Application of LRK20 gene in regulation and control of rice disease resistance, related biological material and cultivation method

By studying the LRK20 gene in the L-type LecRLK family gene, and overexpressing using genetic engineering technology, the problem of insufficient resistance to striatric blight in rice was solved, and the disease resistance and striatric blight resistance of rice were significantly improved.

CN120192976APending Publication Date: 2025-06-24YANGZHOU UNIV
View PDF 0 Cites 2 Cited by

Patent Information

Application Number
CN202510348740.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-24
Publication Date
2025-06-24

AI Technical Summary

Technical Problem

The prior art is difficult to effectively improve the resistance of rice to striae blight, and most of the identified anti-stria blight QTL effects are not obvious.

Method used

By studying the role of L-type LecRLK family genes, especially the LRK20 gene, in the resistance to rice streak blight, genetic engineering technology is used to knock out and overexpress the LRK20 gene to improve the disease resistance of rice.

Benefits of technology

Through the overexpression of the LRK20 gene, the resistance to striatric blight in rice is significantly enhanced, the sensitivity of striatric blight is weakened, and new breeding application value is provided.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120192976A_ABST
    Figure CN120192976A_ABST
Patent Text Reader

Abstract

The invention discloses application of an LRK20 gene in regulation and control of rice disease resistance, a related biological material and a cultivation method. According to the application of the LRK20 gene in regulation and control of rice disease resistance, the sequence of the LRK20 gene is shown as SEQ ID NO.1, and the disease resistance is sheath blight resistance. The amino acid sequence of the protein coded by the LRK20 gene is as shown in SEQ ID NO. 2. The recombinant vector comprises the complementary sequence of the LRK20 gene in the application. The novel gene LRK20 for regulating and controlling the resistance of the rice sheath blight disease is obtained through identification, the sheath blight resistance gene LRK20 can regulate and control the resistance of the rice sheath blight disease, the resistance of the rice to the sheath blight disease can be remarkably weakened by knocking out the gene, and the resistance of the rice to the sheath blight disease can be remarkably enhanced by overexpressing the gene; therefore, the gene has a potential breeding application value in sheath blight resistance molecular breeding.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering, and specifically relates to the application of the LRK20 gene in regulating rice disease resistance, related biological materials and cultivation methods. Background Art

[0002] As one of the main fungal diseases of rice, sheath blight poses a serious threat to rice yield. With the increase in nitrogen fertilizer application, the popularization of compact varieties, and the improvement of planting density, the occurrence and spread of sheath blight show an increasing trend year by year, and its disease area ranks first among the three major rice diseases. At present, the control of sheath blight largely relies on chemical pesticides, which not only increases production costs but also has an adverse impact on the environment. Therefore, cultivating rice varieties resistant to sheath blight is the most economical, effective and environmentally friendly method.

[0003] However, the resistance of rice to sheath blight is a quantitative trait controlled by multiple genes. At present, 60 QTLs resistant to sheath blight have been identified, but through near-isogenic lines and multi-environment experiments, it has been proved that most QTLs have the problem of insignificant effects. In contrast, the combination of reverse genetics and omics technologies such as genomics and transcriptomics provides a new solution to this problem. By screening differentially expressed genes or gene sets related to specific traits using omics technologies and then using reverse genetics technologies for systematic verification and cloning, gene resources related to specific biological processes can be mined more comprehensively and efficiently.

[0004] Based on the transcriptome data of lemont inoculated with Rhizoctonia solani, we found that the expression levels of multiple genes in the L-type Lectin Receptor-like Kinases (L-type LecRLKs) family were significantly different before and after inoculation. Research has shown that LecRLK plays an important role in plant stress responses and is an indispensable regulatory factor in plant life activities. However, there are few reports on its role in regulating rice sheath blight resistance. Therefore, further studying whether L-type LecRLK family genes are involved in regulating rice sheath blight resistance has important practical significance and theoretical value. Summary of the Invention

[0005] In order to solve the problems existing in the prior art, the present invention provides the application of the LRK20 gene in regulating rice disease resistance, related biological materials and cultivation methods, which can effectively improve rice disease resistance and clarify the biological function of LRK20 in regulating sheath blight resistance.

