Method for fixed-point insertion of gene and rapid introduction of corn strain

Abstract

The invention provides a method for inserting a gene at a fixed point and rapidly introducing the gene into a corn strain, which comprises the following steps: inserting a target gene into the downstream of an S91 gene promoter as shown in SEQ ID NO: 31 so as to insert the target gene into a corn chromosome B, and hybridizing the obtained transgenic positive plant containing the target gene inserted at the fixed-point position in the B chromosome with a corn strain needing to be improved, and further selfing. By means of the method, the corn strain can be flexibly and rapidly improved according to requirements, and growth and development and original agronomic characters of the corn strain are not affected.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene editing, and relates to an S91 gene promoter for site-directed insertion of a target gene and rapid introduction into a maize line, and a method for highly efficient homologous recombination site-directed insertion of a gene using the promoter. The present invention also relates to a method for rapidly introducing a site-directed inserted gene into a designated maize line, which can bypass any transformation of the maize line and can be rapidly introduced only by conventional hybridization. More specifically, the present invention relates to a method for site-directed insertion of a gene and rapid introduction into a maize line. Background Art

[0002] There are various techniques available for achieving site-directed insertion, but there are often significant differences in the size of the inserted fragment and the insertion frequency, or it is impossible to take both into account. The Clustered Regularly Interspaced Short Palindromic Repeats / CRISPR associated system (CRISPR / Cas) technology is often used to generate site-directed small fragment insertions or deletions in the non-coding region of a gene, thereby changing the gene expression pattern and then generating important agronomic traits. However, the fragments inserted by the CRISPR / Cas technology are generally relatively small, and the homologous recombination efficiency is extremely low. After DNA double-strand break (DSB), there are two mechanisms for repair in cells, namely non-homologous end joining (NHEJ) and homologous recombination (HR). NHEJ is prone to cause deletions or insertions of fragments at the break site, while homologous recombination uses exogenous nucleic acid fragments to precisely repair DNA. Compared with NHEJ, the efficiency of homologous recombination is extremely low (generally less than 1%). The realization of DNA homologous recombination depends on two key factors, namely the effective cleavage of DNA and the effective number of target homologous fragments. Therefore, whether the target homologous fragments are sufficient becomes the key to determining whether homologous recombination can be achieved under the action of the nuclease Cas9.

[0003] Methods based on viral DNA replicons as donor templates have been proven to greatly improve homologous recombination efficiency. Taking advantage of the rolling circle replication of the viral replicons of Geminivirus, which can produce a large number of copies in cells in a short time, the donor DNA is assembled into the replication region of the viral replicon, which can increase the copy number of the donor DNA by 1-2 orders of magnitude, thus greatly increasing the probability of homologous recombination. Bean yellow dwarf virus (BeYDV) was first isolated from beans and belongs to the genus Mastrevirus of the family Geminivirus (Liu et al., 1997). It can infect plants such as beans, chickpeas, tobacco, tomatoes, potatoes, and Arabidopsis thaliana (Halley-Stott et al., 2007; Liu et al., 1999; Liu et al., 1997). Using its replicon elements, Agrobacterium-mediated infection of plants such as tobacco, tomatoes, and lettuce can produce high-copy target DNA fragments in plant cells (Collens et al., 2007; Hefferon and Dugdale, 2003; Hefferon and Fan, 2004; Hefferon et al., 2004; Huang et al., 2009; Mor et al., 2003; Zhang and Mason, 2006). In 2015, Cermak et al. increased the template amount in tomatoes through the BeYDV replication system of Geminivirus and used the homologous recombination (HR) repair method mediated by the CRISPR / Cas9 technology to insert the 35S promoter into the front of the expression frame of the tomato anthocyanin synthesis gene (ANT1), making the mutants with site-directed insertion show a purple phenotype (Cermak et al., 2015). This method has currently been applied to various crops including potatoes, wheat, cassava, rice, etc. (Butler et al., 2016; Gil-Humanes et al., 2017; Wang et al., 2017; Dahan-Meir et al., 2018; Hummel et al., 2018; Vu et al., 2020).

[0004] Although the Geminivirus system in the above technologies has been applied in some plants, there is no relevant research report in maize yet. Summary of the Invention

[0005] Based on this, by combining the Geminivirus system and the CRISPR-Cas9 system, an object of the present invention is to obtain a method for efficient homologous recombination and site-directed gene insertion.

[0006] Specifically, the method for efficiently inserting genes by homologous recombination at a fixed point of the present invention includes the following steps:

[0007] 1) Agrobacterium is used to transform the F1 hybrid offspring of maize inbred line HiIIA and inbred line HiIIB (for maize transformation, young embryos with strong vitality and high regeneration ability are preferably selected. Therefore, the young embryos of the hybrid offspring of the two lines HiIIA and HiIIB meet the requirements very well and are often used as transformation materials). The HiIIA inbred line among them carries the B chromosome. The CRISPR-Cas9 and geminivirus systems are introduced. The CRISPR-Cas9 is used to generate a nick at a fixed point on the maize B chromosome, and at the same time, the geminivirus provides a homologous recombination insertion fragment to achieve the insertion of a gene at the fixed point position on the B chromosome;

[0008] 2) From the regenerated plants obtained in step 1), transgenic positive plants with the B chromosome having the target gene inserted at the fixed point position are screened;

[0009] The construction method of the geminivirus system includes the following steps:

[0010] The construction of the vector HR04a-S91-AsRed for homologous recombination insertion at a fixed point on the B chromosome includes the following steps:

[0011] 1) Construction of the pHR04a vector: The replicon element LIR-RepA-SIR (nucleotide sequence as shown in SEQ ID NO:27) of the bean yellow dwarf virus publicly available in NCBI is synthesized and constructed between the SphI and StuI sites of the binary vector pGreen0029 (GenBank: JB160914.1) to obtain the intermediate vector I; then the intermediate vector I is digested with SphI, and through In-fusion cloning, the LIR fragment (nucleotide sequence as shown in SEQ ID NO:28) is constructed onto the intermediate vector I to obtain the vector pHR04a;

[0012] 2) Construction of the pHR04a-AsRed vector: The expression cassette AsRed-Tnos (nucleotide sequences of AsRed and Tnos are shown in SEQ ID NO:29 and 30 respectively) is constructed between the AscI and BstXI sites of the vector pHR04a to obtain the vector pHR04a-AsRed;

[0013] 3) Construction of B chromosome site-specific homologous recombination insertion vector HR04a-S91-AsRed: Fragments of 934 bp at the end of the S91 promoter (nucleotide sequence as shown in SEQ ID NO:31) and 1036 bp downstream starting from 5 bp upstream of the first exon (this position is 88 bp upstream of the start codon ATG of the open reading frame) were amplified respectively, and used as the homologous left arm and homologous right arm. The homologous left arm was constructed between the AscI and NcoI sites of vector pHR04a-AsRed, and the homologous right arm was constructed between the BstxI and XhoI sites of vector pHR04a-AsRed, thus obtaining a B chromosome site-specific homologous recombination insertion vector. The site-specific position is downstream of the promoter of the S91 gene, and the inserted gene can be driven by the promoter of S91.

[0014] Construction of B chromosome site-specific homologous recombination insertion vector HR04a-S91-Bar includes the following steps:

[0015] 1) Construction of vector pHR04a: The replicon element LIR-RepA-SIR of bean yellow dwarf virus publicly available in NCBI was synthesized and constructed between the SphI and StuI sites of vector pGreen0029 to obtain intermediate vector I. Then, intermediate vector I was digested with SphI, and the LIR fragment was constructed onto intermediate vector I through In-fusion cloning, thus obtaining vector pHR04a;

[0016] 2) Construction of vector pHR04a-S91-Bar: The expression cassette p35S-Bar-Tnos (nucleotide sequences of p35S, Bar, and Tnos are shown in SEQ ID NO:32, 33, and 30 respectively) was constructed between the AscI and BstXI sites of vector pHR04a, thus obtaining vector pHR04a-Bar;

[0017] 3) Construction of B chromosome site-specific homologous recombination insertion vector HR04a-S91-Bar: Fragments of 934 bp at the end of the S91 promoter and 1036 bp downstream starting from 5 bp upstream of the first exon (this position is 88 bp upstream of the start codon ATG of the open reading frame) were amplified respectively, and used as the homologous left arm and homologous right arm. The homologous left arm was constructed between the AscI and NcoI sites of vector pHR04a-Bar, and the homologous right arm was constructed between the BstxI and XhoI sites of vector pHR04a-Bar, thus obtaining another B chromosome site-specific homologous recombination insertion vector. The site-specific position is downstream of the promoter of the S91 gene, and the inserted gene can be driven by the promoter of S91.

