Edible and medicinal monascus purpureus with high esterifying enzyme activity and application of monascus purpureus
By providing high esterase activity as A.R. purple M230701Z6Ib10a, the safety hazards and low esterase activity of Aspergillus Rheumata are solved during the fermentation process of Aspergillus Rheumata, it realizes efficient and safe esterase production, which is suitable for industrial applications of food and drugs.
Patent Information
- Application Number
- CN202510373167.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-27
- Publication Date
- 2025-06-24
AI Technical Summary
During the fermentation of Aspergillus Rheumata, there are safety hazards (such as the production of tangerine) and the esterase activity is low, making it difficult to meet the needs of industrial production.
A strain of Aspergillus violet M230701Z6Ib10a is provided, which has high esterase activity and does not produce tangerine and is applied in food and medicine in the form of fermentation agents and compositions.
It has achieved a high-yield esterase-producing and safe and non-toxic red citrus products, suitable for industrial fermentation and production, and has improved the flavor and functionality of food and drugs.
Smart Images
Figure CN120192856A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of microbial strain protection and fermentation engineering of traditional Chinese medicine resources, and particularly relates to a Monascus purpureus with both edible and medicinal uses and high esterase activity and its application. Background Art
[0002] Esterase can promote the reaction of carboxylic acid and alcohol to generate ester and water, and is widely used in the food, cosmetic and pharmaceutical industries to synthesize spices, fragrances and drugs. Esterase can participate in the biosynthesis of natural products such as terpenoids and alkaloids, and contribute to the generation of bioactive products. Esterase is an important flavor-improving enzyme. In wine and other foods, esterase can improve the flavor of foods by catalyzing the production of esters. It can make the food have a more intense aroma and rich taste, increasing consumers' preference for the food.
[0003] For example, in bread making, esterase can promote the formation of esters in the dough, making the bread have a unique aroma and better flavor. In liquor brewing, esterase can promote the formation of flavor substances, thus enriching the aroma and taste of liquor. However, different esterases have different specificities for substrates and can catalyze the formation of different types of esters, laying the foundation for the formation of the unique flavor of liquor. At the same time, esterase can accelerate the esterification reaction, making the fermentation process more efficient, promoting the conversion and utilization of raw materials, and improving the liquor yield and quality of liquor. In wine brewing, it can improve the flavor quality of wine, affect the formation and transformation of other flavor substances in wine, optimize the taste and aroma balance of wine, and at the same time accelerate the aging process of wine, making the aroma of wine more complex and mellow. In the food industry, esterase can be used for oil modification, changing the structure and properties of oil, and adjusting the melting point, viscosity, oxidation stability and other characteristics of oil to make it more suitable for the processing requirements of different foods.
[0004] On March 9, 2025, the National Health Commission launched a three-year action plan for the "Year of Weight Management", aiming to vigorously popularize healthy lifestyles and strengthen chronic disease prevention and control work. In this context, red yeast products are expected to play an important role during this period due to their lipid-lowering active ingredients such as lovastatin and monascus pigments, as well as their thousand-year application history.
[0005] As an important producer of esterase, different strains of Monascus purpureus not only have different esterase activities, but also produce different types of esterases, thus endowing red yeast products with rich and diverse flavors.
[0006] On March 20, 2025, the State Council issued the "Opinions on Improving the Quality of Traditional Chinese Medicine and Promoting the High-quality Development of the Traditional Chinese Medicine Industry", which emphasized safeguarding the safety of industrial development and proposed to comprehensively use means such as traditional knowledge protection to strengthen the protection of traditional Chinese medicine resources and core technical processes. As a key microbial product that can be used both as food and medicine, Monascus strains are the core elements determining the efficacy of Monascus. Given the important value of Monascus products in the fields of traditional Chinese medicine and food and medicine, deeply exploring Monascus strains with high esterase activity to create Monascus products with more excellent flavors is of great significance for promoting the long-term development of the Monascus industry.
[0007] However, there are some technical problems that need to be solved urgently in the process of Monascus fermenting to produce esterase: First, some strains may produce fungal toxins such as citrinin during metabolism, posing potential safety hazards; second, the esterase activity of wild strains is generally low, making it difficult to meet the actual market demands of industrial production and the industry. Summary of the Invention
[0008] To solve the above problems, the present invention provides a Monascus purpureus strain with high esterase activity, a fermentation agent, its application, and a method for promoting its production of esterase.
[0009] In the first aspect, the present invention provides a Monascus purpureus strain M230701Z6Ib10a, whose taxonomic name is Monascus purpureus, and it was deposited at the China Center for Type Culture Collection on September 25, 2024, with the deposit number CCTCC No: M 20242077.
[0010] In the second aspect, the present invention provides a fermentation agent, which contains the above-mentioned Monascus purpureus strain M230701Z6Ib10a or its metabolites.
[0011] Feasibly, the fermentation agent is a fermentation culture of Monascus purpureus strain M230701Z6Ib10a.
[0012] Feasibly, the fermentation agent is a liquid preparation or a solid preparation.
[0013] Optionally, the dosage form of the fermentation agent is selected from any one of solution, suspension, emulsion, powder, granule, pill, tablet, and gel.
[0014] In the third aspect, the present invention provides a preparation method of the fermentation agent as described in the second aspect above. The preparation method includes: fermenting the spore suspension of the Monascus purpureus strain until the concentration reaches 10 4 spores / mL to 10 6 spores / mL to obtain the fermentation agent.
[0015] Preferably, it is obtained by fermenting and culturing the Monascus purpureus M230701Z6Ib10a in a culture medium. Among them, every 1000 mL of the culture medium contains: 40 g - 60 g of glucose, 10 g - 20 g of peptone, 1 g - 3 g of NaNO3, 0.8 g - 1.2 g of MgSO4·7H2O, 1 g - 2 g of KH2PO4, and the rest is water.
[0016] Preferably, every 1000 mL of the culture medium contains: 50 g of glucose, 15 g of peptone, 2 g of NaNO3, 1 g of MgSO4·7H2O, 1.5 g of KH2PO4, and the rest is water.