[0006] The technical solution of the present invention is as follows:

[0007] Application of the LRK20 gene in regulating rice disease resistance, wherein the sequence of the LRK20 gene is as shown in SEQ ID NO.1, and the disease resistance is sheath blight resistance.

[0008] Furthermore, the amino acid sequence of the protein encoded by the LRK20 gene is as shown in SEQ ID NO.2.

[0009] A recombinant vector comprising the complementary sequence of the LRK20 gene in the above application.

[0010] A recombinant microorganism comprising the LRK20 gene in the above application or the above recombinant vector.

[0011] A method for cultivating high-disease-resistant rice, comprising overexpressing the LRK20 gene in the above application, or increasing the content of the protein in the above application, so as to increase the sheath blight resistance of the plant and reduce the susceptibility.

[0012] Furthermore, the overexpression process includes amplifying the CDS sequence of the LRK20 gene, recombinantly ligating it to the pU1301-GFP vector, transforming it through Escherichia coli and verifying by sequencing, and mediating the plasmid into rice after extraction.

[0013] Furthermore, the sequences of the adapter primer pair of the pU1301-GFP vector are as shown in SEQ ID NO.3 and SEQ ID NO.4.

[0014] The present invention identifies a new gene LRK20 that regulates rice sheath blight resistance. The sheath blight resistance gene LRK20 of the present invention positively regulates rice sheath blight resistance. Knocking out this gene significantly weakens the resistance of rice to sheath blight, and overexpressing this gene can significantly enhance the resistance of rice to sheath blight, indicating that the gene has potential breeding application value in molecular breeding for sheath blight resistance.

[0015] The recombinant vector and recombinant microorganism of the present invention can accurately participate in and complete the regulation process of the LRK20 gene, thereby significantly improving the resistance of plants to sheath blight.

[0016] The method for cultivating high-disease-resistant rice of the present invention obtains LRK20 gene-edited plants and overexpressing plants through genetic engineering, thereby cultivating transgenic plants with enhanced resistance to sheath blight. Description of the Drawings

[0017] Figure 1 It is the expression pattern of the LRK20 gene. Among them, A is the relative expression level of the LRK20 gene in response to different infection times of Rhizoctonia solani; B is the relative expression level of the LRK20 gene in different tissues.

[0018] Figure 2Creation and identification of LRK20 knockout and overexpression materials. Among them, A shows the nucleotide sequence changes of three LRK20 knockout lines (lrk20-ko1, lrk20-ko2, lrk20-ko3); B shows the protein sequence changes of three LRK20 knockout lines; C shows the detection of protein expression levels of LRK20 overexpression materials; D shows the transcriptional level detection of two LRK20 overexpression materials (LRK20-OE#1, LRK20-OE#3).

[0019] Figure 3 Results of sheath blight resistance identification of three LRK20 gene knockout lines and two overexpression lines in the growth chamber. Among them, A shows the sheath blight resistance identification phenotypes and lesion length results of three LRK20 gene knockout lines; B shows the sheath blight resistance identification phenotypes and lesion length results of two LRK20 gene overexpression lines. "**" indicates a highly significant difference at the 1% level, that is, P≤0.01. Scale = 5 cm. Detailed implementation manners

[0020] The present invention will be further described in detail below in combination with the detailed implementation manners. The examples given are only for clarifying the present invention, rather than limiting the scope of the present invention. The test materials used in the following examples can be obtained from commercial channels without special instructions.

