Composite active component, antagonistic antibacterial agent and application of antagonistic antibacterial agent in prevention and treatment of postharvest soft rot of kiwi fruits
By combining the yeast yeast with saccharomyces Y3, Bacillus J6 and Frucsakeria cows in a specific proportion, the complex active ingredients are formed, and the antagonism problem during the complexation of various microorganisms is solved, and the efficient antibacterial inhibition of the saccharomyces is achieved, effectively preventing and treating soft rot after harvest of kiwi fruit.
Patent Information
- Application Number
- CN202510463742.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-14
- Publication Date
- 2025-06-24
AI Technical Summary
In the prior art, due to different morphological and physiological and biochemical characteristics of various microorganisms, antagonistic effects are easily produced when complexed, resulting in a decrease in the antibacterial performance of the antagonist after complex, and it is impossible to effectively prevent and treat plant diseases.
The complex active ingredient was formed according to a specific mass ratio by using yeast syrup, Bacillus J6 and Coxsakeria cows. The three strains did not have antagonistic effects on each other, and synergistically increased the antibacterial rate of the saccharomyces.
It has achieved excellent antibacterial effect on the gizzard cavity bacteria, significantly improved the prevention and treatment effect of kiwi fruit post-harvest soft rot, and reduced the incidence of disease.
Smart Images

Figure CN120192859A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of microorganisms and their applications, and relates to a composite active ingredient, an antagonistic bactericide and their applications in the prevention and control of postharvest soft rot of kiwifruit. Background Art
[0002] Kiwifruit is a perennial dioecious vine native to China, Japan, Korea and other countries. Due to its rich nutritional value and various health benefits, it has become a popular fruit globally. Shaanxi is the main production area of kiwifruit in China, and Cuixiang kiwifruit is an important variety of kiwifruit in China. However, kiwifruit is susceptible to various diseases before and after harvest. Postharvest soft rot of kiwifruit is one of the main diseases affecting the fruit quality of kiwifruit, mainly caused by Botryosphaeria dothidea. This disease has caused a serious economic decline in the kiwifruit industry.
[0003] Currently, the prevention and control measures for postharvest soft rot of kiwifruit mainly rely on chemical control. Referring to the reference "Evaluation of the Control Effects of Different Fungicides on the Soft Rot Pathogen of Kiwifruit", the indoor toxicity of 8 fungicides against the soft rot pathogen Botryosphaeria dothidea of kiwifruit was evaluated, and all the fungicides used were chemical fungicides. Although chemical fungicides have a relatively low cost and are relatively convenient to operate, and have a certain degree of control effect on postharvest soft rot of kiwifruit, long-term use of chemical fungicides will cause the pathogen to develop drug resistance, resulting in an increasing dosage of the drug and an increase in the residue of chemical fungicides on the fruit. In addition, physical control also accounts for a certain proportion in controlling postharvest soft rot of kiwifruit. Although physical control (such as low-temperature storage) can weaken the respiration intensity of the fruit, delay ripening and senescence, and prevent postharvest soft rot of kiwifruit, during the low-temperature storage process, when the storage temperature is lower than the temperature control range of the fruit itself, it will cause low-temperature injury, i.e., chilling injury, to the fruit, and thus have a certain degree of impact on the nutritional quality of the fruit. Therefore, it is necessary to find new ways to prevent and control the postharvest soft rot disease of kiwifruit.
[0004] In recent years, biological control of plant diseases has become a new research hotspot. Biological control is a control method that uses beneficial organisms or other organisms to inhibit or eliminate harmful organisms, which is the result of the interaction between species. The characteristics of biological control are that the control effect is lasting and stable, there is no drug resistance, no pollution, and no harm to fruits. As a kind of microorganism in biological control, antagonistic bacteria mainly compete with pathogenic bacteria through antagonistic action, thereby inhibiting the growth of pathogenic bacteria. At the same time, they induce the activity of related enzymes in fruits, further enhancing the disease resistance of fruits, making them more dominant in the biological control of plant diseases. However, in the existing biological control technologies, most use a single microorganism for control, resulting in a single control effect and poor control effect. Multiple microorganisms can inhibit pathogenic bacteria in different ways, have good colonization ability and antibacterial effect. But when using multiple microbial strains in combination for control, due to the different morphological, physiological and biochemical characteristics of each microbial strain, antagonistic effects are likely to occur between each microorganism, resulting in a decline in the antibacterial performance of the combined antagonistic bactericide and unable to play a good role in controlling plant diseases. Therefore, it is necessary to find multiple strains that do not have antagonistic effects on each other to prepare a composite antagonistic bacterium. Summary of the Invention
[0005] Aiming at the technical problem in the above-mentioned existing technology that when multiple microorganisms are combined, due to the different morphological, physiological and biochemical characteristics of each microorganism, antagonistic effects will occur between each microorganism, resulting in a decline in the antibacterial performance of the combined antagonistic bactericide and unable to play a good role in controlling plant diseases, the present invention provides a composite active ingredient, an antagonistic bactericide and its application in the control of postharvest soft rot of kiwifruit.