[0017] More preferably, the culture medium further contains amino acid additives.
[0018] Even more preferably, the amino acid additives are selected from any one or more of the following additives: cysteine, histidine, and glycine.
[0019] Preferably, the fermentation and culture temperature is 25°C - 35°C.
[0020] More preferably, the fermentation and culture temperature is 30°C.
[0021] Preferably, the fermentation and culture time is 5 days - 10 days.
[0022] More preferably, the fermentation and culture time is 6 days - 8 days.
[0023] Fourthly, the present invention provides a composition, which contains the Monascus purpureus M230701Z6Ib10a, or contains the above-mentioned fermentation inoculum.
[0024] In a feasible embodiment, the composition is a food or pharmaceutical composition, and it further contains a food or pharmaceutically acceptable carrier.
[0025] Fifthly, the present invention provides the use of the Monascus purpureus M230701Z6Ib10a, the above-mentioned fermentation inoculum, and / or the above-mentioned composition in the preparation of fermented foods.
[0026] In a feasible embodiment, the fermented food uses grains, beans, or traditional Chinese medicinal materials as raw materials.
[0027] Preferably, the raw materials of the fermented food are rice, sorghum, or dried tangerine peel.
[0028] More preferably, the fermented food includes any one of red yeast rice, red yeast sorghum, red yeast wine, red yeast dried tangerine peel, and red yeast dried tangerine peel beverage.
[0029] Sixth aspect, the present invention provides a method for preparing a fermented food, the method comprising: fermenting cereals, legumes or Chinese medicinal materials as raw materials by using the Monascus purpureus M230701Z6Ib10a, the fermentation inoculant or the composition described above.
[0030] The ratio of the raw material to the liquid of the fermentation inoculant is 8-12:1.
[0031] Preferably, the raw material is selected from: rice, sorghum or tangerine peel.
[0032] Preferably, the fermented food includes any one of red yeast rice, red yeast sorghum, red yeast wine, red yeast tangerine peel and red yeast tangerine peel beverage.
[0033] Preferably, the fermentation temperature is 25°C to 35°C.
[0034] More preferably, the fermentation temperature is 30°C.
[0035] Preferably, the fermentation time is 5 days to 10 days.
[0036] More preferably, the fermentation time is 6 days to 8 days.
[0037] By fermenting rice using the above method, red yeast rice with high esterase and non-toxic and harmless can be obtained.
[0038] By fermenting sorghum using the above method, red yeast sorghum with a fermented aroma can be obtained.
[0039] By brewing wine using the above method, the obtained red yeast wine has a light orange color and is uniform and natural, with a rich aroma level and is non-toxic and harmless.
[0040] By fermenting tangerine peel using the above method, the total flavonoid content and its antioxidant activity of tangerine peel can be greatly improved.
[0041] Seventh aspect, the present invention provides a method for producing esterase, the method comprising: fermenting and culturing the Monascus purpureus M230701Z6Ib10a in a medium containing glucose, peptone, NaNO3, MgSO4·7H2O and KH2PO4 to produce esterase.
[0042] In a feasible embodiment, each 1000 mL of the medium contains: 40 g - 60 g of glucose, 10 g - 20 g of peptone, 1 g - 3 g of NaNO3, 0.8 g - 1.2 g of MgSO4·7H2O, 1 g - 2 g of KH2PO4, and the rest is water.
[0043] Further preferably, per 1000 mL of the culture medium, it contains: 50 g of glucose, 15 g of peptone, 2 g of NaNO3, 1 g of MgSO4·7H2O, 1.5 g of KH2PO4, and the rest is water.
[0044] Preferably, the culture medium further contains amino acid additives.
[0045] Further preferably, the amino acid additives are selected from any one or more of the following additives: cysteine, histidine, and glycine.
[0046] The addition amount of the amino acid additives is 3 g / L to 8 g / L.
[0047] Preferably, the fermentation culture temperature is 25°C to 35°C.
[0048] Further preferably, the fermentation culture temperature is 30°C;
[0049] Preferably, the fermentation culture time is 5 days to 10 days.
[0050] Further preferably, the fermentation culture time is 6 days to 8 days.
[0051] Optionally, the method further includes the step of separating and purifying the esterase from the fermentation culture.
[0052] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0053] The Monascus purpureus M230701Z6Ib10a obtained in the present invention has high yield of esterase and is safe and non-toxic. It is preserved by the China Center for Type Culture Collection, and the preservation number is CCTCC No: M 20242077, and the preservation date is September 25, 2024. Monascus purpureus M230701Z6Ib10a has strong pH adaptability, temperature adaptability, and alcohol tolerance, and these characteristics make it suitable for industrial fermentation production.
[0054] The present invention discovers for the first time that adding exogenous additives (such as amino acids like cysteine and histidine) to the growth environment of Monascus purpureus M230701Z6Ib10a can significantly activate the secondary metabolic pathway of the strain and can significantly improve the esterase activity. This discovery provides a new technical idea for the efficient biosynthesis of esterase.
[0055] In addition, inoculating Monascus purpureus M230701Z6Ib10a into miscellaneous grains such as rice and sorghum can endow the miscellaneous grains with functional properties and increase the aroma of koji; fermenting wine with Monascus purpureus M230701Z6Ib10a can enrich the aroma levels of the wine and increase functional activity; fermenting tangerine peel with Monascus purpureus M230701Z6Ib10a can increase the total flavonoid content in the tangerine peel and improve its antioxidant activity, providing a new way for the value-added development of traditional Chinese medicinal materials. Brief Description of the Drawings
[0056] Figure 1 Colony morphologies of M230701Z6Ib10a cultured at a constant temperature of 30 °C for 7 days, 15 days, and 30 days in PDA medium.
[0057] Figure 2 Observation results of M230701Z6Ib10a under an optical microscope.
[0058] Figure 3 Phylogenetic tree of M230701Z6Ib10a constructed based on ITS sequencing.
[0059] Figure 4 Phylogenetic tree of M230701Z6Ib10a constructed based on β-tubulin sequencing.
[0060] Figure 5 ISSR amplification detection results of M230701Z6Ib10a with different primer pairs.