[0021]

[0022] The amino acid sequence of the protein encoded by the LRK20 gene is shown in SEQ ID NO.2: MSFMLLLLLLLSLILNLASPTTAASGDGNGDQFIYSGFHGSNLTVDGAASITPDGLLQLTDGAAYLKGHAFHPSPVRLRRDVSTSTTTTTVRSFSVTFVFGIVSVYPDFSAHGMAFVVSPTTNLSSSLPAKYLGLTNVQNDGNASNHMLAVELDTIQSVEFRDINANHVGVDINGLQSVRAYNAGYYDDVSGEFRSLKLISRQAMQVWVDYHGGEKKQLDVTMAPLRMARPVKPLLSVTHDLSTVLADVVYLGFSAATGRVNSRHCVLGWSLGINGPAPAIDIDKLPKLPRAEPKPRSRVLEIVLPIVTATIVLVVGGAIVMVVRRRSRYAELREDWEVEFGPHRFSYKELFRATDGFADKHLLGSGGFGKVYRGVLPKSKLEVAVKKVSHESRQGMKEFVAEIVSIGRIRHRNLVQLLGYCRRKGELLLVYAYIPNGSLDKYLYSEEDKPILSWAQRFRIIKGIASGLLYLHERWEKVVVHRDIKAGNILLDKDMNGQLGDFGLARLYDHGTDSQTTHVVGTMGYLAPELIRTGKASPLTDVFAFGVFLLEVTCGQKPIKEKNPQGSHIALVDWVLEHWRDGSLMDTVDGRLHGEYDAGEAALVLKLGLLCSHPFAAARPGMGQVTCCLAGEAPLPELTPADMGFDVLAMMQDKGFDTSVVSYPDLMTSFGTISSLSGGR。

[0023] Knocking out the rice LRK20 gene by CRISPR / Cas9 reduces its resistance to sheath blight and enhances its susceptibility; overexpressing the rice LRK20 gene increases its resistance to sheath blight and reduces its susceptibility.

[0024] A method for cultivating rice with high disease resistance includes overexpressing the LRK20 gene in the above application, or increasing the content of the protein in the above application, so as to enhance the sheath blight resistance of the plant and reduce the susceptibility. The overexpression process includes amplifying the CDS sequence of the LRK20 gene, recombinantly ligating it to the pU1301-GFP vector, transforming it through Escherichia coli and verifying by sequencing, and mediating the plasmid into rice after extraction. The sequences of the adapter primer pairs of the pU1301-GFP vector are shown in SEQ ID NO.3: CGAACGATAGCCGGTACCATGTCTTTCATGCTTCTTCT and SEQ ID NO.4: GTCGACTCTAGAGGATCCTCGGGATACGACACGA.

[0025] The gene knockout vector pOs-Cas9-LRK20 for regulating the sheath blight resistance gene LRK20 in rice. The construction method is to design and synthesize the sgRNA that recognizes the target site: 5’-TCTACCTCGGCTTCTCGGCGG-3’ (SEQ ID NO.5), add adapters to the first 18 base sequences before CGG: LRK20-Cas9-F: 5'-TGTGGTCTACCTCGGCTTCTCGG-3' (SEQ ID NO.6), LRK20-Cas9-R: 5'-AAACCCGAGAAGCCGAGGTAGAC-3' (SEQ ID NO.7). Obtain the PCR product through primer annealing, ligate the PCR product with the digested linear vector pOs-Cas9, transform it through Escherichia coli and verify by sequencing, and finally obtain the gene editing vector pOs-Cas9-LRK20.

[0026] When the gene of the present invention is constructed into a plant expression vector, any general promoter, enhanced promoter or inducible promoter can be added before its transcription start nucleotide, such as the cauliflower mosaic virus (CAMV) 35S promoter, the ubiquitin promoter (Ubiquitin) of maize, and they can be used alone or in combination with other plant promoters; in addition, when using the gene of the present invention to construct a plant expression vector, enhancers can also be used, including translation enhancers or transcription enhancers. These enhancer regions can be the ATG start codon or the adjacent region start codon, etc., but must be in the same reading frame as the coding sequence to ensure the correct translation of the entire sequence. The sources of the translation control signal and the start codon are extensive and can be natural or synthetic. The translation initiation region can come from the transcription initiation region or the structural gene.

[0027] In order to facilitate the identification and screening of transgenic plant cells or plants, the plant expression vector used can be processed, such as adding genes that can be expressed in plants and encode enzymes or luminescent compounds that can produce color changes (GUS gene, luciferase gene, etc.), antibiotic markers with resistance (gentamicin marker, kanamycin marker, etc.), etc. The expression vector of the gene described in the present invention can be transformed into plant cells or tissues by conventional biological methods such as Agrobacterium-mediated, Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, and conductivity, and the transformed plant tissues can be cultivated into plants.