[0018] Among them, the construction method of the CRISPR-Cas9 system vector includes the following steps:

[0019] Construction of CRISPR-Cas9 vector: The nucleic acid sequence recognized by gRNA downstream of the promoter of S91 gene is 5'-GGGTTTGGGGCGGGACGCGT-3' (SEQ ID NO:16). Based on this, two single-stranded DNAs were designed, which are 5'- agca GGGTTTGGGGCGGGACGCGT-3' (SEQ ID NO:17) and 5'- aaac ACGCGTCCCGCCCCAAACCC-3' (SEQ ID NO:18) (the lowercase underlined sequences in the two sequences are the BbsI restriction sites for subsequent ligation). The two single-stranded DNAs were hybridized, and the resulting double-stranded DNA fragment was ligated to the vector pU3-sgRNA (Feng et al., 2013) digested with BbsI. Then, XmaI restriction sites were added to both ends of the ligation product by PCR. Finally, it was ligated to the pDMC1-Cas9 vector digested with XmaI (see Chinese Patent ZL201710599030.2), thus obtaining the S91 gene editing vector.

[0020] Although the geminivirus system in the above technology has been applied in some plants, there is no relevant research report in maize. From the perspective of increasing the homologous recombination frequency, the present invention provides two methods to comprehensively achieve the goal. One is to increase the donor template concentration through geminivirus, and the other is to select the downstream site of a promoter sequence in the B chromosome as the insertion point (the 35S promoter is used when discussing the recombination frequency below, not the promoter of the B chromosome. The promoter of the B chromosome is used for site-directed insertion of AsRed in protoplasts). Through the latter method, the length of the inserted sequence can be saved, and only the open reading frame sequence of the inserted gene needs to be added. The length of the inserted sequence is significantly inversely proportional to the homologous recombination frequency, and each shortening of the inserted length can greatly increase the recombination frequency. The combination of these two technologies in the present invention can significantly improve the efficiency of site-directed insertion, which is a technological breakthrough and reflects the good advancement and innovation of this research method.

[0021] Another object of the present invention is to provide a method for quickly introducing a specified maize line.

[0022] Specifically, the rapid introduction of the B chromosome with the site-directed inserted gene into the specified maize line in the present invention specifically includes the following steps:

[0023] 1) Agrobacterium-mediated transformation of the F1 hybrid offspring of maize inbred line HiIIA and inbred line HiIIB, where the HiIIA inbred line carries the B chromosome. The CRISPR-Cas9 and geminivirus systems are introduced. The CRISPR-Cas9 is used to generate a site-specific incision on the maize B chromosome, and at the same time, the geminivirus provides homologous recombination insertion fragments to achieve the insertion of genes at the site-specific position on the B chromosome;

[0024] 2) From the regenerated plants obtained in step 1), transgenic positive plants that have inserted the target gene at the site-specific position on the B chromosome are screened;

[0025] 3) The transgenic plants obtained in step 2) are crossed with the maize line to be improved and then self-crossed;

[0026] 4) From the offspring obtained in step 3), plants are screened that carry the B chromosome with the inserted gene and contain all the chromosomes of the maize line to be improved.

[0027] The most crucial step in the above steps is the screening of the offspring in step 4), which includes two aspects. First, plants containing the B chromosome with the inserted target gene need to be identified (not all maize lines have the B chromosome, only a small number of specific lines have the B chromosome, and these are the special lines for insertion. Therefore, the edited B chromosome in the special lines needs to be introduced into maize lines without the B chromosome through hybridization). PCR detection can be performed to determine whether the target gene has been inserted into the B chromosome. In addition, it is necessary to identify whether all the A chromosome sets of the offspring are derived from the maize line to be improved (the A chromosome sets of the offspring need to be entirely from the maize line to be improved, while the B chromosome is the B chromosome with the inserted gene). PCR detection can be carried out on the specific molecular marker set unique to the A chromosome set of the original parent containing the B chromosome, and the offspring that do not produce any molecular marker special products are retained. In this way, the B chromosome with the inserted gene is obtained, and thus a new improved maize line is obtained.

[0028] Conventional gene editing techniques, when applied to the improvement of crop lines, require direct genetic transformation and other operations on the crop lines to be improved. However, in maize, there are problems of genotype dependence and relatively low transformation efficiency. The genetic transformation of most commercial maize varieties is extremely difficult, which has become a bottleneck in maize biological breeding. In the present invention, the B chromosome that does not affect the normal A chromosome set of maize is first edited, and then the edited B chromosome is introduced into the maize line to be improved by hybridization, avoiding a series of transformation operations on the maize line to be improved. The B chromosome, also known as the supernumerary chromosome, is a type of chromosome with an indefinite number in addition to the normal chromosomes in the nuclei of animals and plants. Using the B chromosome as an insertion vector avoids affecting the expression of normal chromosome genes or disrupting the normal chromosome structure, and the method of site-directed insertion can also avoid gene silencing due to insertion into the heterochromatin region. Generally, commercial and farmer maize lines do not contain B chromosomes, and the B chromosome contained in a specific maize line can be introduced into the designated maize line by hybridization. In addition, by self-crossing and only retaining the A chromosome set of the maize line to be improved, the influence on the original agronomic traits of the maize line is minimized. The present invention can quickly and efficiently introduce genes into the designated maize line through this technology, which is a technological breakthrough and reflects that this research method has very good practicability.

[0029] Specifically, the present invention provides the following technical solutions.

[0030] On the one hand, the present invention provides the promoter of the S91 gene for site-directed insertion of a target gene and rapid introduction into a maize line, and the sequence of the promoter is shown as SEQ ID NO:31.

[0031] On the other hand, the present invention provides the use of the above-mentioned promoter in maize breeding.

[0032] On the other hand, the present invention provides a maize breeding method, which includes the steps of inserting a target gene downstream of the promoter of the S91 gene shown as SEQ ID NO:31 to insert the target gene into the maize B chromosome, and then hybridizing the obtained transgenic positive plants containing the target gene inserted at a site-directed position in the B chromosome with the maize line to be improved and further self-crossing.

[0033] In some embodiments, the maize line to be improved does not contain the B chromosome.

[0034] On the other hand, the present invention provides a method for site-directed insertion of a target gene and rapid introduction into a maize line, which includes the step of inserting the target gene into the maize B chromosome.

[0035] In some embodiments, a target gene is inserted into the maize B chromosome by inserting the target gene downstream of the S91 gene promoter as shown in SEQ ID NO:31.

[0036] In some embodiments, a target gene is inserted into the maize B chromosome through two systems, CRISPR-Cas9 and geminivirus.

[0037] In some embodiments, the gRNA recognizes the nucleotide sequence as shown in SEQ ID NO:16 downstream of the S91 gene promoter.

[0038] In some embodiments, the geminivirus system comprises the long gene spacer, replicon, and short gene spacer of bean yellow dwarf virus.

[0039] In some embodiments, the sequence of the long gene spacer + replicon + short gene spacer of bean yellow dwarf virus is as shown in SEQ ID NO:27.

[0040] In some embodiments, the geminivirus system further comprises a long gene spacer as shown in SEQ ID NO:28.

[0041] In some embodiments, the CRISPR-Cas9 system further includes a homologous left arm as shown in SEQ ID NO:34 and a homologous right arm as shown in SEQ ID NO:35.

[0042] On the other hand, the present invention provides a method for site-specific insertion of a gene and rapid introduction into a maize line, the method comprising the following steps:

[0043] 1) The F1 hybrid offspring of maize inbred line HiIIA and inbred line HiIIB carrying the B chromosome are transformed by Agrobacterium (the most commonly used Agrobacterium-mediated transformation is the hybrid offspring of maize inbred lines HiIIA and HiIIB because the callus production frequency of the hybrid offspring is the highest), and two systems, CRISPR-Cas9 and geminivirus, are introduced. CRISPR-Cas9 is used to generate a site-specific incision on the maize B chromosome, and at the same time, the geminivirus provides a homologous recombination insertion fragment to achieve the insertion of the target gene at the site-specific position on the B chromosome, and the target gene is inserted downstream of the S91 gene promoter as shown in SEQ ID NO:31;

[0044] 2) From the regenerated plants obtained in step 1), transgenic positive plants that have inserted the target gene at the site-specific position on the B chromosome are screened;

[0045] 3) The transgenic plants obtained in step 2) are hybridized with the maize line to be improved and further self-crossed;

[0046] 4) From the offspring obtained in step 3), select plants that have the B chromosome with the inserted gene and the chromosome of the corn variety to be improved.