[0061] Figure 6 Comparison between red yeast rice of Monascus purpureus M230701Z6Ib10a and commercially available red yeast rice.
[0062] Figure 7 Red yeast sorghum of Monascus purpureus M230701Z6Ib10a.
[0063] Figure 8 Red yeast rice wine of Monascus purpureus M230701Z6Ib10a.
[0064] Figure 9 Comparison between red yeast tangerine peel of Monascus purpureus M230701Z6Ib10a and non-inoculated tangerine peel.
[0065] Figure 10 Comparison between red yeast tangerine peel beverage of Monascus purpureus M230701Z6Ib10a and non-inoculated tangerine peel beverage. Detailed Implementation Modes
[0066] The specific embodiments of the present invention will be described in detail below, but it should be understood that the protection scope of the present invention is not limited by the specific embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts belong to the protection scope of the present invention. The experimental methods described in the embodiments of the present invention are all conventional methods unless otherwise specified.
[0067] The culture medium formula and index determination method used in the present invention are as follows:
[0068] PD medium: 60 g of potatoes, 6 g of glucose, 300 mL of distilled water, sterilized at 121 °C for 30 min.
[0069] PDA medium: 60 g of potatoes, 6 g of glucose, 6 g of agar, 300 mL of distilled water, sterilized at 121 °C for 30 min.
[0070] Seed liquid medium: 50 g of glucose, 15 g of peptone, 2 g of NaNO3, 1 g of MgSO4·7H2O, 1.5 g of KH2PO4, supplemented with distilled water to 1000 mL, sterilized at 121 °C for 30 min.
[0071] Liquid medium: 50 g of glucose, 15 g of peptone, 2 g of NaNO3, 1 g of MgSO4·7H2O, 1.5 g of KH2PO4, supplemented with distilled water to 1000 mL, sterilized at 121 °C for 30 min.
[0072] Esterase determination method: Weigh 0.5 mL of crude enzyme extract, add 8.5 mL of pH = 6.5 phosphate buffer, and then add 0.5 mL of α -naphthyl acetate solution with a concentration of 0.006 mol / L, react at a constant temperature of 40 °C for 5 min, then add 0.5 mL of fast blue B salt solution with a mass fraction of 0.02% for color development, mix well, start timing after 30 s, and then add 0.5 mL of 1:1 hydrochloric acid solution, mix well until the color development is stable. Replace the enzyme solution with distilled water as a blank control. Measure the esterase at 530nm OD.
[0073] Determination of citrinin content: Refer to the national standard GB 5009.222-2016 "Determination of citrinin in foods".
[0074] Example 1
[0075] Screening of Monascus purpureus M230701Z6Ib10a
[0076] The strain of the present invention is selected from the Monascus strain library of Shenyang Agricultural University, and the strains in the library are all isolated from naturally fermented red yeast rice. The Monascus purpureus M230701Z6Ib10a of the present invention is obtained through primary screening and secondary screening. The specific steps are as follows:
[0077] 1. Primary screening of strains
[0078] Liquid fermentation is adopted to preliminarily screen Monascus strains with high esterase activity.
[0079] Activation of strains: Take out the preserved Monascus cake from the -80°C refrigerator for activation, and then place it in a PDA medium respectively, and incubate it at a constant temperature of 30°C for 7 days.
[0080] Preparation of spore suspension: Pick the spores on the surface of the PDA medium into sterile water to prepare a spore suspension with a spore concentration of 1×10 6 spores / mL.
[0081] Liquid fermentation method: Take 4 mL of each spore suspension and add it to 50 mL of the seed liquid medium. After culturing at 30°C and 180 r / min for 4 days, take 4 mL of the seed liquid and inoculate it into 50 mL of the liquid medium, and incubate it at a constant temperature of 30°C and 180 r / min for 7 days to obtain the fermented enzyme solution.
[0082] Determination of esterase activity: Take 0.5 mL of the fermented enzyme solution and measure the esterase activity at OD 530nm .
[0083] Result: 18 Monascus strains with an esterase activity of 60 U / mL are initially screened out.
[0084] 2. Secondary screening of strains
[0085] Solid-state fermentation is used to re-screen Monascus strains with high esterase activity. The seed liquids of the 18 Monascus strains obtained from the primary screening are subjected to solid-state fermentation culture.
[0086] Preparation of seed liquid: Add 4 mL of spore suspension to 50 mL of the seed liquid medium, and incubate it at a constant temperature of 30°C and 180 r / min for 4 days to obtain the seed liquid.
[0087] Solid-state fermentation method: Weigh 20 g of early indica rice and wash it with clear water until it is no longer turbid. Add 40 mL of water to the fermentation tank, soak the weighed early indica rice for 24 h, wash and drain the soaked rice, and sterilize it at 115°C for 20 min. After cooling, suck 10% of the seed liquid by mass for culture, and place it in a constant temperature incubator at 30°C for 7 days to obtain red yeast rice. It should be noted that soaking the weighed early indica rice for 24 h to 28 h can achieve the final effect.
[0088] Sample treatment: Grind 1.5 g of Monascus rice into powder to obtain rice powder. Take 1 g of rice powder, add 9 mL of phosphate buffer solution with pH = 6.5, mix evenly, and vortex for about 10 s to make it fully mixed. Then filter. Take 1.5 mL of the filtrate and centrifuge it at 3500 r / min for 10 min. The supernatant is the crude enzyme extract. Then measure its esterase activity and citrinin content.
[0089] Determination of citrinin content: Refer to the national standard GB 5009.222-2016 "Determination of citrinin in foods".
[0090] Results: The esterase activity of M230701Z6Ib10a was the highest, reaching 2294.22 U / g, and it did not produce citrinin. Therefore, the strain M230701Z6Ib10a was finally determined to be a high-quality strain with high esterase activity and no citrinin production.
[0091] Prepare a fermentation inoculant for the finally screened strain with high esterase activity and no citrinin production as follows: Inoculate the spore suspension of this strain into a liquid medium and culture it at 30 °C and 180 r / min for 4 d to obtain the fermentation inoculant of this strain. The concentration of the fermentation inoculant was measured to be 10 5 spores / mL.