[0028] The rice genetic transformation material in the embodiment is the sheath blight susceptible variety NIP (Nipponbare): it is stored and provided by the rice germplasm resource bank of Yangzhou University.

[0029] Example 1. Identification and cloning of LRK20 gene

[0030] In order to screen for genes resistant to sheath blight, the transcriptome data of lemont inoculated with sheath blight (Cao et al, Plant Biotechnology Journal, 2021, 20, 335-349.) were analyzed and it was found that the expression levels of multiple L-type LecLRK genes in the LecLRK gene family were significantly different before and after inoculation, among which the LRK20 gene was significantly upregulated by sheath blight. Furthermore, the present invention conducted knockout and overexpression studies on it.

[0031] The cloning method of LRK20 gene comprises the following steps:

[0032] Using the genome of the sheath blight-susceptible variety NIP as a reference sequence, PCR amplification primers for the LRK20 gene were designed:

[0033] LRK20-F:5'-ATGTCTTTCATGCTTCTTCT-3'(SEQ ID NO.8),

[0034] LRK20-R: 5'-CTATCGGGATACGACACGA-3' (SEQ ID NO. 9).

[0035] The cDNA of the NIP variety susceptible to sheath blight was used as a template for PCR amplification. The PCR amplification method was referred to the instruction manual of NoviZan PhantaMax Super-Fidelity DNA Polymerase. The PCR amplification product was recovered and purified (Tiangen Ordinary Agarose Gel DNA Recovery Kit DP209) and sequenced (Qingke Biotechnology Co., Ltd.) to obtain the correct CDS sequence of the LRK20 gene.

[0036] The nucleotide sequence encoded by the rice LRK20 gene of the present invention is shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown in SEO ID NO.2.

[0037] Example 2: Analysis of the expression characteristics of the LRK20 gene

[0038] Cultivate NIP in a normal field environment until the late tillering stage and inoculate with the sheath blight pathogen. The strain is the moderately virulent strain YN-7 provided by the Plant Protection Department of Yangzhou University. Use the embedding method for inoculation (Pan Xuebiao, Journal of Jiangsu Agricultural College, 1997, (03): 28-33). Carefully embed a 1 cm long and 2 mm wide wood bark (covered with mycelium) with sheath blight mycelium into the leaf sheath 1 cm - 2 cm below the second-to-last leaf of the rice. Cut the rice leaf sheath tissue in the 1 cm section above and below the inoculum at 0 h (before inoculation), 6 h, 9 h, 12 h, 24 h, and 48 h after inoculation, and place it in liquid nitrogen for freezing and preservation. The experimental procedures of RNA extraction, reverse transcription, and qRT-PCR are the same as the steps for measuring the expression level of rice tissues described above.

[0039] Take RNA samples from different tissues (roots, stems, leaves, leaf sheaths, spikes) of the rice susceptible variety NIP at the booting stage, and extract the total RNA of each rice sample using the Trizol method. Use ⅢRT Super Mix for qPCR (Nanjing Novizan Biotech Co., Ltd.) reverse transcriptase to synthesize the first-strand cDNA, and the synthesis method is carried out according to the instructions of its reverse transcriptase. Using the cDNA of the above different tissues as a template, the rice OsActin gene as an internal reference gene, the quantitative primers of the OsActin gene qActin-F: 5’-CTAA GCCAAGAGGAGCTGTTAT-3’ (SEQ ID NO.10) and qActin-R: 5’-ATAACAGATAGGCCGGTTGAAA-3’ (SEQ ID NO.11), and using the specific quantitative primers of the LRK20 gene, qLRK20-F: 5’-CTCGCTTTCTGGGAAACAACAGC-3’ (SEQ ID NO.12), and qLRK20-R: 5’-CAATGTGCCGCTGCTTGAAAGG-3’ (SE Q ID NO.13), perform real-time quantitative PCR to detect the expression level of the LRK20 gene in different tissues of rice. The qRT-PCR reaction system is: 5 μL of qPCR Master Mix (Nanjing Novoprotein Scientific Inc.), 0.5 μL each of forward and reverse primers (10 μmol / L), and 5 μL of cDNA template (100 ng / μL). The qRT-PCR reaction was performed using a Bio-Rad CFX96 TouchTM fluorescence quantitative PCR instrument under the following conditions: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing and extension at 60°C for 30 s, for 40 cycles. The expression value data was converted and analyzed using the 2-ΔΔct method. The reaction conditions were: 95°C for 30 sec, 95°C for 10 sec, 60°C for 10 sec, for 40 cycles; 95°C for 15 sec, 60°C for 60 sec, 95°C for 15 sec to read the melting curve.