[0047] definition

[0048] B chromosome: also known as supernumerary chromosome, is a type of chromosome with an indefinite number in the nucleus of animal and plant cells in addition to normal chromosomes (A chromosome set). Some inbred lines of corn contain B chromosomes, such as B73, W22 and HiIIA.

[0049] Bialaphos: A herbicide used to control a variety of annual and perennial monocotyledonous and dicotyledonous weeds.

[0050] Geminivirus: The virus particles of the Geminiviridae family are a diploid structure, without an envelope, and are composed of two incomplete icosahedrons. This family is the only plant virus with a monopartite or dipartite genome with single-stranded DNA. The virus encapsulates a single or two molecules of closed circular ssDNA, each molecule of DNA is 2.5-3.0kb long, and the total gene length is about 2.5-5.2kb. The coding region is distributed in the viral chain and the complementary chain of DNA, with the intergenic region in the middle. Virus replication is through a double-stranded replication intermediate, through rolling circle replication, ssDNA synthesis starts from a conserved sequence TAATATT / AC in the intergenic region, and the viral gene is bidirectionally transcribed, with a transcription start point in the intergenic region.

[0051] Bean yellow dwarf virus (BeYDV): First isolated from beans, it belongs to the genus Zea mays virus of the family Geminiviridae. It can infect beans, chickpeas, tobacco, tomatoes, potatoes, Arabidopsis, etc. Its replicon elements can be used to infect plants such as tobacco, tomatoes and lettuce through Agrobacterium-mediated infection, and high-copy target DNA fragments can be produced in plant cells.

[0052] Gene homologous recombination donor unit: contains the homologous left arm, the gene to be knocked in and the homologous right arm, as well as the replicon from the bean yellow dwarf virus. The connection relationship between the various elements is: LIR-RepA-SIR-homologous left arm-gene to be knocked in-homologous right arm-LIR. Among them, LIR is the long gene spacer, SIR is the short gene spacer, and RepA is the replicon of the bean yellow dwarf virus. LIR is required at the beginning and end, because the recombination of the front and back LIRs can make the rolling circle between the two LIRs replicate. The large amount of replicated rolling circle DNA can provide a high-concentration template for gene homologous recombination, that is, the donor DNA, through the "homologous left arm-gene to be knocked in-homologous right arm" contained therein.

[0053] In-fusion cloning: It is a fast, simple, and efficient gene cloning technology. The target DNA fragment does not need to be treated with restriction endonucleases and can be directly and directionally cloned into the vector under the action of In-fusion enzyme. Mix the target DNA fragment obtained by PCR amplification with the linearized vector, add In-fusion enzyme and incubate (for 15 minutes), and the directional cloning of the target DNA fragment can be completed. The In-fusion reaction solution can be directly transformed into Escherichia coli without dilution.

[0054] Multiple cloning site (MCS): It is a very short DNA sequence containing multiple restriction enzyme cleavage sites.

[0055] Geminivirus helper vector pSoup: It is an auxiliary plasmid required for the replication of all pGreen series vectors.

[0056] ZmU3: Maize promoter.

[0057] TATA sequence: It is a DNA sequence located in the promoter region of eukaryotic genes. Its core sequence is TATA(A / T)A(A / T), usually located about 25 - 30 base pairs upstream of the transcription start site. It is an important component of the RNA polymerase II transcription initiation complex and plays a key role in the process of gene transcription initiation. Description of the Drawings

[0058] Figure 1 . Geminivirus system vector providing homologous recombination template. A: Schematic diagram of HR04a vector. Among them, LIR (Long intergenic region): Long gene spacer region; SIR (Small Intergenic Region): Short gene spacer region; RepA: Replicon of BeYDV. Its vector backbone is pGreen0029. B: Schematic diagram of HR04a-S91-AsRed vector. Among them, HM1-S91 and HM2-S91 are homologous arms approximately 1000 bp upstream and downstream of the S91 gene insertion site respectively (the nucleotide sequences of HM1-S91 and HM2-S91 are shown in SEQ ID NO:34 and 35 respectively), AsRed is red fluorescent protein, Tnos is Nos terminator, and its vector backbone is pH04a. C: Schematic diagram of HR04a-S91-Bar vector. Among them, AsRed in the HR04a-S91-AsRed vector is replaced by Bar, and Bar is a herbicide-resistant gene.

[0059] Figure 2. Insert AsRed into maize protoplast cells at a specific site by combining the CRISPR / Cas9 system and geminivirus. In the red and green fluorescence channels, the green is the green fluorescence produced by the co-transformed GFP vector in the protoplasts, which is used to indicate the cells; the red is the red fluorescence produced by the expression of the AsRed gene in the protoplasts. B, D: Red fluorescence channel. A, B: The same field of view, only the geminivirus vector is transformed, carrying AsRed, including the promoter and terminator. C, D: The same field of view, the CRISPR / Cas9 vector and the geminivirus vector are transformed, and the geminivirus vector carries a DNA donor, and the donor contains AsRed but no promoter.

[0060] Figure 3 . Insert Bar into the B chromosome of maize plants at a specific site by combining the CRISPR / Cas9 system and geminivirus. The three sequences for Blast comparison are the genomic related sequences of the transgenic plant 25273-3 that has been site-specifically edited, the upstream and downstream sequences of the B chromosome site-specific insertion site (not inserted), and the insertion sequence p35S-Bar-Tnos. Specific implementation mode

[0061] To make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the following further elaborates the present invention in detail with reference to specific embodiments and the accompanying drawings.

[0062] In addition, those skilled in the art should also understand that unless otherwise specifically stated, the reagents used in the following embodiments are all commercially available analytical pure grade reagents.

[0063] Example 1. Confirm the B chromosome insertion site

[0064] 1. Select the Scaffold sequence obtained by sequencing the B chromosome

[0065] Blavet et al. sequenced the B chromosome contained in the maize B73 inbred line in 2021 (Blavet et al., 2021) and obtained 328 B chromosome-specific scaffold sequences. Here, the scaffold23591 sequence was selected because it contains a relatively complete promoter region and a partial coding sequence of the gene (SEQ ID NO: 36). By predicting and aligning the coding sequence of the S91 gene, it was found that there was no homology with the normal A chromosome set of maize. This promoter region can drive the expression of the downstream coding region. Specifically, in Example 2, after the open reading frame ORF of the AsRed red fluorescent protein was site-specifically inserted, very bright red fluorescence could be seen in the protoplast cells ( Figure 2 D). If an exogenous sequence is inserted downstream of its promoter, it will be very suitable for the expression of the inserted sequence.

[0066] 2. Determine the sequence of the B chromosome insertion site

[0067] The insertion site needs to be exactly downstream of the promoter to obtain the best driving effect and should not be within the gene coding region to avoid forming a fusion protein with the original gene. Through bioinformatics analysis and prediction of the scafflod23591 sequence, the first exon sequence and multiple common TATA sequences upstream of its promoter were confirmed.

[0068] 1) Extract the genome and sequence the upstream and downstream sequences of the proposed insertion site

[0069] Extract genomic DNA from the HiIIA maize inbred line (with B chromosome) used for subsequent transgenic operations by the CTAB method (Li et al., 2008). Then, use the primer pair (forward: 5'-gcacacaccatcgatccaatacaccata-3' (SEQ ID NO:1), reverse: 5'-ccgcgataccgaattgagtccgaagg-3' (SEQ ID NO:2)) and amplify the upstream and downstream sequences of the insertion site from the genomic DNA according to the PCR conditions in Example 2. The sequencing results show complete consistency with the relevant region in the scafflod23591 sequence, including the previously predicted first exon sequence and a partial promoter sequence upstream.

[0070] 2) Extract RNA and confirm the upstream sequence of the S91 gene transcript by RT-PCR

[0071] It is necessary to determine whether the predicted promoter can drive transcription. First, it is necessary to detect whether the predicted transcript exists. Extract RNA from the HiIIA maize inbred line (with B chromosome) using Trizol reagent (Ambion, USA) according to the product manual, and then reverse-transcribe and synthesize cDNA using the FastKing cDNA First Strand Synthesis Kit (Tiangen, China) according to the product manual. Then, using the cDNA as a template, use the primer pair (forward: 5'-acgcgccgccagaacgacctc-3' (SEQ ID NO:3), reverse: 5'-tcgtcctctggtggtgcgggctaac-3' (SEQ ID NO:4)) and amplify the 5'-end sequence of the S91 gene transcript according to the PCR conditions in Example 2. The sequencing results show complete consistency with the predicted first exon, indicating that the predicted promoter can drive the downstream open reading frame.

