2O. The amplification conditions were: denaturation at 94°C for 2 min, denaturation at 94°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 1 min, running for 35 cycles, then final extension at 72°C for 2 min, cooling to 16°C, and after taking out, agarose gel electrophoresis was performed.

[0062] Figures 4 - 6 As shown by the arrows, all are the amplification results of strain MLY61. Figure 4 Showing the amplification results of primer pair PF3, PR3. It can be seen that the amplified fragment of MLY61 is approximately 0.8 kb smaller than that of the other 7 controls, indicating DNA fragment loss. Figure 5 and Figure 6 Successively are the amplification results of primer pairs PF1, PR1 and PF2, PR2. No fragment was amplified by MLY61 in this region, which also reflects fragment loss.

[0063] (7) Detection of the xyloglucan-specific endo-β-1,4-glucanase gene (PpN-xeg1) and 3D structure simulation of the enzyme molecule of Phytophthora parasitica nicotianae strain MLY61 of the present invention.

[0064] Transcriptome sequencing analysis was performed on strain MLY61 and wild-type strain PpN03 in this example, and it was found that there was an important amino acid mutation between them in the xyloglucan-specific endo-β-1,4-glucanase gene (PpN-xeg1), that is, methionine (Met119) at position 119 in the wild type mutated to leucine (Leu119) at position 119 in strain MLY61. The 3D structures of the wild-type and mutant PpN_XEG1 proteins were simulated using the SWISS-MODEL Homology Modelling method, and the results are shown in Figure 7Among them, A is the 3D model of the wild-type PpN_XEG1 protein, and B is the 3D model of the PpN_XEG1 protein in the MLY61 strain (generated on December 8, 2023). It can be seen from the simulated 3D structure that the enzyme catalytic pocket in MLY61 becomes smaller, and the space around the Leu119 position is also significantly narrower than that around Met119.

[0065] Example 2:

[0066] (1) Domestication and cultivation of the wild-type strain PpN03 of Phytophthora parasitica nicotianae:

[0067] The wild-type strain PpN03 of Phytophthora parasitica nicotianae isolated from flue-cured tobacco plants with black shank disease in Qianxinan Prefecture was inoculated on domestication culture agar and cultured for 10.0 days at 25.0 °C and an air relative humidity of 90.0% as one generation, and continuous subculture was carried out.

[0068] The formula of the domestication culture agar is as follows: 50.0 g of whole potato powder, 5.0 g of sucrose, 1.0 g of brown sugar, 2.0 - 10.0 g of yeast extract, 1.0 g of peptone, 1.0 g of calf extract, 1.0 g of gluten powder, 1.0 g of soy peptone, 2.0 g of aspartic acid, 1.0 - 10.0 g of arginine, 0.5 g of glutamic acid, 0.5 g of tyrosine, 5.0 mg of vitamin B1, 2.0 g of inositol, 0.1 g of nicotinamide, 0.5 g of magnesium sulfate, 1.0 g of potassium dihydrogen phosphate, 0.1 g of calcium carbonate, 0.1 g of zinc borate, 100.0 g of humic acid, 5.0 g of fulvic acid, 12.0 g of agar powder, 1.0 L of distilled water; the culture medium was sterilized by moist heat at 121 °C for 30 min, then poured into a sterile petri dish, and used for the domestication culture of the wild-type strain PpN03 of Phytophthora parasitica nicotianae after cooling and solidifying.

[0069] (2) Screening method for domesticated strains:

[0070] After 10 subcultures, differences in colony edge growth occurred. 1.0 mm of mycelium at the colony front edge was cut along the colony edge, mixed, shaken in 50 mL of 0.8% sterile physiological saline containing glass beads for 1 h, then gradient diluted again and spread on the domestication culture agar described in this example. The plate with an appropriate dilution was selected, and the strain with the most vigorous growth was picked and transferred to obtain a new starting strain. Then, the aforementioned domestication culture process was repeated. When it reached the 20th subculture, extracellular pectinase activity screening was started. Strains with significantly reduced pectinase activity were selected and the aforementioned domestication culture process was continued until an extracellular pectinase-negative strain was obtained.