[0006] The present invention uses Hanseniaspora uvarum Y3, Bacillus sp. J6 and Kosakonia cowanii K9 to form a composite active ingredient according to a specific mass ratio. The three strains do not produce antagonistic effects on each other and can synergistically improve the antibacterial rate against Botryosphaeria dothidea, and have excellent control effects on postharvest soft rot of kiwifruit.
[0007] In order to achieve the above object, the technical solution adopted by the present invention is:
[0008] A composite active ingredient, the composite active ingredient includes at least two or more of Hanseniaspora uvarum Y3, Bacillus sp. J6 and Kosakonia cowanii K9; the mass ratio of Hanseniaspora uvarum Y3, Bacillus sp. J6 and Kosakonia cowanii K9 is (0-3):(0-3):(0-3).
[0009] Further defined, the Hanseniaspora sp. Y3 has the Latin name Hanseniaspora sp. Y3 and was deposited on February 19, 2025 at the China Center for Type Culture Collection (address: Wuhan University, Wuhan, China), with the deposit number CCTCC M 2025252.
[0010] Further defined, the Kosakonia cowanii K9 has the Latin name Kosakonia cowanii K9 and was deposited on February 19, 2025 at the China Center for Type Culture Collection (address: Wuhan University, Wuhan, China), with the deposit number CCTCC M 2025253.
[0011] Further defined, the Bacillus sp. J6 has the Latin name Bacillus sp. J6 and was deposited on February 19, 2025 at the China Center for Type Culture Collection (address: Wuhan University, Wuhan, China), with the deposit number CCTCC M 2025254.
[0012] Further defined, the 18S rRNA sequence of the Hanseniaspora sp. Y3 is as shown in SEQ No. 1; the 16S rDNA sequence of the Bacillus sp. J6 is as shown in SEQ No. 2; the 16S rDNA sequence of the Kosakonia cowanii K9 is as shown in SEQ No. 3.
[0013] Further defined, the application of the said composite active ingredient in preventing and controlling postharvest soft rot of kiwifruit.
[0014] An antagonistic bactericide includes an active substance and a wettable powder. The active substance is the said composite active ingredient. The wettable powder includes a filler, a wetting agent, a dispersant and a stabilizer. The mass fraction of the active substance is 15% - 25%, the mass fraction of the filler is 65% - 77.5%, the mass fraction of the wetting agent is 3% - 5%, the mass fraction of the dispersant is 3% - 5%, and the mass fraction of the stabilizer is 1.5% - 2.5%.
[0015] Further defined, the filler is diatomaceous earth, bentonite or white carbon black; the wetting agent is sodium dodecyl sulfate or Tween - 80; the dispersant is CMC - Na, NNO, polyethylene glycol or polyaspartic acid; the stabilizer is tert - butylhydroquinone, vitamin E or potassium dihydrogen phosphate.
[0016] Further defined, the application of the said antagonistic bactericide in preventing and controlling postharvest soft rot of kiwifruit.
[0017] 1. Three antagonistic strains were screened from healthy kiwifruit fruits. There is no antagonistic effect among the three antagonistic strains, and they can form a composite active ingredient in a certain proportion. Through research, the composite active ingredient has excellent antibacterial effect on Botryosphaeria dothidea and can be used for the prevention and control of postharvest soft rot of kiwifruit.
[0018] 2. Through research, it is found that in the composite active ingredient, when the proportions of strain Y3 and strain J6 are relatively large, a higher antibacterial rate can be obtained. Especially when the ratio of Y3:J6:K9 is 2:1:1, the antibacterial rate reaches the highest of 54.9%, and at this time, the antibacterial effect on Botryosphaeria dothidea is the best.