[0072] 3) Determine the targeting sequence of CRISPR-Cas9

[0073] By confirming the promoter region and the first exon of S91, the range of the insertion point can be roughly determined, which is downstream of the promoter region and upstream of the first exon. A target sequence for CRISPR-Cas9 editing, 5'-gccccaaaccccagccgcat-3' (SEQ ID NO:5), was found in this region. CRISPR-Cas9 will create a nick at a position approximately 3 bp downstream of this sequence, which will then serve as the site for subsequent site-directed insertion of the DNA fragment.

[0074] Example 2. Site-directed insertion of genes into maize protoplast cells

[0075] 1. Construction of the vector HR04a-S91-AsRed required for the geminivirus system

[0076] 1) Construction of the HR04a vector

[0077] The replicon element LIR-RepA-SIR and the multiple cloning site (MCS) of BeYDV were synthesized according to its reference sequence (NCBI NO. DQ458791) into the pGH cloning vector (Shanghai Jierui Biotechnology Co., Ltd.).

[0078] First, a primer pair (forward: 5'- tatatcctgtcaaggcctgagggtcgtacgaataattcgtatccaacggaaatacc-3' (SEQ ID NO:6), reverse: 5'-aacgttatcag cttgcatgcgatatcaggtacttttgttctgcga-3' (SEQ ID NO:7)) was designed. According to the following PCR conditions, the target fragment LIR-RepA-SIR was amplified from the previously obtained pGH vector: pre-denaturation at 98°C for 2 min, 35 PCR cycles (98°C for 10 s, 55 - 60°C for 15 s, 72°C for 1 - 2 min). The PCR reaction system was: DNA polymerase (KOD One TM PCR Master Mix, Toyobo / Toyo Boseki Co., Ltd.) 1 μL, 10× buffer 5 μL, target template (100 ng / μL) 1 μL, upstream and downstream primers (10 pM) 1 μL each, and made up to 50 μL with ultrapure water. After PCR, the PCR product was purified using a PCR purification kit (Beijing TransGen Biotech Co., Ltd.) for later use.

[0079] Digest the pGreen0029 vector with SphI and StuI, ligate the fragment LIR-RepA-SIR into it to construct an intermediate vector. After correct sequencing, design primers (forward: 5'- aacgttatcagcttgcatgcgagggtcgtacgaataattcgtatccaac-3' (SEQ ID NO:8), reverse: 5'-aagtacctgatatcgcatggttgttgtga ctccgagggg-3' (SEQ ID NO:9)), amplify the target fragment LIR from the intermediate vector according to the above PCR reaction conditions, digest the intermediate vector with SphI, and ligate the fragment LIR into it to obtain the vector pHR04a ( Figure 1 A).

[0080] 2) Construction of the HR04a-S91-AsRed vector

[0081] Recombine the expression cassette AsRed-Tnos between the AscI and BstXI sites of pHR04a. Design a primer pair (forward: 5'-acgaccctcggcgcgcctgagacttttcaacaaagggtaatatccgga-3' (SEQ ID NO:10), reverse: 5'-acgtgacgtacccaaagctctgggatctagtaacatagatgacaccgcgc-3' (SEQ ID NO:11)), PCR amplify the target fragment AsRed-TNos, digest the pHR04a vector with AscI and BstXI, and ligate the fragment AsRed-Tnos into it to obtain the vector pHR04a-AsRed.

[0082] Construction of homologous arms: Design primer pairs (forward: 5'-ACGGCGCGCCCATAATCTCATAT-3' (SEQ ID NO:12), reverse: 5'-ATCCATGGTCGGATGGGGCTGCT-3' (SEQ ID NO:13)), using the above PCR reaction system and procedure, amplify a fragment about 1,000 bp upstream of the gRNA recognition site of the S91 gene from the genome of the maize line containing B chromosome (insertion at this position can utilize the promoter of S91 upstream), digest the pHR04a-AsRed vector with AscI and NcoI enzymes, and ligate the upstream fragment to obtain an intermediate vector; design primer pairs (forward: 5'-TACCAGAGCTTTGGCGCGTCCCGCCCC-3' (SEQ ID NO:14), reverse: 5'-CGCTCGAGACTGGATTCTCCCAGGAAAACAACA-3' (SEQ ID NO:15)), using the above primers, with the above PCR reaction system and procedure, amplify a fragment about 1,000 bp downstream of the gRNA recognition site of the S91 gene from the genome of the maize line containing B chromosome, digest the above intermediate vector with BstXI and XhoI enzymes, and ligate the downstream fragment to obtain HR04a-S91-AsRed ( Figure 1 B).

[0083] 2. Construction of gene editing vector for CRISPR-Cas9 system

[0084] Construction of CRISPR-Cas9 vector: The nucleic acid sequence recognized by gRNA downstream of the S91 gene promoter is 5'-GGGTTTGGGGCGGGACGCGT-3' (SEQ ID NO:16). Based on this, design two single-stranded DNAs, which are 5'- agca GGGTTTGGGGCGGGACGCGT-3' (SEQ ID NO:17) and 5'- aaac ACGCGTCCCGCCCCAAACCC-3' (SEQ ID NO:18). Hybridize the two single-stranded DNAs, and ligate the obtained double-stranded DNA fragment to the vector pU3-sgRNA digested with BbsI. Then add XmaI restriction sites to both ends of ZmU3-sgRNA by PCR, and finally ligate it to the pDMC1-Cas9 vector digested with XmaI (see Chinese Patent ZL201710599030.2) to obtain the S91 gene editing vector.

[0085] 3. Maize protoplast preparation and transformation

[0086] 1) Corn seedlings are cultured in a 28°C dark incubator for about one week. When the second leaf grows out, the central part of the young stem is taken out and chopped in a petri dish with a double-sided blade.

[0087] 2) The chopped samples are placed in a 100 mL Erlenmeyer flask containing 10 mL of enzyme solution, wrapped with tin foil, and vacuumed in the dark for 30 min in a vacuum pump. Then it is placed on a shaker and enzymatically digested in the dark at room temperature for 4 h at a rotation speed of 40 rpm. After the enzymatic digestion is completed, the enzyme solution is gently shaken to release the protoplasts.

[0088] 3) In a laminar flow hood, the enzyme solution is filtered through a 75 μm nylon filter membrane (pre-soaked in W5 solution) into a round-bottom centrifuge tube, and centrifuged at 100 g for 3 min (the centrifuge is set to accelerate at 3 and decelerate at 3), and the protoplasts are precipitated. The protoplasts are washed twice with an equal volume of W5 solution.

[0089] 4) Add 15 mL of W5 solution, gently suspend the protoplast cells, let it stand on ice for 25 min, carefully remove the supernatant, add an appropriate amount of MMG solution to resuspend the protoplast cells, and observe the state of the protoplasts under a phase contrast microscope to prepare for transformation.

[0090] 5) Add 10 μg of plasmid (divided into 2 groups. The first group includes the HR04a-AsRed vector with a 35S promoter added before AsRed, and the empty vector pJIT163-GFP (Feng et al., 2020) (the empty vector carries the GFP green fluorescent protein, which can make the successfully transformed cells produce green fluorescence, thus marking all the transformed positive cells); the second group includes HR04a-S91-AsRed and the CRISPR-Cas9 vector, and the empty vector pJIT163-UBI-hGFP) into a 2 mL centrifuge tube, add 190 μL of protoplast cells, add 200 μL of PEG4000 solution, gently flick to mix evenly, and transform in the dark at 25°C in a metal bath for 18 min.

[0091] 6) Add 1.4 mL of W5 solution, gently invert it up and down five times, let it stand for 5 min, centrifuge at 100 g for 3 min, and aspirate the supernatant with a pipette tip.

[0092] 7) Add 1.4 mL of W5 solution, gently invert it up and down to mix evenly, transfer it to a six-well plate pre-added with 1 mL of W5 solution, and culture it at 28°C in the dark for 16 - 24 h.

[0093] 8) Observe the samples with a confocal microscope (Zeiss LSM 710 NLO, Oberkochen, Germany).