[0092] Example 2
[0093] Morphological identification of Monascus purpureus M230701Z6Ib10a
[0094] Observation by plate culture method: Inoculate the activated M230701Z6Ib10a bacterial cake into PDA medium and incubate it at a constant temperature of 30 °C for 7 d, 15 d, and 30 d, and observe its colony morphology, color, and growth conditions.
[0095] Results: The colony of M230701Z6Ib10a on the 7th day was circular, with a diameter of 13-16 mm. The mycelium was orange, the edge was white, the center was convex, and the texture was felt-like; on the 15th day, the colony diameter of M230701Z6Ib10a was 39 mm - 41 mm, and the mycelium was orange-red with a complete edge; on the 30th day, the colony diameter of M230701Z6Ib10a was 44 mm - 47 mm, and the mycelium was red; during the entire observation period, the color of the PDA medium gradually changed from transparent to orange and finally to red ( Figure 1 )
[0096] Observation by optical microscope: Add an appropriate amount of distilled water to the plate and gently scrape off the mycelium and spores on the bacterial cake, etc. Aspirate 10 μL and drop it onto a glass slide, and use an optical microscope to observe the morphological characteristics of ascospores, ascocarps, etc.
[0097] Results: The hyphae of M230701Z6Ib10a are irregularly branched, transparent, with obvious oil droplets and cross septa; the ascocarp type is cleistothecium, and the ascocarp is spherical or oval. There are many asci scattered in the ascocarp, which are spherical, and each ascus contains ascospores. The ascospores are spherical or oval-shaped. Figure 2 )
[0098] Example 3
[0099] Molecular identification of Monascus purpureus M230701Z6Ib10a
[0100] DNA extraction: The hyphae of strain M230701Z6Ib10a were placed in PD medium and cultured on a constant temperature shaker at 32 °C and 120 r / min for 4 days, then filtered and dried at 60 °C. Take 0.1 g of hyphae and extract DNA with reference to the fungal genomic DNA kit (Shenyang Wanlei Company).
[0101] For the identification of this strain, ITS sequence and β-tubulin sequence were selected for analysis. The specific operations are as follows:
[0102] 1. ITS phylogenetic tree analysis
[0103] ITS sequence primers: ITS5 and ITS4 were used for PCR amplification.
[0104] The nucleotide sequence of ITS5 is: 5’-GGAAGTAAAAGTCGTAACAAGG-3’, denoted as SEQ ID NO.1.
[0105] The nucleotide sequence of ITS4 is: 5’-TCCTCCGCTTATTGATATGC-3’, denoted as SEQ ID NO.2.
[0106] Sequencing and identification: After the purified PCR products were sequenced by Shanghai Bioengineering Company, a phylogenetic analysis was further constructed for strain M230701Z6Ib10a and the type strain Figure 3 )
[0107] The ITS sequence of M230701Z6Ib10a is: CGAGGGCGGGTCCTTCGTGGGACCCAACCTCCCACCCGTGATTATTGTACCTCCTGTTGCTTCGGCGCGGCCCCCTGGGGCCCGCCGGAGACATCTTCTCGAACGCTGTCTTTGAAAAGGATTGCTGTCTGAGTAAACATACCAAATCGGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGC AGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACTGCCCCTCAAGCGCGGCTTGTGTGTTGGGCCGCCGTCCCCTGCGCCTCCGGGCAACGGGGACGGGCCCGAAAGGCAGTGGCGGCGCCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCAGTAGGTCGGGCCGGGGCCTTTGCCCTCTCCAACCTTTTTTTCCTTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAAAAGGCCGGAGGACA, denoted as SEQ ID NO.3.
[0108] Result: The homology between strain M230701Z6Ib10a and Monascus purpureus MN 156545.1 reached 99%, and strain M230701Z6Ib10a was identified as Monascus sp.
[0109] 2. Phylogenetic tree analysis of β-tubulin
[0110] β-tubulin sequence primers: Bt2a and Bt2b were used for PCR amplification of the Ben A region.
[0111] The nucleotide sequence of Bt2a is: 5'-GGTAACCAAATCGGTGCTGCTTTC-3', denoted as SEQ ID NO.4.
[0112] The nucleotide sequence of Bt2b is: 5'-ACCCTCAGTGTAGTGACCCTTGGC-3', denoted as SEQ ID NO.5.
[0113] Sequencing and identification: The purified PCR products were sent to Shanghai Bioengineering Co., Ltd. for sequencing, and a phylogenetic analysis was further constructed for strain M230701Z6Ib10a and the type strain ( Figure 4 ).
[0114] The β-tubulin sequence of M230701Z6Ib10a is: GGTAACCCCAAACGGTGCTGCTTTCTGGTATGTTATTCAGGCGATTGAACGATATGGAAGAACGCGTAGACCCCATTCCTGGTGGATGAGGTTCCAGCTGTTCTTTTGTTTTCTGGGTCCGAGTTTTTGCTGACTTGTTCTTTTATAGGCAGAACATCTCTGGTGAGCACGGCCTTGATGGCTCCGGTGTGTAAGTAGAAACCTTTTCCATCTATCTCAAGGCATTGTACAGGGTGTGAGGGGAAAAGGGGCATCAATGTCTAATGTGATAACAGCTACCATGGTACTTCCGACCTTCAGTTGGAGCGTATCAACGTTTACTTCAACGAGGTTCGTCCTGTGGTGGATTCCTATTCCAAGTAGAGCACCTTTCTGATAATTTCGATTAGGCCAGTGGTCAGAAGTACGTTCCTCGTGCCGTCCTGGTCGACCTCGAGCCCGGTACCATGGATGCCGTCCGTGCTGGTCCCTTCGGTGAACTTTTCCGCCCCGACAACTTCATCTTCG GCCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCACTAACCTTGAGGGGTA, denoted as SEQ ID NO.6.
[0115] Result: The homology between strain M230701Z6Ib10a and Monascus purpureus MN 229577.1 reached 99%, and strain M230701Z6Ib10a was identified as Monascus purpureus.