[0019] 3. The present invention uses the composite active ingredient and wettable powder to form an antagonistic bactericide, which can greatly reduce the incidence of postharvest soft rot of kiwifruit and provide a new method for the prevention and control of postharvest soft rot of kiwifruit. Description of the Drawings
[0020] Figure 1 It is the comparison result of the phylogenetic tree of strain Y3;
[0021] Figure 2 It is the comparison result of the phylogenetic tree of strain J6;
[0022] Figure 3 It is the comparison result of the phylogenetic tree of strain K9;
[0023] Figure 4 It is the colony plate diagram of the three strains;
[0024] Figure 5 It is the growth curves of the three antagonistic bacteria;
[0025] Figure 6 It is the influence of different carbon sources on the concentrations of J6 and K9;
[0026] Figure 7 It is the influence of different nitrogen sources on the concentrations of J6 and K9;
[0027] Figure 8 It is the influence of different yeast media on the concentration of Y3
[0028] Figure 9 It is the antibacterial effect diagram of strain Y3, strain J6, and strain K9;
[0029] Figure 10 It is the antagonistic result among the three strains;
[0030] Figure 11 It is the influence of different materials on the suspension rate of the bactericide;
[0031] Figure 12 It is the influence of different materials on the wetting time of the bactericide;
[0032] Figure 13 Effect of different materials on viable count of microbial inoculum
[0033] Figure 14 Picture of control effect of antagonistic bacteria on fruits Specific implementation mode
[0034] The technical solutions of the present invention will be further described below with reference to the accompanying drawings and embodiments
[0035] Unless otherwise defined, the technical terms or scientific terms used in the present invention shall have the ordinary meanings understood by those of ordinary skill in the art to which the present invention belongs
[0036] For technologies, methods and equipment known to those of ordinary skill in the relevant fields, they may not be discussed in detail, but under appropriate circumstances, the said technologies, methods and equipment should be regarded as part of the specification
[0037] It should also be understood that the specific embodiments described above are only used to explain the present invention, and the protection scope of the present invention is not limited thereto. Any person skilled in the art within the technical scope disclosed by the present invention, according to the technical solutions and inventive concepts of the present invention, makes equivalent substitutions or changes, and should be covered within the protection scope of the present invention
[0038] Example 1
[0039] The purpose of this example is to screen and identify three strains of antagonistic bacteria from healthy kiwifruit fruits
[0040] 1.1 Screening of antagonistic strains
[0041] 1) Pick healthy kiwifruit fruits from orchards in Zhouzhi County, Xi'an City, Shaanxi Province
[0042] 2) Disinfect the surface of the kiwifruit fruits, rinse them thoroughly, and then put them into phosphate buffer solution and ultrasonically clean for 30 min to obtain a washing solution
[0043] 3) Dilute the washing solution to a concentration of 1×10 7 cfu / mL and then coat it on LB medium and PDA medium respectively, and culture for 3 - 4 days
[0044] 4) Take the bacteria on the edge of the colonies after the above culture and inoculate them on the above two media (LB medium and PDA medium) respectively to obtain single colonies; and place the LB medium in a constant temperature incubator at 37°C for culture, and place the PDA in a constant temperature incubator at 28°C for culture
[0045] 5) Rinse the cultured plate with sterile water to obtain a bacterial suspension, and adjust its concentration to 1×10 7 cfu / mL
[0046] 6) Use a 5-mm punch to punch a hole in the center of the flat plate. Add 5 μL of the spore suspension of the pathogenic bacterium (Botryosphaeria dothidea, denoted as pathogenic bacterium P) into the hole. After 2 h, add 5 μL of the bacterial suspension. The CK group adds 5 μL of sterile water. Observe the growth of the pathogenic bacterium after culturing for 5 days, and screen out three colonies with obvious antibacterial effects on pathogenic bacterium P, namely antagonistic strains, denoted as strain Y3, strain J6, and strain K9 in sequence; and conduct identification respectively.
[0047] 1.2 Identification of strains
[0048] 1.2.1 Determination of the nucleotide sequence of the strain
[0049] (1) Identification of strain Y3
[0050] Entrust Shanghai Sangon Biotech Co., Ltd. to determine the 18S rRNA gene sequence of strain Y3, conduct a homology comparison of the sequencing results in the GenBank nucleic acid database, and complete the identification in combination with morphology.
[0051] In this example, PCR amplification was used for strain Y3 for sequencing.
[0052] The primers used for PCR amplification are as follows:
[0053] ITS1: TCCGTAGGTGAACCTGCGG;
[0054] ITS4-R: TCCTCCGCTTATTGATATGC.
[0055] The reaction system for PCR amplification is as follows: 10×PCR Buffer Mix 12.5 μL, Template 1 μL, 1 μL of each forward and reverse primer, and make up to 25 μL with ddH2O.
[0056] The procedure for PCR amplification is: 95 °C, 5 min, 94 °C, 30 s, 57 °C, 30 s, 72 °C, 90 s, for 30 cycles; extension at 72 °C for 10 min; finally keep warm at 4 °C.
[0057] After PCR amplification and sequencing, an 18S rRNA nucleotide sequence fragment with a length of about 720 bp was obtained. The specific sequence is as follows:
[0058] ACTGCGGAAGGATCATTAGATTGAATTATCTTGTTGCTCGAGTTCtTGTT
[0059] TAGATCTTTTACAATAATGTGTATCTTTATTGGAGATGTGCGCTTAATTGCGC
[0060] TGCTTCATTAGAGTGTCGCAGTAGAAGTAGTCTTGCTTGAATCTCAGTCAA
[0061] CGTTTACACACATTGGAGTTTTTTACTTTAATTTAATTCTTTCTGCTTTGAAT
[0062] CGAAAGGTTCAAGGCAAAAAACAAACACAAACAATTTTATTTTATTATAAT
[0063] TTTTTAAACTAAACCAAAATTCCTAACGGAAATTTTAAAATAATTTAAAACT
[0064] TTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCGAATTG
[0065] CGATAAGTAATGTGAATTGCAGATACTCGTGAATCATTGAATTTTTGAACGC
[0066] ACATTGCGCCCTTGAGCATTCTCAAGGGCATGCCTGTTTGAGCGTCATTTC
[0067] CTTCTCAAAAGATAATTTTTTATTTTTTGGTTGTGGGCGATACTCAGGGTTA
[0068] GCTTGAAATTGGAGACTGTTTCAGTCTTTTTTAATTCAACACTTAGCTTCTT
[0069] TGGAGACGCTGTTCTCGCTGTGATGTATTTATGGATTTATTCGTTTTACTTTA
[0070] CAAGGGAAATGGTAATGTACCTTAGGCAAAGGGTTGCTTTTAATATTCATC
[0071] AAGTTGACCTCAAATCAGTAGGATTACCCGCTGAACTTAAGCATATCA
[0072] (2) Sequencing of Strains J6 and K9
[0073] The 16S rDNA sequences of strains J6 and K9 were determined by Shanghai Sangon Biological Engineering Co., Ltd. The sequencing results were subjected to homology alignment in the GenBank nucleic acid database, and the identification was completed in combination with morphology.