[0094] The mother liquors required for the preparation of maize protoplast cells include: 0.2 M 2-(N-morpholino)ethanesulfonic acid (MES) (pH = 5.7; Sigma, USA), 0.8 M mannitol (Sigma, USA), 1 M CaCl2 (Sigma, USA), 2 M KCl (Sigma, USA), 2 M MgCl2 (Sigma, USA), and 10% (w / v) bovine serum albumin (BSA) (Sigma, USA). All were sterilized by filtration through a 0.45 μm filter membrane.

[0095] Table 1 Enzyme digestion solution formula

[0096]

[0097] Among them, Cellulase R10 and Macerozyme R10 were purchased from Yakult Company (Yakult Pharmaceutical Ind. Co., Ltd., Japan).

[0098] Table 2 W5 solution formula

[0099]

[0100] Table 3 MMG solution formula

[0101]

[0102] Table 4 PEG4000 solution formula

[0103]

[0104] 4. Results and discussion

[0105] The research results are shown in Figure 2 .

[0106] The transformed protoplast cells in Groups 1 and 2 could produce green fluorescence because they were transformed with the empty vector pJIT163-UBI-hGFP, showing the transformation efficiency of protoplasts ( Figure 2 A, Figure 2 C). Figure 2 A - B shows the same field of view of Group 1, Figure 2 C - D shows the same field of view of Group 2. Figure 2 A and 2C are the red and green fluorescence channels, Figure 2 B and 2D are only the red fluorescence channel. The transformed protoplast cells in Group 1 did not undergo homologous recombination, but the geminivirus could highly express the AsRed protein, producing red fluorescence ( Figure 2B). In the second group of transformed protoplast cells, homologous recombination occurred in the B chromosomes, and the open reading frame of AsRed was inserted at a specific site. It could be driven by the S91 gene promoter upstream and express the AsRed protein, presenting red fluorescence ( Figure 2 D). Flow cytometry detection found that the cells capable of producing red fluorescence after recombination accounted for 2.4% of the total cells. This indicates that the site-directed insertion technology combining CRISPR / Cas9 and geminivirus can achieve good results in maize protoplast cells. Figure 2 Both A and 2C had red fluorescence. Figure 2 The red fluorescence of A came from 35S-AsRed replicated by geminivirus rolling circle, which could express the red fluorescent protein. Figure 2 The red fluorescence of C came from the recombinantly inserted AsRed. Only when correctly inserted behind the S91 promoter could it express the red fluorescent protein.

[0107] Example 3. Site-directed insertion of genes in maize plants

[0108] 1. Construction of the vector HR04a-S91-Bar required for the geminivirus system

[0109] The expression cassette p35S-Bar-Tnos was recombined between the NcoI and BstXI sites of pHR04a-S91-AsRed (here NcoI enzyme was used because there is an AscI restriction site in p35S-Bar-Tnos, which needs to be avoided, and the NcoI site is next to the AscI site, both belonging to the multiple cloning sites). Primer pairs were designed (forward: 5'-gcccatggtgcgtattggctagag-3' (SEQ ID NO:19), reverse: 5'-gggacgcgccaaagctctgggatctagtaacatagatg-3' (SEQ ID NO:20)), and the target fragment p35S-Bar-Tnos was amplified by PCR from the pWY86 vector (Yuan et al., 2017) with the reaction system and procedure of Example 2. The pHR04a-S91-AsRed vector was digested with NcoI and BstXI, and the fragment 35S-Bar-Tnos was ligated into it to obtain the vector pHR04a-S91-Bar (since there was no suitable restriction site available after AsRed, the inventor used 35S-Bar-Tnos instead of AsRed-Tnos, rather than directly using 35S-Bar instead of AsRed).

[0110] 2. Agrobacterium-mediated transformation of maize immature embryos with B chromosomes

[0111] Maize Agrobacterium transformation mainly referred to the published method (Frame et al., 2002) with slight modifications.

[0112] 1) Agrobacterium transformation

[0113] Take 0.2 mL of Agrobacterium EHA105 competent cells (Fangwei Company), add 1 μg of plasmid DNA (including pHR04a - S91 - Bar, CRISPR - Cas9, and geminivirus helper vector pSoup (Vain, et al., 2003)), gently mix and place on ice for 30 min. Quick - freeze in liquid nitrogen for 1 min, thaw the competent cells in a 37°C water bath for 3 - 5 min, add 1 mL of YEP medium, and gently shake on a shaker at 28°C and 150 rpm for 2 - 4 h. Centrifuge at 5000 rpm for 1 min, discard the supernatant, resuspend with 0.2 mL of YEP solution, spread on a YEP solid plate containing Kana resistance, and culture at 28°C for 48 h. Detect the obtained colonies by PCR to identify whether they contain the three vectors.

[0114] 2) Agrobacterium infection: One day before the infection experiment, inoculate the positive Agrobacterium colonies obtained in step 1) into 10 mL of YEP medium, and shake - culture at 28°C and 200 rpm in a shaker for 16 - 20 h. Centrifuge to collect Agrobacterium and resuspend it in the infection medium (OD550 value is 0.3 - 0.4). Strip immature embryos (1.5 - 2.0 mm) from the young ears of the hybrid offspring of maize inbred lines HiIIA (containing B chromosomes) and HiIIB. Then place the young embryos in a 2 mL centrifuge tube containing the Agrobacterium - containing infection medium, invert 5 - 10 times and then let it stand for 5 min.

[0115] 3) Co - culture: The infected young embryos are then placed on sterile filter paper and immediately transferred to the co - culture medium, with the scutellum of the young embryos facing up. Then place them in an incubator and culture in the dark at 20°C for 3 days.

[0116] 4) Resting culture: After 3 days of co - culture, transfer all the young embryos to the resting medium, place them in an incubator, and culture in the dark at 28°C for 7 days.

[0117] 5) Selection culture of resistant calli: After 7 days of resting culture, transfer all the young embryos to selection medium I, place them in an incubator, and culture in the dark at 28°C for 14 days. Then transfer all the calli to selection medium II, place them in an incubator and culture in the dark at 28°C for 14 days. Repeat the sub - culture of the calli in selection medium II 3 - 5 times until all the resistant calli are gradually selected.

[0118] 6) Regeneration of resistant calli: After selective culture, when the selected resistant calli grow large enough, they are transferred to regeneration medium I and cultured in an incubator at 25 °C in the dark for 14 days. Then, the calli containing somatic embryos are selected and transferred to regeneration medium II, and cultured in an incubator at 25 °C under light until all seedlings are regenerated.

[0119] 7) Extract the genome of the regenerated seedling leaves and identify it by PCR.

[0120] Infection medium (pH 5.2)

[0121] 4 g / L N6 basal medium (Merck, Germany), 1.5 mg / L 2,4-D, 0.7 g / L L-proline, 68.4 g / L sucrose, 36 g / L glucose.

[0122] YEP liquid medium (pH 7.0)

[0123] 1 g of yeast extract, 5 g of beef extract, 5 g of peptone, 5 g of sucrose, 0.5 g of MgSO4•7H2O, dissolved in 1000 ml of water and autoclaved.

[0124] Co-culture medium (pH 5.8)

[0125] 4 g / L N6 basal medium (Merck, Germany), 1.5 mg / L 2,4-D, 0.7 g / L L-proline, 30 g / L sucrose, 3 g / L Gelrite, 5 mM silver nitrate, 100 mM acetosyringone (AS), 300 mg / L L-cysteine.

[0126] Resting medium (pH 5.8)

[0127] 4 g / L N6 basal medium (Merck, Germany), 1.5 mg / L 2,4-D, 0.7 g / L L-proline, 30 g / L sucrose, 0.5 g / L MES, 8 g / L agar, 5 mM silver nitrate, 100 mg / L cefotaxime, 100 mg / L vancomycin.

[0128] Selection medium I (pH 5.8)

[0129] 4 g / L N6 basal medium (Merck, Germany), 1.5 mg / L 2,4-D, 0.7 g / L L-proline, 30 g / L sucrose, 0.5 g / L MES, 8 g / L agar, 5 mM silver nitrate, 100 mg / L cefotaxime, 100 mg / L vancomycin, 1.5 mg / L bialaphos.

[0130] Selection medium II (pH 5.8)

[0131] 4 g / L N6 basal medium (Merck, Germany), 1.5 mg / L 2,4-D, 0.7 g / L L-proline, 30 g / L sucrose, 0.5 g / L MES, 8 g / L agar, 5 mM silver nitrate, 100 mg / L cefotaxime, 100 mg / L vancomycin, 1.5 mg / L bialaphos.