[0116] Example 4
[0117] ISSR fingerprint of Monascus purpureus M230701Z6Ib10a
[0118] ISSR is applicable to marking the differences within microbial populations. In this example, 8 ISSR primers were used to construct a fingerprint map for the strain M230701Z6Ib10a of the present invention.
[0119] Selection of primers: The 8 selected primers are all from the 100 ISSR primers published by Columbia University, numbered 816, 817, 836, 855, 857, 888, 889, and 890 respectively. The specific sequences are shown in Table 1.
[0120] PCR reaction system (total volume 25 μL): DNA 1.5 μL, primer 1.5 μL, dd H2O 9.5 μL, 2×TaqMaster Mix DNA polymerase 12.5 μL.
[0121] Amplification program: Pre-denaturation at 94°C for 5 min, denaturation at 94°C for 30 s, optimal annealing temperature for 45 s, a total of 35 cycles, and extension at 72°C for 7 min.
[0122] Construction of ISSR map: Prepare a 1.5% agarose gel by mass, take 5 μL of the PCR product for spotting and electrophoresis. The voltage is 100 V. Stop electrophoresis when the bromophenol blue dye band in the gel moves close to the end of the gel. Observe on a gel imaging system, take pictures and record. The obtained map is the DNA fingerprint map of the PCR product.
[0123] Results: After amplification of the strain of the present invention with 8 primers, the obtained fingerprint map is shown in Figure 5 .
[0124] The amplified map of primer 816 has 5 obvious bands, 2 bands are distributed in the range of 1000 - 2000 bp, and 3 bands are distributed in the range of 500 - 750 bp; primer 817 has 6 obvious bands, 1 band is at 1000 bp, and 5 bands are distributed in the range of 250 - 750 bp; primer 836 has a total of 6 clear bands, 2 bands are distributed in the range of 1000 - 2000 bp, and 4 bands are concentrated in the range of 250 - 750 bp; primer 855 has 2 clear bands, 1 band is distributed in the range of 1000 - 2000 bp with clear and bright band, and 1 band is distributed in the range of 500 - 750 bp; primer 857 has 3 clear bands, 2 bands are concentrated in the range of 750 - 1000 bp, and 1 band is at 500 bp; primer 888 has 5 clear bands, 2 bands are distributed in the range of 1000 - 2000 bp with clear and bright bands, and 3 bands are distributed in the range of 500 - 750 bp; primer 889 has 4 clear bands, among which 1 band at 1200 bp has the most prominent brightness, 1 band is at 1000 bp, and 2 bands are distributed in the range of 250 - 500 bp; primer 890 has 6 clear bands, 1 band at 1000 bp has prominent brightness, 1 band is at 2000 bp, and 4 bands are distributed in the range of 250 - 750 bp.
[0125] Table 1 Tested ISSR primers
[0126] Primer Sequence 816 CAC ACA CAC ACA CAC AT 817 CAC ACA CAC ACA CAC AA 836 AGA GAG AGA GAG AGA GYA 855 ACA CAC ACA CAC ACA CYT 857 ACA CAC ACA CAC ACA CYG 888 BDB CAC ACA CAC ACA CA 889 DBD ACA CAC ACA CAC AC 890 VHV GTG TGT GTG TGT GT
[0127] Note: Among them: Y = C or T, B = C, G or T, D = A, G or T, H = A, C or T, V = A, C or G.
[0128] Example 5
[0129] Effect of different exogenous additives on the ability of Monascus purpureus M230701Z6Ib10a to produce esterase
[0130] Through liquid fermentation and solid fermentation, the effects of exogenous addition on the ability of Monascus purpureus M230701Z6Ib10a to produce esterase were observed respectively.
[0131] Exogenous addition culture medium: Add 5 g / L of cysteine to the seed liquid of Monascus purpureus M230701Z6Ib10a, and incubate at a constant temperature of 30 °C for 4 d to obtain the first exogenous addition culture medium.
[0132] Add 5 g / L of histidine to the seed liquid of Monascus purpureus M230701Z6Ib10a, and incubate at a constant temperature of 30 °C for 4 d to obtain the second exogenous addition culture medium.
[0133] Liquid fermentation: Absorb 4 mL of exogenous additive culture medium I and 4 mL of exogenous additive culture medium II, and inoculate them into the liquid medium respectively for liquid fermentation. Incubate at a constant temperature of 30 °C for 7 days. Take 5 mL of the cultured fermentation broth and measure its esterase activity and citrinin content. The untreated fermentation broth is used as the CK control group.
[0134] Results: As shown in Table 2, after adding cysteine and histidine, the esterase activities are 246.55 U / mL and 163.95 U / mL respectively, which are 1 - 2 times that of the CK group (130.21 U / mL), and no citrinin is produced.
[0135] Add 5 g / L of glycine to the seed liquid of Monascus purpureus M230701Z6Ib10a, and incubate at a constant temperature of 30 °C for 4 days to obtain exogenous additive culture medium III.
[0136] Solid - state fermentation: Absorb 2 mL of exogenous additive culture medium I, 2 mL of exogenous additive culture medium II, and 2 mL of exogenous additive culture medium III, and inoculate them into 20 g of early indica rice respectively. Incubate at a constant temperature of 30 °C for 7 days. Then grind them into powder and measure their esterase activity and citrinin content. The untreated rice powder is used as the CK control group.
[0137] Results: As shown in Table 3, after adding cysteine, glycine, and histidine, the esterase activities are 3024.71 U / g, 2950.45 U / g, and 2911.04 U / g respectively, which are 1 times that of the CK group (2294.22 U / g), and no citrinin is produced.