[0074] In this example, the primers for PCR amplification are as follows:
[0075] 27F: AGAGTTTGATCMTGGCTCAG;
[0076] 1492R: GGTTACCTTGTTACGACTT.
[0077] The reaction system for PCR amplification: 12.5 μL of 10×PCR Buffer Mix, 1 μL of Template, 1 μL of each forward and reverse primer, and made up to 25 μL with ddH2O.
[0078] The PCR amplification program is: 95°C for 5 min, 94°C for 30 s, 57°C for 30 s, 72°C for 90 s, for 30 cycles; extension at 72°C for 10 min; finally incubated at 4°C.
[0079] In this example, strain J6 was amplified and sequenced to obtain a 16S rDNA nucleotide sequence fragment with a length of approximately 1485 bp. The 16S rDNA is specifically as follows:
[0080]
[0081] In this embodiment, the strain K9 was amplified and sequenced to obtain a 16S rDNA nucleotide sequence fragment with a length of about 1478 bp. The 16S rDNA is specifically as follows:
[0082]
[0083] 1.2.2, Homology alignment
[0084] The nucleotide sequence fragments amplified from strains Y3, J6, and K9 were respectively subjected to homology alignment in the GenBank database; a phylogenetic tree was constructed by the neighbor-joining method using MEGA7.0, and the results are as Figures 1 to 3 shown. At the same time, the plate diagrams of strains Y3, J6, and K9 are as Figure 4 shown.
[0085] See Figure 1 , the gene sequence of strain Y3 has the closest homology with Hanseniaspora_pseudoguilliermondii (NR155181.1); see Figure 2 , the gene sequence of strain J6 has the closest homology with Bacillus altitudinis ((NR042337.1); see Figure 3 , the gene sequence of strain K9 has the closest homology with Kosakonia cowanii (CP107077.1).
[0086] Figure 4 (a) shows that the colony morphology of strain Y3 is smooth on the colony surface, without irregularities such as protrusions, depressions, folds, or granularity. The colony color is mostly white to milky white, with uniform color. Under microscopic observation, the cells are oval-shaped with relatively sharp ends. Figure 4 (b) shows that the colony morphology of strain J6 is relatively large, circular in shape, with a slightly yellow color, and the colony surface is rough. The single cells are rod-shaped. Figure 4 (c) shows that the colony morphology of strain K9 is smooth and moist on the colony surface, with a yellow color, and the colony is viscous.
[0087] Combining the phylogenetic tree and the morphology of the antagonistic strains, the identification of the three strains is as follows:
[0088] Strain Y3 was identified as Hanseniaspora sp. Y3, with the Latin name Hanseniaspora sp.Y3, and was deposited in the China Center for Type Culture Collection (address: Wuhan University, Wuhan, China) on February 19, 2025, with the deposit number CCTCC M 2025252.
[0089] Strain K9 was identified as Kosakonia cowanii K9. The Latin name is Kosakonia cowanii K9, and it was deposited in the China Center for Type Culture Collection (address: Wuhan University, Wuhan, China) on February 19, 2025, with the deposit number CCTCC M 2025253.
[0090] The strain J6 was identified as Bacillus sp. J6, with the Latin name Bacillus sp. J6, and was deposited at the China Center for Type Culture Collection (address: Wuhan University, Wuhan, China) on February 19, 2025, with the deposit number CCTCC M 2025254.
[0091] 1.3. Performance determination of the strain
[0092] 1.3.1. Growth curve determination
[0093] The strain J6 and the strain K9 were respectively inoculated into the LB liquid medium, and the strain Y3 was inoculated into the PDB medium. The strain J6 and the strain K9 were cultured under the conditions of 37 °C and 170 rpm in a shaker, and the strain Y3 was cultured under the conditions of 28 °C and 170 rpm in a shaker; the fermentation broth was taken every four hours, and its growth amount was observed under a microscope. At the same time, three groups were repeated, and then the growth curve of the strain was drawn.
[0094] The growth curves of the three antagonistic strains are as Figure 5 shown. The strain Y3 entered the logarithmic growth phase at about 4 h and was in the growth stable phase from 28 to 32 h; the strain J6 entered the logarithmic growth phase at about 4 h and was in the growth stable phase from 32 to 40 h; the strain K9 entered the logarithmic growth phase at about 4 h and was in the growth stable phase from 20 to 44 h. The growth cycles of the three antagonistic strains are all relatively short, with high production efficiency and are suitable for industrial production. At the same time, the measurement time of the subsequent cell concentration is to measure the strain Y3 until 28 h, the strain J6 until 32 h, and the strain K9 until 20 h.