[0071] (3) Screening for extracellular pectinase-negative strains:

[0072] Using the liquid fermentation supernatant as the test sample, referring to the reference method for the determination of pectinase activity described in the national standard (GB 1886.174-2016), the pectinase activity was determined. The preparation method of the fermentation supernatant was as follows: The candidate strains screened in the previous step and the initial wild-type strain PpN03 were respectively transferred to the medium for domestication culture described in the previous example of this embodiment, and cultured at 30 °C with shaking at 180 rpm for 10 d. Then, the bacterial liquid was centrifuged at 12,000 rpm for 10 minutes, and the supernatant was taken for the determination of pectinase activity. When subcultured 50 times, an extracellular pectinase-negative strain was obtained, indicating that an extracellular pectinase-negative strain could also be obtained under low component concentration conditions.

[0073] (4) The tobacco Phytophthora parasitica strain of the present invention has a mycelial extension growth rate on the domestication medium described in this example that is 1.30 times faster than that of the original wild-type strain PpN03, and the mycelial dry weight biomass accumulation rate increases by 1.67 times.

[0074] Example 3:

[0075] (1) Domestication culture of the wild-type strain PpN03 of Phytophthora parasitica nicotianae:

[0076] The wild-type strain PpN03 of Phytophthora parasitica nicotianae isolated from flue-cured tobacco plants with black shank disease in Qianxinan Prefecture was inoculated on domestication culture agar and cultured at 35.0 °C and a relative air humidity of 95.0% for 5.0 d as one generation, and continuous subculture was carried out.

[0077] The formula of the domestication culture agar was as follows: 250.0 g of whole potato powder, 20.0 g of sucrose, 5.0 g of brown sugar, 10.0 g of yeast extract, 10.0 g of peptone, 10.0 g of calf extract, 10.0 g of gluten powder, 10.0 g of soy peptone, 10.0 g of aspartic acid, 10.0 g of arginine, 5.0 g of glutamic acid, 2.5 g of tyrosine, 50.0 mg of vitamin B1, 10.0 g of inositol, 1.0 g of nicotinamide, 2.0 g of magnesium sulfate, 5.0 g of potassium dihydrogen phosphate, 1.0 g of calcium carbonate, 0.5 g of zinc borate, 400.0 g of humic acid, 50.0 g of fulvic acid, 20.0 g of agar powder, and 1.0 L of distilled water; The medium was sterilized by moist heat at 121 °C for 30 min, then poured into a sterile petri dish, and used for the domestication culture of the wild-type strain PpN03 of Phytophthora parasitica nicotianae after cooling and solidifying.

[0078] (2) Screening method for domesticated strains:

[0079] After 10 subcultures, differential growth occurred at the colony edge. Cut 2.0 mm of the hyphae at the forefront of the colony along the colony edge, mix them, and shake them in 50 mL of 0.8% sterile physiological saline containing glass beads for 1 h. Then, perform gradient dilution again and spread them on the domestication culture agar described in this example. Select a plate with an appropriate dilution degree, pick the strain with the most vigorous growth, and transfer it to obtain a new starting strain. Then repeat the aforementioned domestication culture process. When it reaches the 20th subculture, start screening for extracellular pectinase activity. Select strains with significantly reduced pectinase activity and continue the aforementioned domestication culture process until an extracellular pectinase-negative strain is obtained.

[0080] (3) Screening for extracellular pectinase-negative strains:

[0081] Using the liquid fermentation supernatant as the test sample, refer to the reference method for determining pectinase activity described in the national standard (GB 1886.174-2016) to determine the pectinase activity. The preparation method of the fermentation supernatant is as follows: Transfer the candidate strains screened in the previous step and the initial wild-type strain PpN03 to the liquid medium for the aforementioned domestication culture in this example, and culture them at 30 °C with shaking at 180 rpm for 10 d. Then centrifuge the bacterial liquid at 12,000 rpm for 10 minutes, and take the supernatant for pectinase activity determination. When it reaches the 30th subculture, an extracellular pectinase-negative strain is obtained, indicating that an extracellular pectinase-negative strain can also be obtained under low-component concentration conditions.