[0138] Table 2 Effects of different exogenous additives on the esterase activity and citrinin of Monascus purpureus M230701Z6Ib10a strain in liquid fermentation
[0139] Types of exogenous additives Esterase U / mL Citrinin μg / mL CK 130.21 0 Cysteine 246.55 0 Histidine 163.95 0
[0140] Table 3 Effects of different exogenous additives on the esterase activity and citrinin of Monascus purpureus M230701Z6Ib10a strain in solid - state fermentation
[0141] Types of exogenous additives Esterase U / g Citrinin μg / mL CK 2294.22 0 Cysteine 3024.71 0 Glycine 2950.45 0 Histidine 2911.04 0
[0142] Example 6
[0143] pH adaptability of Monascus purpureus M230701Z6Ib10a strain
[0144] Take 10 μL of the spore suspension of Monascus purpureus M230701Z6Ib10a and inoculate it into PD media with pH values of 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, and 8.0. Incubate at a constant temperature of 30 °C and 180 r / min, then perform suction filtration and weigh the mycelium weight.
[0145] Result: Monascus purpureus M230701Z6Ib10a has strong adaptability to pH value and can grow in both strong acid fermentation environment and weak base fermentation environment (Table 4).
[0146] Table 4 Effect of pH value on the growth of Monascus purpureus M230701Z6Ib10a in fermentation
[0147] pH value Macroscopic morphology Growth amount g 2 ± 1.4 3 + 2.0 4 ++ 3.4 5 +++ 4.5 6 +++ 4.9 7 ++ 3.7 8 ± 1.0
[0148] Note: "-" means no growth; "±" means slight growth; "+" means average growth; "++" means good growth; "+++" means vigorous growth; the volume of the sample for measuring the growth amount is 30 mL.
[0149] Example 7
[0150] Temperature adaptability of Monascus purpureus M230701Z6Ib10a strain
[0151] Determination of the growth amount of the strain: Take 10 μL of the spore suspension of Monascus purpureus M230701Z6Ib10a and inoculate it into PD medium. The PD medium is placed at temperatures of 15°C, 20°C, 25°C, 30°C, 35°C, 40°C, 45°C, and 50°C respectively, and is cultured with constant temperature oscillation at 180 r / min. Then, suction filtration is carried out and the weight of the mycelium is weighed.
[0152] Determination of the colony diameter: Take 10 μL of the spore suspension of Monascus purpureus M230701Z6Ib10a and inoculate it into PAD medium. The PDA medium is placed at 15°C, 20°C, 25°C, 30°C, 35°C, 40°C, 45°C, and 50°C respectively under constant temperature static culture, and then the colony diameter is measured.
[0153] Result: The M230701Z6Ib10a strain can grow under the conditions of 15°C to 45°C, and has strong temperature adaptability (Table 5).
[0154] Table 5 Effect of temperature on the growth of Monascus purpureus M230701Z6Ib10a in fermentation
[0155]
[0156]
[0157] Note: "-" means no growth; "±" means slight growth; "+" means average growth; "++" means good growth; "+++" means vigorous growth, " / " means negligible; the volume of the sample for measuring the growth amount is 30 mL.
[0158] Example 8
[0159] Alcohol Tolerance of Monascus purpureus M230701Z6Ib10a Strain
[0160] Determination of strain growth: Take 10 μL of the spore suspension of Monascus purpureus M230701Z6Ib10a and inoculate it into PD media with alcohol volume concentrations of 8%, 10%, 12%, 15%, 18%, and 20% respectively. Place the PD media in a constant temperature incubator at 30 °C and 180 r / min for incubation. Then, perform suction filtration and weigh the mycelium weight.
[0161] Determination of colony diameter: Take 10 μL of the spore suspension of Monascus purpureus M230701Z6Ib10a and inoculate it into PDA media with alcohol volume concentrations of 8%, 10%, 12%, 15%, 18%, and 20% respectively. Place it in a constant temperature static incubator at 30 °C for incubation, and then measure the colony diameter.
[0162] Results: Monascus purpureus M230701Z6Ib10a can grow within the range of alcohol content ≤ 18%, and it has strong tolerance to alcohol (Table 6).
[0163] Table 6 Effects of Alcohol Concentration on the Growth of Fermented Monascus purpureus M230701Z6Ib10a
[0164] Alcohol concentration % Macroscopic morphology Growth amount g Colony diameter cm 8 +++ 4.5 2.77 10 +++ 4.1 2.36 12 ++ 3.0 1.73 15 + 2.1 0.94 18 ± 0.3 - 20 - / -
[0165] Note: "-" indicates no growth; "±" indicates slight growth; "+" indicates average growth; "++" indicates good growth; "+++" indicates vigorous growth; the volume of the samples for growth measurement is 30 mL.
[0166] Example 9
[0167] Preparation of High Esterase Red Koji Rice Using M230701Z6Ib10a
[0168] Preparation of red koji rice: Weigh 20 g of high-quality early indica rice, wash it with clear water, add 40 mL of water to the fermentation tank, soak it, drain it, and sterilize it at 115 °C for 20 min. After cooling, suck 10% (by volume) of the fermentation inoculum of Monascus purpureus M230701Z6Ib10a based on the weighed 20 g of high-quality early indica rice and place it in the fermentation tank. Stir well to evenly distribute the seed liquid on the rice grains. Seal the fermentation tank and place it in a constant temperature incubator at 30 °C for 7 d to obtain red koji rice.
[0169] Sample preparation: Grind 1.5 g of Monascus rice into powder. Take 1 g of the rice powder and add it to 9 mL of phosphate buffer solution with pH = 6.5, mix well, and vortex for about 10 s to ensure thorough mixing. Then filter. Take 1.5 mL of the filtrate and centrifuge it at 3500 r / min for 10 min. The supernatant is the crude enzyme extract. Subsequently, determine its esterase activity, citrinin content, and conduct a sensory evaluation of the Monascus rice.
[0170] Results: The esterase activity of Monascus purpureus M230701Z6Ib10a was 2674.62 U / g, and there was no citrinin, while the esterase activity of commercially available Monascus rice was 1795.61 U / g.
[0171] A sensory evaluation of the Monascus rice of Monascus purpureus M230701Z6Ib10a found that the Monascus rice of Monascus purpureus M230701Z6Ib10a was bright red in color, the rice grains were intact and there were no visible impurities to the naked eye, there was no obvious adhesion between the grains, and there was a slight fermentation aroma ( Figure 6 )
[0172] Example 10
[0173] Preparation of high-esterase Monascus sorghum using M230701Z6Ib10a
[0174] Preparation of Monascus sorghum rice: Weigh 20 g of sorghum rice, wash it, add 40 mL of water to the fermentation tank, soak it, drain it, and sterilize it at 115 °C for 20 min. After cooling, pipette 10% (by volume) of the fermentation inoculum of Monascus purpureus M230701Z6Ib10a based on the weighed 20 g of sorghum rice into the fermentation tank, and place it in a constant temperature incubator at 30 °C for 7 d to obtain Monascus sorghum.