[0095] 1.3.2. Screening of the best carbon source
[0096] The strain J6 and the strain K9 were inoculated into the medium based on 1% peptone and 1% sodium chloride, respectively using 1% glucose, 1% soluble starch, 1% sucrose, 1% maltose, and 1% lactose as carbon sources, and inoculated into the same volume of medium at an inoculation amount of 2%. Cultivation was carried out under the conditions of a fermentation temperature of 35 °C, an initial pH of 7, and a shaker rotation speed of 170 rpm. The fermentation broth at the growth stable phase of each bacterium was taken, and its growth amount was observed under a microscope.
[0097] Figure 6 Shown is the effect of different carbon sources on the concentrations of the strain J6 and the strain K9. The concentration of the strain J6 was the highest when the carbon source was glucose, reaching 21.97×10 8 cfu / mL, and the lowest when the carbon source was sucrose, only 9.37×10 8 cfu / mL. While for the strain K9, the concentrations were relatively high and similar when the carbon sources were glucose, sucrose, and lactose, being 41.17×10 8 cfu / mL, 40.43×10 8cfu / mL, 41.30×10 8 cfu / mL, the concentration is the lowest when the carbon source is maltose, only 25.2×10 8 cfu / mL. Considering the commonness and cost of raw materials, glucose was finally selected as the fermentation carbon source for the two strains.
[0098] 1.3.3. Screening of the optimal nitrogen source
[0099] Using the optimal carbon source and 1% sodium chloride as the basal medium, 1% peptone, beef extract, yeast powder, and ammonium sulfate were used as nitrogen sources respectively. Inoculate into the same volume of medium at an inoculation amount of 2%, the fermentation temperature is 35°C, the initial pH is 7, and the shaker speed is 170 rpm. Take the fermentation broth at the growth stationary phase of each bacterium, and observe its growth amount under a microscope.
[0100] Figure 7 The effects of different nitrogen sources on the concentrations of strain J6 and strain K9 are shown. The concentration of strain J6 is the highest when the nitrogen source is yeast extract, reaching 35.67×10 8 cfu / mL, and it hardly grows when the nitrogen sources are NaNO3 and (NH4)2SO4. The concentration of strain K9 is the highest when the nitrogen sources are yeast extract and beef extract, reaching 46.17×10 8 cfu / mL and 46.13×10 8 cfu / mL, and it also hardly grows when the nitrogen sources are NaNO3 and (NH4)2SO4. Therefore, yeast extract was finally selected as the fermentation nitrogen source for the two strains.
[0101] 1.3.4. Screening of the medium for strain Y3
[0102] Take strain Y3, and inoculate the Y3 bacterial suspension with an inoculation amount of 2% into 60 mL, YEPD medium, PDB medium, yeast minimal medium, and yeast complete medium respectively, and then carry out fermentation culture on a shaker; the fermentation temperature is 28°C, the initial pH is 5.5, and the shaker speed is 170 r / min. Take the fermentation broth at the growth stationary phase of the strain, and observe its growth amount under a microscope. The results are as Figure 8 shown.
[0103] The formulations of the above four media are as follows. It should be noted that the percentages given in the following formulations refer to mass fractions.
[0104] (1) YEPD medium includes YEPD liquid medium and YEPD solid medium. The formulation of YEPD liquid medium is: 1% yeast extract, 2% glucose, 2% peptone, and the rest is made up with distilled water. The formulation of YEPD solid medium is: add 2% agar to YEPD liquid medium, and the rest is made up with distilled water.
[0105] (2) The formula for the yeast basal medium is: 0.1% yeast extract, 0.025% (NH4)2SO4, 0.025% MgSO4, 2% glucose, and 0.05% K2HPO4, and the rest is made up with distilled water.
[0106] (3) The formula for the yeast complete medium is: 2.5% sucrose, 0.05% FeSO4, 0.05% MgSO4, 0.5% ZnSO4, 0.05% K2HPO4, 0.3% (NH4)2SO4, and the rest is made up with distilled water.
[0107] (4) The formula for the PDB medium is: 20% potato, 2% sucrose, and the rest is made up with distilled water.
[0108] See Figure 8 , the concentration of strain Y3 in the PDB medium is the highest, reaching 32.2×10 8 cfu / mL, while the concentration in the yeast complete medium is the lowest, only 2.7×10 8 cfu / mL. Therefore, the PDB medium was selected as the fermentation medium for strain Y3.
[0109] 1.3.5, Antibacterial effects of three strains
[0110] Examine the antibacterial effects of strain Y3, strain J6, and strain K9 in Example 1 against Botryosphaeria dothidea respectively.
[0111] After culturing the above three strains in the PDB medium for 2 - 3 days, the cell suspension at 1×10 7 cfu / mL was mixed in different proportions and placed in a sterile centrifuge tube for later use.