[0082] (4) The tobacco Phytophthora parasitica strain of the present invention has a mycelial extension growth rate on the domestication medium described in this example that is 1.82 times faster than that of the starting wild-type strain PpN03, and the mycelial dry weight biomass accumulation rate increases by 2.17 times.

[0083] Example 4:

[0084] (1) Domestication culture of the wild-type strain PpN03 of Phytophthora parasitica nicotianae:

[0085] Inoculate the wild-type strain PpN03 of Phytophthora parasitica nicotianae isolated from flue-cured tobacco plants with black shank disease in Qianxinan Prefecture on the domestication culture agar, and culture it at 30.0 °C and an air relative humidity of 93.0% for 6.0 d as one generation, and perform continuous subculture.

[0086] The formula of the domestication culture agar is as follows: 200.0 g of whole potato powder, 5.0 g of sucrose, 1.0 g of brown sugar, 5.0 g of yeast extract, 2.0 g of peptone, 1.0 g of calf extract, 10.0 g of gluten, 1.0 g of soy peptone, 5.0 g of aspartic acid, 9.0 g of arginine, 4.0 g of glutamic acid, 2.0 g of tyrosine, 30.0 mg of vitamin B1, 8.0 g of inositol, 0.3 g of nicotinamide, 1.5 g of magnesium sulfate, 4.0 g of potassium dihydrogen phosphate, 0.7 g of calcium carbonate, 0.4 g of zinc borate, 350.0 g of humic acid, 15.0 g of fulvic acid, 18.0 g of agar powder, and 1.0 L of distilled water; the culture medium is sterilized by moist heat at 121 °C for 30 min, and then poured into a sterile petri dish. After cooling and solidifying, it is used for the domestication culture of the wild-type strain PpN03 of Phytophthora parasitica nicotianae.

[0087] (2) Screening method for domesticated strains:

[0088] After 10 subcultures, different growth conditions appeared at the colony edge. Cut 1.0 mm of the mycelium at the forefront of the colony along the colony edge, mix it, and shake it in 50 mL of 0.8% sterile physiological saline containing glass beads for 1 h. Then, dilute it again by gradient and spread it on the domestication culture agar described in this example. Select a plate with an appropriate dilution degree, pick the strain with the most vigorous growth, and transfer it to obtain a new starting strain. Then repeat the aforementioned domestication culture process. When it comes to the 20th subculture, start to screen for extracellular pectinase activity. Select strains with significantly reduced pectinase activity and continue the aforementioned domestication culture process until an extracellular pectinase-negative strain is obtained.

[0089] (3) Screening for extracellular pectinase-negative strains:

[0090] Using the liquid fermentation supernatant as the test sample, the pectinase activity was determined with reference to the reference method for the determination of pectinase activity described in the national standard (GB 1886.174-2016). The preparation method of the fermentation supernatant is as follows: Transfer the candidate strains screened in the previous step and the initial wild-type strain PpN03 to the liquid domestication culture medium described in this example respectively, and shake-culture at 30 °C and 180 rpm for 10 d. Then centrifuge the bacterial liquid at 12,000 rpm for 10 minutes, and take the supernatant for pectinase activity determination. When it comes to the 30th subculture, an extracellular pectinase-negative strain is obtained, indicating that an extracellular pectinase-negative strain can also be obtained under the condition of low component concentration.

[0091] (4) For the Phytophthora parasitica nicotianae strain of the present invention, on the domestication culture medium described in this example, the growth rate of the mycelium extending on the plate is 2.04 times faster than that of the starting wild-type strain PpN03, and the cumulative rate of the dry weight biomass of the mycelium increases by 2.31 times.