[0175] Determination method: Grind the Monascus sorghum into powder. The sample preparation and index determination are the same as in Example 9.
[0176] Results: The esterase activity of Monascus purpureus M230701Z6Ib10a was 2044.16 U / g, and there was no citrinin.
[0177] A sensory evaluation of the Monascus sorghum of Monascus purpureus M230701Z6Ib10a found that the Monascus sorghum of Monascus purpureus M230701Z6Ib10a was orange-red in color, the rice grains were intact, the texture was crispy, there was no obvious adhesion between the grains, and there was a slight fermentation koji aroma ( Figure 7 )
[0178] Example 11
[0179] Preparation of high-esterase Monascus wine using M230701Z6Ib10a
[0180] Preparation method of red yeast rice wine: Weigh 20 g of early indica rice and put it into a conical flask, and wash it 3 - 4 times with clear water until it is no longer turbid. Add 40 mL of water to soak until the rice fully absorbs water. Wash and drain the soaked rice, sterilize it at 115 °C for 20 min, and cool it to room temperature. Add 40 mL of sterile distilled water, the red yeast rice in Example 9 accounting for 10% of the volume of the weighed 20 g of early indica rice, and 0.72% glucoamylase (Shanghai Xintai, food grade), place it in a constant temperature incubator at 30 °C and seal it for cultivation for 7 d, and shake the wine liquid every 12 h during this period. Squeeze and filter the fermented wine liquid, fry the wine in a constant temperature water bath at 80 °C for 15 min. After complete sedimentation, take the supernatant and transfer it to a sterile storage bottle and seal it, and store it at 4 °C.
[0181] Determination method: Take an appropriate amount of wine liquid to measure relevant indicators such as red yeast pigment, citrinin, reducing sugar content, total acid content, alcohol content, etc., and conduct a sensory evaluation of the wine liquid. The determination of relevant indicators refers to the national standards GB 1886.19 - 2015 "Food Additive Red Yeast Rice", GB 5009.222 - 2016 "Determination of Citrinin in Foods", QB 5334 - 2019 "Red Yeast Rice Wine" and GB 13662 - 2018 "Yellow Rice Wine" respectively.
[0182] Results: The pigment content of the red yeast rice wine fermented by Monascus purpureus M230701Z6Ib10a is 6.996 U / mL, the reducing sugar content is 23.12 g / L, the total acid content is 5.67 g / L, the alcohol content is 11.5%, and no citrinin is generated.
[0183] The sensory evaluation of the red yeast rice wine fermented by Monascus purpureus M230701Z6Ib10a found that the red yeast rice wine fermented by Monascus purpureus M230701Z6Ib10a has a light orange color, natural and pure color, clear and transparent; the red yeast rice wine has the aroma of red yeast rice and fruits and no any strange smell, and the aroma of the wine is rich in layers; the red yeast rice wine has a soft and smooth taste, slightly sweet and mellow, and the wine body is harmonious ( Figure 8 ).
[0184] Example 12
[0185] Preparation of red yeast rice tangerine peel fermented by Monascus purpureus M230701Z6Ib10a
[0186] Tangerine peel is one of the traditional Chinese medicines, which has the effects of regulating qi and strengthening the spleen, relieving cough and resolving phlegm, antioxidant, anti - inflammatory, etc. Generally, consumers obtain the active substances in tangerine peel by brewing it. As a fungus with both medicinal and edible uses, the enzyme system metabolized by Monascus can catalyze the synthesis of fruity esters. Fermenting tangerine peel with Monascus can not only significantly increase the content of functional components in tangerine peel, but also endow tangerine peel with the unique aroma of Monascus.
[0187] Method for fermenting tangerine peel: Weigh 5 g of tangerine peel and put it into a fermentation tank. Rinse it 3 - 4 times with clean water, then drain it, and sterilize it at 115 °C for 20 min. After cooling to room temperature, add a fermentation inoculum of Monascus purpureus M230701Z6Ib10a with a volume fraction of 10% based on the 5 g of weighed tangerine peel into the fermentation tank. Incubate it in a constant temperature incubator at 30 °C for 7 d, shake it once every 12 h during this period, and dry it at 40 °C for 4 h to obtain Monascus - fermented tangerine peel.
[0188] Determination of Monascus - fermented tangerine peel: Take an appropriate amount of Monascus - fermented tangerine peel for the determination of related indexes such as esterifying enzyme, citrinin, total flavonoids, and antioxidant activity, and conduct a sensory evaluation. The following are the specific operation methods:
[0189] Determination method of total flavonoids: Crush the Monascus - fermented tangerine peel sample and sieve it. Weigh about 0.1 g of the powder, add 5 mL of ethanol with a volume fraction of 70%, heat it in a water bath for 1 h, centrifuge it at 8000 r for 5 min, and collect the supernatant. Measure 0.5 mL of the test solution, add 1 mL of 5% (mass fraction) NaNO2, shake well, and let it stand for 6 min. Add 1 mL of 10% (mass fraction) Al(NO3)3, shake well, and let it stand for 6 min. Finally, add 5 mL of 4% (volume fraction) NaOH, make up the volume with ethanol with a volume fraction of 70%, shake well, and let it stand for 15 min. Measure its absorbance at a wavelength of 510 nm and calculate the total flavonoid content in mg / g.
[0190] Determination of DPPH free radical scavenging ability: After centrifuging the fermentation broth, take the supernatant, dilute it 10 times with distilled water, take 0.3 mL, add 3.7 mL of DPPH solution with a concentration of 1.0×10 -4 mol / L, mix well, react in the dark at room temperature for 20 min, centrifuge it at 8000 r / min for 5 min, take the supernatant and measure its absorbance at a wavelength of 517 nm, and calculate the DPPH free radical scavenging rate.