[0112] The pathogenic bacterium (Botryosphaeria dothidea) was evenly spread on the PDA medium. After culturing for 3 - 4 days, the surface of the colony was rinsed with sterile water, and the obtained spore suspension was collected. A 5 - mm puncher was used to punch holes in the middle of the blank medium. First, 5 μL of the spore suspension was added to the hole, and 2 h later, 5 μL of the cell suspension was added. The antibacterial effect is as Figure 9 shown. Among them, (a) is the original picture of the pathogenic bacterium; (b) is the antibacterial effect of strain Y3; (c) is the antibacterial effect of strain J6; (d) is the antibacterial effect of strain K9.
[0113] See Figure 9 , the results showed that all three strains could completely inhibit the growth of the pathogenic bacterium under contact conditions. It can be seen that strain Y3, strain J6, and strain K9 all have obvious antibacterial effects against Botryosphaeria dothidea, and thus have a preventive and control effect on kiwifruit soft rot.
[0114] 1.3.6, Mutual antagonism of three strains
[0115] Since strains Y3, J6, and K9 all have antagonistic effects, it is thus explored whether there is also antagonism among the three.
[0116] After using an inoculation loop to pick strain Y3 and draw a straight line in the center of the petri dish, pick strain J6 and draw a straight line crossing with strain Y3, and observe whether there are phenomena such as shrinkage or growth arrest at the junction of the two lines.
[0117] Take strain Y3 and strain K9, as well as strain J6 and strain K9, and repeat the above operations. The results of the antagonistic effects of the three strains are as Figure 10 shown. (a) is the cross of the colonies of strain Y3 and strain J6, (b) is the cross of the colonies of strain J6 and strain K9, and (c) is the cross diagram of the colonies of strain Y3 and strain J6.
[0118] From Figure 10 it can be seen that there is no shrinkage or growth inhibition at the intersections of strain Y3, strain J6, and strain K9. It shows that there is no antagonism among the three bacteria, and strain Y3, strain J6, and strain K9 can simultaneously serve as the active ingredients of the bacteriostatic agent.
[0119] Example 2
[0120] This example mainly studies the optimal bacteriostatic ratio of the three bacteria, strain Y3, strain J6, and strain K9.
[0121] (1) After culturing the three antagonistic bacteria (strain Y3, strain J6, and strain K9) in their respective optimal culture media for 2 - 3 days, adjust the cell suspensions of the three bacteria to 1×10 7 cfu / mL; use a triangular coordinate system to determine the different ratios of the three bacteria (see Table 2), and mix the cell suspensions in different ratios and place them in sterile centrifuge tubes for later use.
[0122] (2) Uniformly coat the pathogenic bacteria on the PDA culture medium. After culturing for 3 - 4 days, use a 5 - mm punch to take the mushroom stalk and inoculate it in the center of the blank culture medium. Place a 5 - mm sterile filter paper 3 mm on both sides of the mushroom stalk, and take 4 μL of the cell suspension from the sterile centrifuge tubes respectively and drop it on the filter paper. Culture for 6 days to measure the colony diameter and calculate the bacteriostatic rate.
[0123] The mixing ratios, colony diameters, and bacteriostatic rates of strain Y3, strain J6, and strain K9 are all shown in Table 1.
[0124] Table 1 Comparison of bacteriostatic effects under different mixing ratios
[0125]
[0126] As can be seen from the results in Table 1, compared with a single strain, the composite bacteria can improve the antibacterial effect; and the antibacterial rate of the composite antagonistic bacteria containing Y3 is higher than that of the composite antagonistic bacteria without Y3. Especially when the ratio of Y3:J6:K9 is 2:1:1, the antibacterial radius is 3.63±0.12, and the highest antibacterial rate reaches 57.3%. Therefore, the optimal antibacterial ratio of strain Y3, strain J6 and strain K9 is 2:1:1.
[0127] Example 3
[0128] In this example, strain Y3, strain J6 and strain K9 are used to prepare an antagonistic bacterium agent.
[0129] The bacterium agent provided in this example includes a main ingredient and auxiliary ingredients; the main ingredient is an active substance; the auxiliary ingredients are a wettable powder, specifically including a filler, a wetting agent, a dispersant and a stabilizer.
[0130] In this example, the mass fraction of the active substance is 15% - 25%, the mass fraction of the filler is 65% - 77.5%, the mass fraction of the wetting agent is 3% - 5%, the mass fraction of the dispersant is 3% - 5%, and the mass fraction of the stabilizer is 1.5% - 2.5%.
[0131] 3.1. Optimization of wettable powder materials
[0132] During the implementation, strain Y3, strain J6 and strain K9 are respectively concentrated in the optimal culture medium and cultured for 3 - 5 days, then centrifuged. After mixing according to the ratio of Y3:J6:K9 of 2:1:1, the precipitate is taken, glycerol is added, and it is put into a freeze dryer for freeze - drying at a temperature of - 80°C to obtain the active substance.
[0133] 3.1.1. Influence of different fillers on the preparation
[0134] The mass fraction of the active substance is 20%, sodium dodecyl sulfate is used as the wetting agent with a mass fraction of 5%, CMC - Na is used as the dispersant with a mass fraction of 5%, tert - butylhydroquinone is used as the stabilizer with a mass fraction of 2%, and the balance respectively selects diatomaceous earth (A), bentonite (B) or silica white (C) as the filler; then they are mixed evenly, pulverized, passed through a 325 - mesh sieve, the water content is ≤5%, and the viable bacteria count is measured by the plate coating method. The wetting time is measured by the national standard method for measuring the wettability of pesticide wettable powder GB / T5451 - 2001. The suspension rate is measured by the national standard method for measuring the suspension rate of pesticide wettable powder GB / T14825 - 2023. Each treatment is repeated 3 times and the average value is taken.