[0092] Example 5:

[0093] Preparation and Biocontrol Effect Evaluation of the Biocontrol Bacterial Agent Granule MLY61P of the Strain MLY61 of the Present Invention

[0094] Preparation of the MLY61 Solid Fermentation Product: Mix 4.5 parts of wheat bran, 20.0 parts of sawdust powder, 0.1 part of sucrose, 0.1 part of potato powder, 0.1 part of soybean meal powder, 0.1 part of corn steep liquor powder, 0.1 part of humic acid, and 75.0 parts of distilled water, and sterilize by moist heat at 121°C for 1 h. When the temperature of the material drops below 35°C, dig out the MLY61 bacterial strain block and inoculate it into the sterile material, and statically culture it at 30°C for 30 d to obtain the MLY61 solid fermentation product.

[0095] Preparation of the Bacterial Agent Granule MLY61P: First, dry and sterilize 5.0 parts of diatomaceous earth, 5.0 parts of sawdust powder, 0.5 part of wheat bran powder, 1.0 part of potato powder, 1.0 part of brown rice powder, and 0.4 part of soybean meal powder at 105°C for 30 min. After cooling, mix them evenly with 5.0 parts of the MLY61 solid fermentation product and 0.1 part of zinc borate to obtain the standby material A; mix 0.5 part of ammonium alginate, 0.1 part of high-ester pectin, 0.5 part of polyvinyl alcohol, 0.1 part of hydroxyethyl cellulose, 0.1 part of yeast extract with 84.0 parts of sterile water, heat to 85°C and keep warm for 20 min, and then cool to obtain the standby material B; add the material A to the material B in batches, mix evenly, and then drop it into 0.1 part of calcium nitrate aqueous solution to solidify and form the bacterial agent granule MLY61P.

[0096] When the bacterial agent granule MLY61P is applied to the flue-cured tobacco variety Yunyan 85 under the conditions of greenhouse and pot cultivation, and the application rate is 10.0 g / plant, the relative control effect of the plot test reaches 37.2%. After the bacterial agent granule MLY61P is cultured on a sterile water agar plate at 30°C for 3 d, a large number of hyphae can be seen growing on the surface of the granule, and at the same time, the inside of the granule is also densely covered with mycelium. In contrast, the granule embedded with 2% sodium alginate and solidified has a smooth surface, no hyphae grow on it, and few mycelia are formed inside the granule.

[0097] Example 6:

[0098] Preparation and Biocontrol Effect Evaluation of the Biocontrol Bacterial Agent Granule MLY61P of the Strain MLY61 of the Present Invention

[0099] Preparation of the MLY61 Solid Fermentation Product: Mix 8.0 parts of wheat bran, 32.0 parts of sawdust powder, 2.0 parts of sucrose, 2.0 parts of potato powder, 2.0 parts of soybean meal powder, 1.0 part of corn steep liquor powder, 3.0 part of humic acid, and 50.0 parts of distilled water, and sterilize by moist heat at 121°C for 1 h. When the temperature of the material drops below 35°C, dig out the MLY61 bacterial strain block and inoculate it into the sterile material, and statically culture it at 30°C for 30 d to obtain the MLY61 solid fermentation product.

[0100] Preparation of microbial agent granule MLY61P: First, 15.0 parts of diatomite, 10.0 parts of sawdust powder, 2.5 parts of wheat bran powder, 5.0 parts of potato powder, 10.0 parts of brown rice powder, and 2.0 parts of soybean meal powder were dried and sterilized at 115 °C for 30 min. After cooling, they were evenly mixed with 10.0 parts of MLY61 solid-state fermentation product and 0.4 parts of zinc borate to obtain standby material A; 3.0 parts of ammonium alginate, 2.0 parts of high-ester pectin, 3.0 parts of polyvinyl alcohol, 1.0 part of hydroxyethyl cellulose, 0.5 part of yeast extract were mixed evenly with 43.0 parts of sterile water, heated to 100 °C and kept warm for 60 min, and then cooled to obtain standby material B; Material A was added to material B in batches, mixed evenly, and then dropped into 1.0 part of calcium nitrate aqueous solution for solidification and molding to obtain the microbial agent granule MLY61P.