[0191] Results: The esterifying enzyme of the Monascus - fermented tangerine peel fermented by Monascus purpureus M230701Z6Ib10a is 443.75 U / g, and the total flavonoid content is 13.79 mg / g, which is 2.2 times that of the non - inoculated tangerine peel (6.31 mg / g), and there is no citrinin. The results show that the tangerine peel fermented by Monascus M230701Z6Ib10a not only contains the aroma of Monascus, but also significantly increases the total flavonoid content in the tangerine peel. In addition, the addition of Monascus purpureus M230701Z6Ib10a can improve the antioxidant ability of the tangerine peel, and its DPPH free radical scavenging rate can reach 81.40%, which is 1.8 times that of the non - inoculated tangerine peel (45.62%) (Table 7).
[0192] Sensory evaluation of the red yeast rice and tangerine peel fermented by Monascus purpureus M230701Z6Ib10a found that the red yeast rice and tangerine peel fermented by Monascus purpureus M230701Z6Ib10a were dark brown in color, brittle in texture, and had the aroma of fermented red yeast rice and the fresh fragrance of tangerine peel( Figure 9 ).
[0193] Table 7 Comparison of pigment content, total flavonoids, and antioxidant activity between fermented tangerine peel and unfermented tangerine peel
[0194] Group Esterase U / g Total flavonoid content mg / g DPPH free radical scavenging rate % Unfermented tangerine peel 0 6.31 45.62 Fermented tangerine peel 44.375 13.79 81.40
[0195] Example 13
[0196] Preparation of red yeast rice and tangerine peel beverage fermented by Monascus purpureus M230701Z6Ib10a
[0197] Preparation and determination of red yeast rice and tangerine peel beverage: Take 1.5 g of fermented tangerine peel and unfermented tangerine peel respectively, add 13.5 mL of normal temperature pure water for brewing. After brewing for 10 min, take 1 mL of the beverage of fermented tangerine peel and unfermented tangerine peel respectively, and compare the color, total flavonoid content, and antioxidant activity of the beverage (see Example 12 for specific operations).
[0198] Results: The content of esterifying enzyme in the red yeast rice and tangerine peel beverage fermented by Monascus purpureus M230701Z6Ib10a was 8.15 U / mL, and the total flavonoid content (6.12 mg / g) was 1.7 times that of the un-inoculated beverage (3.67 mg / g), and no citrinin was produced. In addition, the DPPH free radical scavenging rate of the fermented beverage was 64.54%, which was 1.5 times that of the un-inoculated beverage (39.21%). The results showed that the beverage fermented by Monascus M230701Z6Ib10a also had high antioxidant activity (Table 8).
[0199] Sensory evaluation of the red yeast rice and tangerine peel beverage fermented by Monascus purpureus M230701Z6Ib10a found that the red yeast rice and tangerine peel beverage fermented by Monascus purpureus M230701Z6Ib10a was brownish-yellow in color and had the aroma of tangerine peel and a unique aroma of koji( Figure 10 ). In addition, the red yeast rice and tangerine peel beverage (liquid) was prepared into a solid powder of red yeast rice and tangerine peel by dry spraying, and then brewed. The beverage had good solubility, smooth taste, and the fresh fragrance of tangerine peel and the aroma of koji.
[0200] Table 8 Comparison of pigment content, total flavonoids, and antioxidant activity between fermented tangerine peel beverage and unfermented tangerine peel beverage
[0201] Group Esterase U / mL Total flavonoid content mg / g DPPH free radical scavenging rate % Unfermented tangerine peel beverage 0 3.67 39.21 Fermented tangerine peel beverage 8.15 6.12 64.54
[0202] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that any value between the two endpoints of each numerical range and the two endpoints can be selected. To prevent repetition, preferred embodiments of the present invention are described.
[0203] Although the preferred embodiments of the present invention have been described, additional changes and modifications can be made by those skilled in the art once they learn of the basic inventive concept. Therefore, the appended claims are intended to be construed to include the preferred embodiments as well as all changes and modifications that fall within the scope of the present invention.
[0204] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention is also intended to include these modifications and variations.
Claims
1. A purple Monascus strain with high esterase activity ( Monascus purpureus )M230701Z6Ib10a, preserved by China Center for Type Culture Collection, the preservation number is CCTCC No: M 20242077, and the preservation date is September 25, 2024.
2. A fermentation agent, characterized in that: It includes the Monascus purpurogenum M230701Z6Ib10a described in claim 1.
3. The fermentation agent according to claim 2, characterized in that: The microbial preparation is a liquid preparation or a solid preparation.
4. The fermentation agent according to claim 2, characterized in that: The preparation method of the fermentation agent is as follows: fermenting the spore suspension of the purple Monascus to a concentration of 10 4 Spores / mL~10 6 spores / mL to obtain the fermentation agent.
5. Use of the purple Monascus according to claim 1 or the fermentation agent according to claim 2 in the preparation of fermentation products.
6. The use according to claim 5, characterized in that: The fermented products are cereal products, bean products, Chinese medicinal materials products, wine products and beverage products.
7. The use according to claim 6, characterized in that: The bean product is red yeast rice or red yeast sorghum; The Chinese herbal medicine product is red yeast rice and tangerine peel; The wine product is red yeast rice wine.
8. The use according to claim 5, characterized in that: The method for preparing the fermented food comprises the following steps: sterilizing the product to be fermented, adding the fermentation agent, and culturing at 25° C. to 30° C. for 5 to 10 days to obtain the fermented product; The material-liquid ratio of the food to be fermented to the fermentation bacteria agent is 8-12:
1.
9. A method for promoting the production of esterase by the purple Monascus according to claim 1, characterized in that: Using amino acid additives to perform liquid fermentation on the seed liquid of the purple Monascus; The amount of the amino acid additive is 3 g / L to 8 g / L; The amino acid additive is at least one of cysteine, histidine and glycine.
10. The method according to claim 9, characterized in that The fermentation temperature is 25°C to 30°C, and the fermentation time is 5 to 10 days.