[0040] As Figure 1 shown in Figure 1 Figure

[0041] Example 3, Vector construction, Genetic transformation and Detection

[0042] 1. Steps for constructing the CRISPR / Cas9 editing vector for the rice LRK20 gene:

[0043] (1) Select highly efficient knockout target sites, design and synthesize sgRNAs that recognize the target sites, with the sequence sgRNA: 5’-TCTACCTCGGCTTCTCGGCGG-3’ (SEQ ID NO.5). Add adapters to the first 18 base sequences before CGG according to the following method, LRK20-Cas9-F: 5'-TGTGGTCTACCTCGGCTTCTCGG-3' (SEQ ID NO.6), LRK20-Cas9-R: 5'-AAACCCGAGAAGCCGAGGTAGAC-3' (SEQ ID NO.7).

[0044] (2) Obtain the intermediate product by primer annealing to introduce the knockout target of LRK20. The reaction system and conditions were: 1 μL of forward primer (10 μM), 1 μL of reverse primer (10 μM), 8 μL of Anneal Buffer (1xTE buffer, 50 mM NaCl), 95°C for 10 min, and cooled to 20°C at 0.1°C / sec.

[0045] (3) Use the restriction endonuclease BsaI (Takara) to shear the specific cleavage site on the pOs-Cas9 vector to linearize it. The enzyme digestion reaction system and conditions are as follows: 1 μg of plasmid, 5 μL of 10x buffer, 1 μL of BsaI, and supplemented with ddH2O to 50 μL. Incubate at 37 °C for 2 - 3 h, and recover according to the DNA purification kit (Tiangen ordinary agarose gel DNA recovery kit DP209).

[0046] (4) Ligate the annealed intermediate product with the digested linear pOs-Cas9 vector. The ligation reaction system and conditions are as follows: 2 μL of annealed product, 2 μL of linear vector, 0.5 μL of 10x T4 DNA Ligase Buffer, 0.5 μL of T4 DNA Ligase, and incubate at room temperature for 15 min.

[0047] (5) Transform Escherichia coli DH5α. After the DH5α competent cells are thawed, add the ligation product from the previous step, incubate on ice for 30 min, heat shock at 42 °C for 90 sec, place on ice for 2 min, add 700 μL of LB liquid medium without antibiotics, culture at 37 °C with 200 rpm for 1 h, centrifuge at 5000 rpm for 1 min, discard most of the supernatant, leave 100 μL of the liquid, pipette and mix well, spread on an LB solid medium plate containing kanamycin, and culture at 37 °C for 12 h.

[0048] (6) Pick a single colony and place it in a liquid LB liquid medium containing kanamycin, culture at 37 °C for 6 h, and perform a bacterial liquid PCR reaction. The PCR reaction is carried out according to the conventional PCR amplification instructions of Novizan 2×Taq Master Mix (Dye Plus). The primer sequences for the PCR reaction are as follows:

[0049] M13F: 5’-TGTAAAACGACGGCCAGT-3’ (SEQ ID NO.14),

[0050] LRK20-Cas9-R: 5'-AAACCCGAGAAGCCGAGGTAGAC-3' (SEQ ID NO.15),

[0051] Amplify the positive monoclonal bacterial liquid, extract the plasmid and perform sequencing verification. The plasmid extraction kit is (Novizan Plasmid Mini Kit), and the sequencing company is Tsingke Biotechnology Co., Ltd.