[0101] When the microbial agent granule MLY61P was applied to the flue-cured tobacco variety Yunyan 85 under the conditions of greenhouse pot cultivation at a dosage of 10.0 g / plant, the relative control efficacy in the plot test reached 82.7%. After the microbial agent granule MLY61P was cultured on a sterile water agar plate at 30 °C for 3 days, a large number of hyphae could be seen growing on the surface of the granule, and at the same time, the inside of the granule was also densely covered with mycelia. In contrast, the granule embedded with 2% sodium alginate and solidified had a smooth surface, no hyphae were seen growing on it, and few mycelia were generated inside the granule.

[0102] Example 7:

[0103] Preparation and biocontrol effect evaluation of the biocontrol microbial agent granule MLY61P of the strain MLY61 of the present invention

[0104] Preparation of MLY61 solid-state fermentation product: 7.0 parts of wheat bran, 22.0 parts of sawdust powder, 1.2 parts of sucrose, 0.8 parts of potato powder, 1.1 parts of soybean meal powder, 0.3 parts of corn steep liquor powder, 2.6 parts of humic acid, and 65.0 parts of distilled water were sterilized by moist heat at 121 °C for 1 h. When the material cooled to below 35 °C, a piece of MLY61 strain was dug and inoculated into the sterile material, and then statically cultured at 30 °C for 30 d to obtain the MLY61 solid-state fermentation product.

[0105] Preparation of microbial agent granule MLY61P: First, 12.0 parts of diatomite, 7.0 parts of sawdust powder, 1.7 parts of wheat bran powder, 3.8 parts of potato powder, 30.0 parts of brown rice powder, and 1.0 part of soybean meal powder are dried and sterilized at 110 °C for 30 min. After cooling, they are evenly mixed with 7.5 parts of MLY61 solid-state fermentation product and 0.3 part of zinc borate to obtain reserve material A; 2.5 parts of ammonium alginate, 1.5 parts of high-ester pectin, 1.0 part of polyvinyl alcohol, 0.2 part of hydroxyethyl cellulose, 0.2 part of yeast extract are mixed evenly with 72.0 parts of sterile water, heated to 85 - 100 °C and kept warm for 20 - 60 min, and then cooled to obtain reserve material B; Material A is added to material B in batches, mixed evenly, and then dropped into 0.4 part of calcium nitrate aqueous solution for solidification and molding to obtain the microbial agent granule MLY61P.

[0106] When the microbial agent granule MLY61P is applied to the flue-cured tobacco variety Yunyan 85 under the conditions of greenhouse pot cultivation at a dosage of 10.0 g / plant, the relative control effect of the plot test reaches 92.7%. After the microbial agent granule MLY61P is cultured on a sterile water agar plate at 30 °C for 3 d, a large number of hyphae can be seen growing on the surface of the granule, and at the same time, the inside of the granule is also densely covered with mycelium. In contrast, for the granule embedded with 2% sodium alginate and solidified, its surface is smooth, no hyphae are seen growing, and few mycelia are generated inside the granule.

[0107] All percentage contents in the present invention, unless otherwise specified, are mass percentage contents.

Claims

1. A Phytophthora parasitica var. nicotianae MLY61, with the preservation number of CGMCC No. 40348.

2. The Phytophthora nicotianae MLY61 according to claim 1, wherein MLY61 does not have the activity of excreting pectin lyase.

3. The Phytophthora nicotianae MLY61 according to claim 1, characterized in that, The xyloglucan-specific endo-β-1,4-glucanase gene PpN-xeg1 of the MLY61 strain has mutated, with Met119 mutated to Leu119, and this mutation causes the enzyme catalytic pocket to narrow.

4. The Phytophthora nicotianae MLY61 according to claim 1, characterized in that, It has no pathogenic effect on tobacco.