[0132] Regeneration medium I (pH 5.8)

[0133] 4.3 g / L Murashige & Skoog basal salt mixture (Merck, Germany), 100 mg / L inositol, 60 g / L sucrose, 3 g / L Gelrite, 100 mg / L cefotaxime.

[0134] Regeneration medium II (pH 5.8)

[0135] 4.3 g / L Murashige & Skoog basal salt mixture (Merck, Germany), 100 mg / L inositol, 60 g / L sucrose, 3 g / L Gelrite, 100 mg / L cefotaxime.

[0136] 3. Transgenic identification and site-specific insertion identification of homologous recombination were carried out on the regenerated maize seedlings

[0137] 1) Genomic DNA of the leaves of the regenerated seedlings was extracted by the CTAB method.

[0138] 2) Primer pairs (forward: 5'-ATGGGCCCAGAACGACGCC-3' (SEQ ID NO:21), reverse: 5'-TCAGATCTCGGTGACGGGCA-3' (SEQ ID NO:22)) were designed to detect the Bar gene fragment. Using the genomic DNA of each small seedling as a template, a positive PCR product indicates the insertion of the Bar gene, but the insertion site cannot be confirmed yet.

[0139] 3) Since the insertion sequence may have structural effects at both ends of the insertion site, directly performing PCR detection using primers on the two homologous arms on both sides is very likely to yield incorrect identification results. Performing PCR separately on both ends can avoid the structure and obtain more reliable identification results. Forward and reverse primers are designed on the left homologous arm and the inserted Bar gene respectively to detect whether the left-side sequence of the insertion site is correct. The primer pair is designed as (forward: 5'-CGCGCATCGGACGGCTGAGA-3' (SEQ ID NO:23); reverse: 5'-CCAGCTGCCAGAAACCCACGTCATG-3' (SEQ ID NO:24)). Additionally, forward and reverse primers are designed on the inserted Bar gene and the right homologous arm respectively to detect whether the right-side sequence of the insertion site is correct. The primer pair is designed as (forward: 5'- GAGCCGCAGGAACCGCAGGAGTG-3' (SEQ ID NO:25); reverse: 5'-CGGGCAGGTGGATCGGAGTCG-3' (SEQ ID NO:26)). If PCR on both sides of the regenerated plants can obtain products of the predicted size, PCR detection can be further performed using primers on the two homologous arms on both sides.

[0140] 4. Results and Discussion

[0141] The research results are shown in Figure 3 .

[0142] As Figure 3 shown, for the three sequences subjected to Blast comparison, from top to bottom, they are the genomic-related sequences of the transgenic plant 25273-3 that has been site-directed edited, the upstream and downstream sequences (not inserted) of the B chromosome site-directed insertion site, and the insertion sequence p35S-Bar-Tnos. It can be seen that the insertion sequence is complete, and the sequences at both ends of the insertion site also conform to the recombination expectation. A total of 9 transgenic events were obtained, and 3 plants were randomly selected from each transgenic event for detection. Among them, 1 was inserted completely correctly, and the recombination frequency was 3.7%.

[0143] In this study, the B chromosome was first used as a vector for inserting genes, which can be quickly transferred to the maize lines that need to be improved through hybridization without affecting the original agronomic traits of the maize lines. This improvement method does not require any transgenic operations on the maize lines themselves and is not restricted by genotypes. In addition, when performing gene editing with homologous recombination insertion on the B chromosome, on the one hand, the geminivirus system is used to provide a high concentration of recombination templates, and on the other hand, the promoter upstream of the B chromosome insertion site itself is used to reduce the length of the inserted fragment, both of which can greatly increase the homologous recombination frequency, thereby greatly improving the efficiency of site-directed insertion.

[0144] It should be understood that although the present invention has been specifically shown and described with reference to its exemplary embodiments, those of ordinary skill in the art should understand that various forms and details may be changed therein and any combination of various embodiments may be made without departing from the spirit and scope of the present invention as defined by the appended claims.

[0145] References:

[0146] Blavet, N., Yang, H., Su, H., Solansky, P., Douglas, R.N., et al.(2021). Sequence of the supernumerary B chromosome of maize provides insightinto its drive mechanism and evolution. Proc Natl Acad Sci USA. 118,e2104254118.

[0147] Butler, N.M., Baltes, N.J., Voytas, D.F., and Douches, D.S. (2016).Geminivirus-mediated genome editing in potato (Solanum tuberosum L.) usingsequence-specific nucleases. Front. Plant Sci. 7, 1045.

[0148] Cermak, T., Baltes, N.J., Cegan, R., Zhang, Y., Voytas, D.F., 2015.High-frequency, precise modification of the tomato genome. Genome Biol 16,232.

[0149] Collens, J.I., Mason, H.S., Curtis, W.R., 2007. Agrobacterium-mediated viral vector-amplified transient gene expression in Nicotianaglutinosa plant tissue culture. Biotechnol Prog 23, 570-576.

[0150] Dahan-Meir, T., Filler-Hayut, S., Melamed-Bessudo, C., Bocobza, S.,Czosnek, H., Aharoni, A., and Levy, A.A. (2018). Efficient in planta genetargeting in tomato using geminiviral replicons and the CRISPR / Cas9 system.Plant J. 95, 5-16.

[0151] Feng, C., Yuan, J., Wang, R., Liu, Y., Birchler, J.A. and Han, F.(2016). Efficient targeted genome modification in maize using CRISPR / Cas9system. J. Genet. Genomics 43, 37–43.

[0152] Feng, C., Yuan, J., Bai, H., Liu, Y., Su, H., Liu, Y., Shi, L., Gao,Z., Birchler, J.A., and Han, F. (2020). The deposition of CENH3 in maize isstringently regulated. Plant J. 102, 6-17.

[0153] Gil-Humanes, J., Wang, Y., Liang, Z., Shan, Q., Ozuna, C.V., Sanchez-Leon, S., Baltes, N.J., Starker, C., Barro, F., Gao, C., and Voytas, D.F..(2017). High-efficiency gene targeting in hexaploid wheat using DNA repliconsand CRISPR / Cas9. Plant J. 89, 1251-1262.

[0154] Halley-Stott, R.P., Tanzer, F., Martin, D.P., Rybicki, E.P., 2007.The complete nucleotide sequence of a mild strain of Bean yellow dwarf virus.Arch Virol 152, 1237-1240.

[0155] Hefferon, K.L., Dugdale, B., 2003. Independent expression of Rep andRepA and their roles in regulating bean yellow dwarf virus replication. J GenVirol 84, 3465-3472.

[0156] Hefferon, K.L., Fan, Y., 2004. Expression of a vaccine protein in aplant cell line using a geminivirus-based replicon system. Vaccine 23, 404-410.

[0157] Hefferon, K.L., Kipp, P., Moon, Y.S., 2004. Expression and purification of heterologous proteins in plant tissue using a geminivirus vector system. J Mol Microbiol Biotechnol 7, 109-114.

[0158] Huang, Z., Chen, Q., Hjelm, B., Arntzen, C., Mason, H., 2009. A DNA replicon system for rapid high-level production of virus-like particles in plants. Biotechnol Bioeng 103, 706-714.

[0159] Hummel, A.W., Chauhan, R.D., Cermak, T., Mutka, A.M., Vijayaraghavan, A., Boyher, A., Starker, C.G., Bart, R., Voytas, D.F., and Taylor, N.J. (2018). Allele exchange at the EPSPS locus confers glyphosate tolerance in cassava. Plant Biotechnol J. 16, 1275-1282.

[0160] Li, R., Mock, R., Huang, Q., Abad, J., Hartung, J., Kinard, G. (2008). A reliable and inexpensive method of nucleic acid extraction for the PCR-based detection of diverse plant pathogens. J Virol Methods. 154, 48-55.

[0161] Liu, L., Saunders, K., Thomas, C.L., Davies, J.W., Stanley, J., 1999. Bean yellow dwarf virus RepA, but not rep, binds to maize retinoblastoma protein, and the virus tolerates mutations in the consensus binding motif. Virology 256, 270 - 279.

[0162] Liu, L., van Tonder, T., Pietersen, G., Davies, J.W., Stanley, J., 1997. Molecular characterization of a subgroup I geminivirus from a legume in South Africa. J Gen Virol 78, 2113 - 2117.

[0163] Mor, T.S., Moon, Y.S., Palmer, K.E., Mason, H.S., 2003. Geminivirus vectors for high - level expression of foreign proteins in plant cells. Biotechnol Bioeng 81, 430 - 437.