[0135] 3.1.2. Influence of different wetting agents on the preparation
[0136] The mass fraction of the active substance is 20%, CMC-Na is used as a dispersant with a mass fraction of 5%, 2% of tert-butylhydroquinone is used as a stabilizer with a mass fraction of 2%, diatomaceous earth is used as a filler with a mass fraction of 68%, and the balance uses sodium dodecyl sulfate (A) or Tween-80 (D) as a wetting agent respectively. The effects of different wetting agents on the indexes of wettable powders were evaluated according to the aforementioned method. Each treatment was repeated 3 times and the average value was taken.
[0137] 3.1.3. Effects of different dispersants on the preparation
[0138] The mass fraction of the active substance is 20%, sodium dodecyl sulfate is used as a wetting agent with a mass fraction of 5%, tert-butylhydroquinone is used as a stabilizer with a mass fraction of 2%, diatomaceous earth is used as a filler with a mass fraction of 68%, and the balance uses CMC-Na (A), NNO (E), polyethylene glycol (F) or polyaspartic acid (G) as a dispersant respectively. The effects of different dispersants on the indexes of wettable powders were evaluated according to the aforementioned method. Each treatment was repeated 3 times and the average value was taken.
[0139] 3.1.4. Effects of different stabilizers on the preparation
[0140] The mass fraction of the active substance is 20%, sodium dodecyl sulfate is used as a wetting agent with a mass fraction of 5%, CMC-Na is used as a dispersant with a mass fraction of 5%, diatomaceous earth is used as a filler with a mass fraction of 68%, and the balance uses tert-butylhydroquinone (A), vitamin E (H) or potassium dihydrogen phosphate (I) as a stabilizer respectively. The effects of different stabilizers on the indexes of wettable powders were evaluated according to the aforementioned method. Each treatment was repeated 3 times and the average value was taken.
[0141] The results of the suspension rate, wetting time and viable bacteria count of the antagonistic bactericides formed by the above different materials are respectively as Figures 11 to 13 shown.
[0142] Figure 11 It shows the effects of different materials on the suspension rate of the bacterial agent. Among them, the suspension rate of group F is the highest, reaching 84.76%, 19.13% higher than that of group C, and group E is the lowest, only 40.23%.
[0143] Figure 12 It shows the effects of different materials on the wetting time of the bacterial agent. The wetting time of group F is significantly lower than that of other groups, only requiring 1.3 s, while the wetting time of group G is the longest, requiring 34.5 s.
[0144] Figure 13 It shows the effects of different materials on the viable bacteria count of the bacterial agent. The viable bacteria count of group F is the highest.
[0145] Considering the results of suspension rate, wetting time, and viable bacteria count comprehensively, the antibacterial effect of Group F is the best; at this time, the filler is selected as diatomaceous earth, the wetting agent is selected as sodium dodecyl sulfate, the dispersant is selected as polyethylene glycol, and the stabilizer is selected as tert-butylhydroquinone.
[0146] 3.2. Optimization of the ratio of antagonistic agents
[0147] In this example, strains Y3, J6, and K9 were cultured in the optimal medium for 3 - 5 days and then centrifuged. After taking the precipitate, glycerol was added and it was placed in a freeze dryer for freeze-drying at a temperature of -80 °C. Then, it was mixed according to the ratio of 2:1:1 optimized in Example 2 as the active substance of the antagonistic agent.
[0148] Then, using sodium dodecyl sulfate as the wetting agent, polyethylene glycol as the dispersant, tert-butylhydroquinone as the stabilizer, and diatomaceous earth as the filler, the SPSS 27.0 software was used to conduct an orthogonal experimental design for the test data. The factors and levels are shown in Table 2; then, 9 kinds of bacterial agents were formed according to different ratios in Table 2, and the suspension rate and viable bacteria count of the 9 kinds of bacterial agents were measured by referring to the above method. The results are shown in Table 3.
[0149] Table 2 Design table of the dosage of each component
[0150]
[0151] Table 3 Comparison results of the performance of bacterial agents formed under different ratios
[0152]
[0153] As can be seen from Table 3, when the active substance is 20%, the wetting agent is 4%, the dispersant is 4%, the stabilizer is 2%, and the filler is 70%, the suspension rate and viable bacteria count are the best. This indicates that this ratio is the optimal ratio.
[0154] Example 4
[0155] This example mainly studies the control effect of the ratio optimized in Example 2 and the antagonistic agent optimized in Example 3 on postharvest soft rot of kiwifruit.
[0156] In this example, the specific process of controlling postharvest soft rot of kiwifruit is as follows:
[0157] (1) Botryosphaeria dothidea (denoted as pathogen P) was cultured in PDB medium for 15 days. The mycelium was scraped off, and the granular hard nodules on the plate were crushed with forceps and adjusted to 1×10 6 cfu / mL with sterile water to obtain the spore suspension of pathogen P.