5. The Phytophthora nicotianae MLY61 according to claim 1, characterized in that, The growth rate of mycelium extension on the plate is 2.15 times faster than that of the original wild-type strain PpN03, and the accumulation rate of mycelium dry weight biomass increases by 2.58 times.

6. Use of Phytophthora nicotianae MLY61 according to any one of claims 1-5, characterized in that, It is used for the prevention and control of tobacco black shank.

7. The application according to claim 6, wherein The above-mentioned Phytophthora parasitica var. nicotianae MLY61 is embedded to form a microbial agent particle MLY61P for the prevention and control of tobacco black shank.

8. According to the application described in claim 7, characterized in that The composition of the microbial agent particle includes: 0.5 - 3.0 parts of ammonium alginate, 0.1 - 2.0 parts of high-ester pectin, 0.5 - 3.0 parts of polyvinyl alcohol, 0.1 - 1.0 parts of hydroxyethyl cellulose, 5.0 - 15.0 parts of diatomite, 5.0 - 10.0 parts of wood chip powder, 0.5 - 2.5 parts of wheat bran powder, 1.0 - 5.0 parts of potato powder, 1.0 - 10.0 parts of brown rice powder, 0.1 - 0.5 parts of yeast extract, 0.4 - 2.0 parts of soybean meal powder, 5.0 - 10.0 parts of MLY61 solid-state fermentation product, 0.1 - 1.0 parts of calcium nitrate, 0.1 - 0.4 parts of zinc borate, and 43.0 - 84.0 parts of sterile water.

9. According to the application described in claim 8, characterized in that The preparation method of the above-mentioned MLY61 solid-state fermentation product is: (1) Medium preparation: 4.5 - 8.0 parts of wheat bran, 20.0 - 32.0 parts of wood chip powder, 0.1 - 2.0 parts of sucrose, 0.1 - 2.0 parts of potato powder, 0.1 - 2.0 parts of soybean meal powder, 0.1 - 1.0 parts of corn steep liquor powder, 0.1 - 3.0 parts of humic acid, 50.0 - 75.0 parts of distilled water, and sterilize by moist heat; (2) Cultivation method: Dig out the MLY61 bacterial strain block and inoculate it into the sterile medium, and statically cultivate at 30 °C for 30 d to obtain it.

10. The application according to claim 8, characterized in that, The preparation method of the microbial agent particle is: First, dry and sterilize diatomite, wood chip powder, wheat bran powder, potato powder, brown rice powder, and soybean meal powder at 105 - 115 °C for 15 - 60 min, cool and then mix evenly with the MLY61 solid-state fermentation product and zinc borate to obtain the standby material A; Mix ammonium alginate, high-ester pectin, polyvinyl alcohol, hydroxyethyl cellulose, and yeast extract evenly with sterile water, heat to 85 - 100 °C and keep warm for 20 - 60 min, and then cool to obtain the standby material B; Add the material A to the material B in batches, mix evenly, and then drop it into the calcium nitrate aqueous solution to solidify and form the microbial agent particle MLY61P.

11. A tobacco black shank prevention and control agent, characterized in that The tobacco black shank disease control agent, namely Phytophthora parasitica var. nicotianae MLY61, is embedded to form a microbial agent granule MLY61P, and its composition includes: 0.5 - 3.0 parts of ammonium alginate, 0.1 - 2.0 parts of high-ester pectin, 0.5 - 3.0 parts of polyvinyl alcohol, 0.1 - 1.0 parts of hydroxyethyl cellulose, 5.0 - 15.0 parts of diatomite, 5.0 - 10.0 parts of sawdust powder, 0.5 - 2.5 parts of wheat bran powder, 1.0 - 5.0 parts of potato powder, 1.0 - 10.0 parts of brown rice flour, 0.1 - 0.5 parts of yeast extract, 0.4 - 2.0 parts of soybean meal powder, 5.0 - 10.0 parts of solid-state fermented product of MLY61, 0.1 - 1.0 parts of calcium nitrate, 0.1 - 0.4 parts of zinc borate, and 43.0 - 84.0 parts of sterile water.