[0164] Vain, P., Afolabi, A.S., Worland, B., Snape, J.W. (2003). Transgene behaviour in populations of rice plants transformed using a new dual binary vector system: pGreen / pSoup. Theor Appl Genet. 107, 210 - 217.

[0165] Vu, T.V., Sivankalyani, V., Kim, E.J., Doan, D., Tran, M.T., Kim, J., Sung, Y.W., Park, M., Kang, Y.J., and Kim, J.Y. (2020). Highly efficient homology-directed repair using CRISPR / Cpf1-geminiviral replicon in tomato. Plant Biotechnol J. 18, 2133-2143.

[0166] Wang, M., Lu, Y., Botella, J.R., Mao, Y., Hua, K., and Zhu, J.K. (2017). Gene targeting by homology-directed repair in rice using a geminivirus-based CRISPR / Cas9 system. Mol Plant. 10, 1007-1010.

[0167] Yuan, J., Shi, Q., Guo, X., Liu, Y., Su, H., Guo, X., Lv, Z., Han, F. (2017). Site-specific transfer of chromosomal segments and genes in wheat engineered chromosomes. J Genet Genomics. 44, 531-539.

[0168] Zhang, X., Mason, H. (2006). Bean Yellow Dwarf Virus replicons for high-level transgene expression in transgenic plants and cell cultures. Biotechnol. Bioeng. 93, 271-279.

[0169] Sequence

[0170] The nucleotide sequence of SEQ ID NO:27 LIR-RepA-SIR

[0171] gagtgtactt caagtcagtg ggaaatcaat aaaatgatta ttttatgaat atatttcattgtgcaagtag atagaaatta catatgttac ataacacacg aaataaacaa aaaaagacaa tccaaaaacaaacaccccaa aaaaaataat cactttagat aaactcgtat gaggagaggc acgttcagtg actcgacgattcccgagcaa aaaaagtctc cccgtcacac atgtagtggg tgacgcaatt atctttaaag taatccttctgttgacttgt cattgataac atccagtctt cgtcaggatt gcaaagaatt atagaaggga tcccaccttttattttcttc ttttttccat atttagggtt gacagtgaaa tcagactggc aacctattaa ttgcttccacaatgggacga acttgaaggg gatgtcgtcg atgatattat aggtggcgtg ttcatcgtag ttggtgaaatcgatggtacc gttccaatag ttgtgtcgtc cgagacttct agcccaggtg gtctttccgg tacgagttggtccgcagatg tagaggctgg ggtgtcggat tccattcctt ccattgtcct tgttaaatcg gccatccattcaaggtcaga ttgagcttgt tggtatgaga caggatgtat gtaagtataa gcgtctatgc ttacatggtatagatgggtt tccctccagg agtgtagatc ttcgtggcag cgaagatctg attctgtgaa gggcgacacatacggttcag gttgtggagg gaataatttg ttggctgaat attccagcca ttgaagcttt gttgcccattcatgagggaa ttcttccttg atcatgtcaa gatattcctc cttagacgtt gcagtctgga taatagttctccatcgtgcg tcagatttgcgaggagaaac cttatgatct cggaaatctc ctctggtttt aatatctccgtcctttgata tgtaatcaag gacttgttta gagtttctag ctggctggat attagggtga tttccttcaaaatcgaaaaa agaaggatcc ctaatacaag gttttttatc aagctggaga agagcatgat agtgggtagtgccatcttga tgaagctcag aagcaacacc aaggaagaaa ataagaaaag gtgtgagttt ctcccagagaaactggaata aatcatctct ttgagatgag cacttgggat aggtaaggaa aacatattta gattggagtctgaagttctt actagcagaa ggcatgttgt tgtgactccg aggggttgcc tcaaactcta tcttataaccggcgtggagg catggaggca ggggtatttt ggtcatttta atagatagtg gaaaatgacg tggaatttacttaaagacga agtctttgcg acaagggggg gcccacgccg aatttaatat taccggcgtg gcccccccttatcgcgagtg ctttagcacg agcggtccag atttaaagta gaaaatttcc cgcccactag ggttaaaggtgttcacacta taaaagcata tacgatgtga tggtatttga tggagcgtat attgtatcag gtatttccgttggatacgaa ttattcgtac gaccctc

[0172] SEQ ID NO:28 Nucleotide sequence of LIR

[0173] tagcagaagg catgttgttg tgactccgag gggttgcctc aaactctatc ttataaccggcgtggaggca tggaggcagg ggtattttgg tcattttaat agatagtgga aaatgacgtg gaatttacttaaagacgaag tctttgcgac aagggggggc ccacgccgaa tttaatatta ccggcgtggc ccccccttatcgcgagtgct ttagcacgag cggtccagat ttaaagtaga aaatttcccg cccactaggg ttaaaggtgttcacactata aaagcatata cgatgtgatg gtatttgatg gagcgtatat tgtatcaggt atttccgttggatacgaatt attcgtacga ccctc

[0174] SEQ ID NO:29 Nucleotide sequence of AsRed

[0175] atggcctctt tgctgaagaa gaccatgccc ttcaggacca ccatcgaggg caccgtgaacggccactact tcaagtgcac cggcaagggc gagggcaacc ccctggaggg cacccaggag atgaagatcgaggtgatcga gggcggcccc ctgcccttcg ccttccacat cctgtccacc tcctgcatgt acggctccaaggccttcatc aagtacgtgt ccggcatccc cgactacttc aagcagtccc tccccgaggg cttcacctgggagcgcacca ccacctacga ggacggcggc ttcctgaccg cccaccagga cacctccctg gacggcgactgcctggtgta caaggtgaag atcctgggca acaacttccc cgccgacggc cccgtgatgc agaacaaggccggccgctgg gagccctcca ccgagatcgt gtacgaggtg gacggcgtgc tgcgcggcca gtccctgatggccctggagt gccccggcgg tcgccacctg acctgccacc tgcacaccac ctaccgctcc aagaagcccgcctccgccct gaagatgccc ggcttccact tcgaggacca ccgcatcgag atcctggagg aggtggagaagggcaagtgc tacaagcagt acgaggccgc cgtgggccgc tactgcgacg ccgccccctc caagctgggccacaactga

[0176] SEQ ID NO:30 Nucleotide sequence of Tnos

[0177] gatcgttcaa acatttggca ataaagtttc ttaagattga atcctgttgc cggtcttgcgatgattatca tataatttct gttgaattac gttaagcatg taataattaa catgtaatgc atgacgttatttatgagatg ggtttttatg attagagtcc cgcaattata catttaatac gcgatagaaa acaaaatatagcgcgcaaac taggataaat tatcgcgcgc ggtgtcatct atgttactag atc

[0178] SEQ ID NO: 31 Nucleotide sequence of the S91 promoter

[0179] accaatccaa ccataatctc atatgcatcc atgcacaagc gggcttactg agggaagtgaagtccttgaa ggagagggac ttgaggttgg ggttgtgctc aacggagttg tcctcataga accagtgcgcctgctccagt aggaacagga tccgctcgaa cgactccagc tcctccttgg gcacattcag aaggaaccgactgcagagat gactcaactc agatttattt aagcaaatcc aataagaact aagaacttca gaggggtctagggcttaggg aaatacctgc agagatcgtc aagcagctct tgcggcggca gctgccccct cgatgaagaccggttcagtc ccccgccacc cgccatcgtc atccaccggc cagcgcgcct tccaagcgcc tgtttgtttgagataaggtt ttggttgtga gcagttagtt cgaagttcgt aggcatcaga tagccaaata gcttgaggttagagtacggg acgaggggtg ggaatacctg atttggtggg cgctcttctc cggcgcagat atcggcgaagttctcggcac cttgcgtagg gcggcggtag cccacccagt cgtcgcacgg agagggggag ggggaggaggggagagagag cacgcatgcg gtctgcgggg gccggttgcg gctcgtgcgg aggagggggg caggaggcggcgggatgatg tgcggaggag gggggcagga ggcggcggga cgatggggtg ctcgcacggt tggacgatgggggcggggcg atgcgtgggg gtgagactgc gcgcatcgga cggctgagag actctaaagt gtattggacggttgagatcg tcggaaggca gaacaagcag aggcagccta ccccttagag ccttaatagg tagtatagatatagatatag aaggggtaggctgtctccac ttggttctgc cttcagccaa tctgcaccgt cgatctatatcatcaaatct acaccgtccg ctagcagccc