[0158] (2) Three antagonistic bacteria, strains Y3, J6, and K9, were cultured in the optimal medium for 3 days respectively. The fermentation broth was taken and adjusted to 1×10 7cfu / mL. After mixing in the ratio of Y3:J6:K9 at 2:1:1, the precipitate was taken, glycerol was added, and then it was placed in a freeze dryer for freeze-drying at -80 °C to obtain the active substance.
[0159] (3) Take 20% of the active substance, 4% sodium dodecyl sulfate, 4% polyethylene glycol, and 2% tert-butylhydroquinone. The balance is added with diatomaceous earth and then mixed evenly to obtain the antagonistic bacteria agent. After adding an appropriate amount of water to dissolve the antagonistic bacteria agent, it is placed in a spray bottle for standby.
[0160] (4) Take 60 healthy kiwifruits. The kiwifruits are soaked in sodium hypochlorite for 3 min, then rinsed three times with distilled water and dried in a cool place. After using a 5 mm puncher to evenly punch three holes at the equator of the kiwifruits, the treated kiwifruits are evenly divided into 4 groups. Among them: The CK group is injected with 10 μL of sterile water, sprayed with sterile water and then dried; the T1 group is injected with 10 μL of spore suspension, sprayed with sterile water and then dried; the T2 group is injected with 10 μL of sterile water and sprayed with 50 mL of the antagonistic bacteria agent; the T3 group is injected with 10 μL of spore suspension and sprayed with 50 mL of the antagonistic bacteria agent. Observe the disease occurrence and incidence rate of the kiwifruits.
[0161] Figure 14 It is a picture of the control effect of the antagonistic bacteria on the fruits. In the T1 group, obvious diseases occurred, and the incidence rate was 100%. While in the CK group and the T2 group, no disease occurrence phenomenon was produced, and the incidence rate was 0%. In the T3 group, the lesion spots were smaller, and the incidence rate was only 36.7%. It shows that the antagonistic bacteria have an obvious antibacterial effect on Botryosphaeria dothidea, can reduce the incidence rate of postharvest soft rot of kiwifruits, and has a control effect on postharvest soft rot of kiwifruits.
[0162] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit them. Although the present invention has been described in detail with reference to the preferred embodiments. Those of ordinary skill in the art should understand that they can still modify the technical solutions of the present invention or make equivalent replacements, and these modifications or equivalent replacements cannot make the modified technical solutions deviate from the spirit and scope of the technical solutions of the present invention.
Claims
1. A composite active ingredient, characterized in that The composite active ingredient includes at least two of Hansenula Y3, Bacillus J6 and Cossackia K9; the mass ratio of Hansenula Y3, Bacillus J6 and Cossackia K9 is (0-3):(0-3):(0-3).
2. The composite active ingredient according to claim 1, characterized in that The spore-forming Hanseniaspora Y3, whose Latin name is Hanseniaspora sp.Y3, was deposited in the China Center for Type Culture Collection on February 19, 2025, with a deposit number of CCTCC M2025252.
3. The composite active ingredient according to claim 1, characterized in that The Kosakonia cowanii K9, whose Latin name is Kosakonia cowanii K9, was deposited in the China Center for Type Culture Collection on February 19, 2025, with the deposit number of CCTCC M 2025253.
4. The composite active ingredient according to claim 1, characterized in that The Bacillus J6 has a Latin name of Bacillus sp. J6 and was deposited in the China Center for Type Culture Collection on February 19, 2025 with a deposit number of CCTCCM 2025254.
5. The composite active ingredient according to claim 1, characterized in that The 18S rDNA sequence of the Hansenula sporogenes Y3 is shown in SEQ No. 1; the 16S rDNA sequence of Bacillus J6 is shown in SEQ No. 2; and the 16S rDNA sequence of Coxsackia coli K9 is shown in SEQ No.
3.
6. Use of the composite active ingredient according to claim 1 in preventing and treating postharvest soft rot of kiwifruit.
7. An antagonistic bacterial agent, characterized in that It comprises an active substance and a wettable powder, wherein the active substance is the composite active ingredient according to claim 1, and the wettable powder comprises a filler, a wetting agent, a dispersant and a stabilizer; the mass fraction of the active substance is 15% to 25%, the mass fraction of the filler is 65% to 77.5%, the mass fraction of the wetting agent is 3% to 5%, the mass fraction of the dispersant is 3% to 5%, and the mass fraction of the stabilizer is 1.5% to 2.5%.
8. The antagonistic agent according to claim 7, characterized in that The filler is diatomaceous earth, bentonite or white carbon black; the wetting agent is sodium dodecyl sulfate or Tween-80; the dispersant is CMC-Na, NNO, polyethylene glycol or polyaspartic acid; and the stabilizer is tert-butylhydroquinone, vitamin E or potassium dihydrogen phosphate.
9. Use of the antagonistic bacteria agent according to claim 7 in preventing and treating postharvest soft rot of kiwi fruit.