12. The preparation according to claim 11, wherein The preparation method of the solid-state fermented product of MLY61 is as follows: (1) Preparation of the culture medium: 4.5 - 8.0 parts of wheat bran, 20.0 - 32.0 parts of sawdust powder, 0.1 - 2.0 parts of sucrose, 0.1 - 2.0 parts of potato powder, 0.1 - 2.0 parts of soybean meal powder, 0.1 - 1.0 parts of corn steep liquor powder, 0.1 - 3.0 parts of humic acid, 50.0 - 75.0 parts of distilled water, and sterilized by moist heat; (2) Cultivation method: Dig out the MLY61 strain block and inoculate it into the sterile culture medium, and statically cultivate it at 30 °C for 30 days to obtain it.

13. The preparation according to claim 11, characterized in that, The preparation method of the microbial agent granule is as follows: First, dry and sterilize diatomite, sawdust powder, wheat bran powder, potato powder, brown rice flour, and soybean meal powder at 105 - 115 °C for 15 - 60 minutes, and after cooling, mix them evenly with the solid-state fermented product of MLY61 and zinc borate to obtain the standby material A; Mix ammonium alginate, high-ester pectin, polyvinyl alcohol, hydroxyethyl cellulose, and yeast extract evenly with sterile water, heat it to 85 - 100 °C and keep it warm for 20 - 60 minutes, and then cool it to obtain the standby material B; Add the material A to the material B in batches, mix them evenly, and then drop them into the calcium nitrate aqueous solution to solidify and form the microbial agent granule MLY61P.

14. A method for screening Phytophthora parasitica var. nicotianae without pathogenicity, characterized in that, It includes the following steps: (1) Culture medium formula: 50.0 - 250.0 g of whole potato powder, 5.0 - 20.0 g of sucrose, 1.0 - 5.0 g of brown sugar, 2.0 - 10.0 g of yeast extract, 1.0 - 10.0 g of peptone, 1.0 - 10.0 g of calf extract, 1.0 - 10.0 g of gluten powder, 1.0 - 10.0 g of soy peptone, 2.0 - 10.0 g of aspartic acid, 1.0 - 10.0 g of arginine, 0.5 - 5.0 g of glutamic acid, 0.5 - 2.5 g of tyrosine, 5.0 - 50.0 mg of vitamin B1, 2.0 - 10.0 g of inositol, 0.1 - 1.0 g of nicotinamide, 0.5 - 2.0 g of magnesium sulfate, 1.0 - 5.0 g of potassium dihydrogen phosphate, 0.1 - 1.0 g of calcium carbonate, 0.1 - 0.5 g of zinc borate, 100.0 - 400.0 g of humic acid, 5.0 - 50.0 g of fulvic acid, 12.0 - 20.0 g of agar powder, 1.0 L of distilled water; The culture medium is sterilized by moist heat at 121 °C for 30 min, then poured into a sterile petri dish, and used for culturing the starting strain of Phytophthora parasitica var. nicotianae and subsequent subcultured strains after cooling and solidifying; (2) Culture temperature: 25.0 - 35.0 °C; (3) Relative air humidity in the incubator: 90.0 - 95.0%; (4) Culture time: 5.0 - 10.0 d; (5) Strain screening method: Cut 1.0 - 2.0 mm of mycelium from the fastest-growing edge of the colony for subculture. After 20 subcultures, the extracellular pectinase activity is tested every 10 generations. Strains with significantly reduced pectinase activity are selected for continuous subculture until strains with lost extracellular pectinase activity are obtained; Using these strains without extracellular pectinase activity as materials for pathogenicity testing, Phytophthora parasitica var. nicotianae strains with no observable pathogenic effect on tobacco are screened.

15. A class of non - pathogenic Phytophthora nicotianae, characterized in that, It is obtained by screening with the method described in claim 14.