[0180] SEQ ID NO:32 Nucleotide sequence of p35S

[0181] tgcgtattgg ctagagcagc ttgccaacat ggtggagcac gacactctcg tctactccaagaatatcaaa gatacagtct cagaagacca aagggctatt gagacttttc aacaaagggt aatatcgggaaacctcctcg gattccattg cccagctatc tgtcacttca tcaaaaggac agtagaaaag gaaggtggcacctacaaatg ccatcattgc gataaaggaa aggctatcgt tcaagatgcc tctgccgaca gtggtcccaaagatggaccc ccacccacga ggagcatcgt ggaaaaagaa gacgttccaa ccacgtcttc aaagcaagtggattgatgtg ataacatggt ggagcacgac actctcgtct actccaagaa tatcaaagat acagtctcagaagaccaaag ggctattgag acttttcaac aaagggtaat atcgggaaac ctcctcggat tccattgcccagctatctgt cacttcatca aaaggacagt agaaaaggaa ggtggcacct acaaatgcca tcattgcgataaaggaaagg ctatcgttca agatgcctct gccgacagtg gtcccaaaga tggaccccca cccacgaggagcatcgtgga aaaagaagac gttccaacca cgtcttcaaa gcaagtggat tgatgtgata tctccactgacgtaagggat gacgcacaat cccactatcc ttcgcaagac cttcctctat ataaggaagt tcatttcatttggagaggac acgctgaaat caccagtctc tctctacaaa tctatctctc tcgagtctac c

[0182] SEQ ID NO:33 Nucleotide sequence of Bar

[0183] atgggcccag aacgacgccc ggccgacatc cgccgtgcca ccgaggcgga catgccggcggtctgcacca tcgtcaacca ctacatcgag acaagcacgg tcaacttccg taccgagccg caggaaccgcaggagtggac ggacgacctc gtccgtctgc gggagcgcta tccctggctc gtcgccgagg tggacggcgaggtcgccggc atcgcctacg cgggcccctg gaaggcacgc aacgcctacg actggacggc cgagtcgaccgtgtacgtct ccccccgcca ccagcggacg ggactgggct ccacgctcta cacccacctg ctgaagtccctggaggcaca gggcttcaag agcgtggtcg ctgtcatcgg gctgcccaac gacccgagcg tgcgcatgcacgaggcgctc ggatatgccc cccgcggcat gctgcgggcg gccggcttca agcacgggaa ctggcatgacgtgggtttct ggcagctgga cttcagcctg ccggtaccgc cccgtccggt cctgcccgtc accgagatctga

[0184] SEQ ID NO:34 Nucleotide sequence of HM1-S91

[0185] cataatctca tatgcatcca tgcacaagcg ggcttactga gggaagtgaa gtccttgaaggagagggact tgaggttggg gttgtgctca acggagttgt cctcatagaa ccagtgcgcc tgctccagtaggaacaggat ccgctcgaac gactccagct cctccttggg cacattcaga aggaaccgac tgcagagatgactcaactca gatttattta agcaaatcca ataagaacta agaacttcag aggggtctag ggcttagggaaatacctgca gagatcgtca agcagctctt gcggcggcag ctgccccctc gatgaagacc ggttcagtcccccgccaccc gccatcgtca tccaccggcc agcgcgcctt ccaagcgcct gtttgtttga gataaggttttggttgtgag cagttagttc gaagttcgta ggcatcagat agccaaatag cttgaggtta gagtacgggacgaggggtgg gaatacctga tttggtgggc gctcttctcc ggcgcagata tcggcgaagt tctcggcaccttgcgtaggg cggcggtagc ccacccagtc gtcgcacgga gagggggagg gggaggaggg gagagagagcacgcatgcgg tctgcggggg ccggttgcgg ctcgtgcgga ggaggggggc aggaggcggc gggatgatgtgcggaggagg ggggcaggag gcggcgggac gatggggtgc tcgcacggtt ggacgatggg ggcggggcgatgcgtggggg tgagactgcg cgcatcggac ggctgagaga ctctaaagtg tattggacgg ttgagatcgtcggaaggcag aacaagcaga ggcagcctac cccttagagc cttaataggt agtatagata tagatatagaaggggtaggc tgtctccacttggttctgcc ttcagccaat ctgcaccgtc gatctatatc atcaaatctacaccgtccgc tagcagcccc atccga

[0186] SEQ ID NO:35 Nucleotide sequence of HM2-S91

[0187] cgcgtcccgc cccaaacccc agccgcatca gcgccaccag ccccatccat cctcctctccccatccgcat ccgccgctag cggccgaatg tcgcgcaggc cctgcaggag aagttcgacc tgctgcccaagaaccccgct ccgaggaggc cctgcgcaga tggcgcgacg ccgtcttcgt cgtcaagaac ccgcgccgccggttccgcat ggtcgccgac ctcgccacgc gccgccagaa cgacctcaag cgccgatcca cacaggtacgtaccgtgccg tgcccctact gctgctacta ctactacgac tcatcctcct gatcgaaccc ttgttgctagctctcgggaa ggagccaggt cgcccgcatc tctgcttttc catctccctt cattggatta actagacgatgaacagttac tttaggagcc tgtactccga ctccgatcca cctgcccgga gtaccacccg acgtccagactactagatct tagactacta cggtcctcca cattagggaa ccgatgggga agagagatag ctctagcgtttctgttgccg tccagccgta cccccacacc tcggccagat ggccggccgc cggcgggaga cgagacgagacgagccgcca cgatcggatc ggcgccccct cccattcacc gttcacgggc caaccgcagc cattgggccggcgtgaaacg aacgcgagct tccgggatcc caccaccaca tccctcccgg atgcccacgt tacgtcgccctgctattggt tccactcgac cggttcggtg cgggctccct ccacttgcac aatcgtagtc actcatttggcccaattata ttcaatctac taagattctg tcgctctgta caaattatta aacaaggaat gcatgctgcccctgttgttt gtttgccaaaccttactcga tcctcgtttt taacatagct aatccttgtt taaattacaatactcatcgg ctggatgcca aatggctcta catttttccc ctgttgtttt cctgggagaa tccagt

[0188] Partial coding region sequence of SEQ ID NO:36 S91

[0189] atgtcgcgca ggccctgcag gagaagttcg acctgctgcc caagaacccc gctccgaggaggccctgcgc agatggcgcg acgccgtctt cgtcgtcaag aacccgcgcc gccggttccg catggtcgccgacctcgcca cgcgccgcca gaacgacctc aagcgccgat ccacaca

[0190] The specific embodiments described above further elaborate on the purpose, technical solutions, and beneficial effects of the present invention. It should be understood that the above are only specific embodiments of the present invention and are not used to limit the present invention. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principles of the present invention shall be included within the protection scope of the present invention.

Claims

1. An S91 gene promoter for site-specific insertion of target genes and rapid introduction into corn strains, characterized in that: The sequence of the promoter is shown in SEQ ID NO:

31.

2. Use of the promoter according to claim 1 in corn breeding.

3. A corn breeding method, characterized in that: The method comprises the steps of inserting the target gene into the downstream of the S91 gene promoter as shown in SEQ ID NO:31, thereby inserting the target gene into the corn B chromosome, and then hybridizing the obtained transgenic positive plant containing the target gene inserted at a fixed position in the B chromosome with the corn variety to be improved and further self-pollinating.

4. The method according to claim 3, characterized in that The corn line to be improved does not contain a B chromosome.

5. A method for site-specific insertion of a target gene and rapid introduction into a corn strain, characterized in that: The method comprises the step of inserting the target gene into the maize B chromosome, and optionally, inserting the target gene into the maize B chromosome by inserting the target gene downstream of the S91 gene promoter as shown in SEQ ID NO:

31.

6. The method according to claim 5, characterized in that The target gene was inserted into the maize B chromosome using both CRISPR-Cas9 and Geminivirus systems.

7. The method according to claim 6, characterized in that The gRNA of the CRISPR-Cas9 system recognizes the nucleotide sequence shown in SEQ ID NO:16 downstream of the S91 gene promoter.

8. The method according to claim 6 or 7, characterized in that: The geminivirus system comprises a long intergenic region, a replicon and a short intergenic region of bean yellow dwarf virus. Optionally, the sequence of the long intergenic region+replicon+short intergenic region of bean yellow dwarf virus is as shown in SEQ ID NO:

27.

9. The method according to claim 8, characterized in that The Geminivirus system also comprises a long intergenic region as shown in SEQ ID NO:

28.

10. The method according to any one of claims 6 to 9, characterized in that The CRISPR-Cas9 system also includes a homologous left arm as shown in SEQ ID NO:34 and a homologous right arm as shown in SEQ ID NO:35.

Images