[0052] (7) The recombinant plasmid was transferred into Agrobacterium tumefaciens EHA105. The reaction system and conditions were as follows: 50 μL of EHA105 competent cells, 1 μL of recombinant plasmid, ice bath for 5 min, quick-freezing in liquid nitrogen for 5 min, water bath at 37 °C for 5 min, and ice bath for 5 min. Add 700 μL of LB liquid medium without antibiotics, culture at 28 °C with 200 rpm for 2 h, centrifuge at 5000 rpm for 1 min, discard most of the supernatant, leave 100 μL of the liquid, pipette and mix well, and spread it on an LB solid medium plate containing kanamycin and rifampicin antibiotics, and culture at 28 °C for two days.

[0053] (8) Pick a monoclonal colony and put it into liquid LB medium containing kanamycin and rifampicin, culture at 28 °C for two days, and perform colony PCR reaction, where the PCR reaction is the same as in step (6). The positive monoclonal bacterial liquid can be used for subsequent rice genetic transformation experiments.

[0054] 2. The construction steps of the overexpression vector are as follows:

[0055] (1) Using the CDS sequence of the LRK20 gene as a template, primers with pU1301-GFP vector adapters were designed and synthesized. The primer sequences were: LRK20_OE-F: CGAACGATAGCCGGTACCATGTCTTTCATGCTTCTTCT (SEQ ID NO.3) and LRK20_OE-R: GTCGACTCTAGAGGATCCTCGGGATACGACACGA (SEQ ID NO.4). The CDS sequence of the LRK20 gene was amplified using a high-fidelity enzyme (Novizan Phanta Max Super-Fidelity DNA Polymerase).

[0056] (2) The overexpression vector pU1301-GFP was digested with restriction enzymes KpnI and BamHI (Takara) to linearize it. The enzyme digestion reaction system and conditions were the same as in step 1(3).

[0057] (3) The CDS of the LRK20 gene was ligated to the linearized vector pU1301-GFP through a homologous recombination enzyme (Novizan II One Step Cloning Kit), and the recombinant plasmid pU1301-LRK20-GFP was obtained.

[0058] 3. The Agrobacterium tumefaciens bacterial liquids of the constructed knockout and overexpression vectors were sent to Weimi Biotechnology Co., Ltd. for rice genetic transformation, and the recipient rice variety was Nipponbare (NIP).

[0059] 4. Detection of transgenic rice plants.

[0060] (1) For the knockout plants, primers were designed and synthesized on both sides of the knockout target, and the obtained T0 transgenic plants were sequenced. The sequencing primer sequences were as follows:

[0061] LRK20-CXF: ATGCAGGTCTGGGTGGACTACCAT (SEQ ID NO.16), LRK20-CXR: GCTCGGCGTACCTCGATCTCCT (SEQ ID NO.17).

[0062] As Figure 2 shown in A, there are three types of mutations in the transgenic knockout lines. Among them, lrk20-ko1 inserted the base G, lrk20-ko2 inserted the base C, and lrk20-ko3 deleted the base C. All three types of these mutations led to frameshift mutations of the LRK20 protein ( Figure 2 B).

[0063] (2) For the overexpression plants, first, all T0 individual plants were detected by Western Blot using GFP antibody ( Figure 2 C); then, the RNA levels of two individual plants with relatively high protein-level expression, LRK20-OE#1 and LRK20-OE#3, were further detected. As Figure 2 shown in D, compared with the wild type, the expression levels of the LRK20 gene in the two overexpression lines were significantly increased. The primer sequences for qRT-PCR were qLRK20-F: 5’-CTCGCTTTCTGGGAAACAACAGC-3’ (SEQ ID NO.12), and qLRK20-R: 5’-CAATGTGCCGCTGCTTGAAAGG-3’ (SEQ ID NO.13).

[0064] Example 4. Identification of sheath blight resistance of transgenic rice plants

[0065] The wild type (WT, NIP), knockout lines (lrk20-ko1, lrk20-ko2, lrk20-ko3), and overexpression lines (LRK20-OE#1, LRK20-OE#3) of this gene were identified for sheath blight resistance using the in vitro resistance identification method in an artificial climate chamber.

[0066] The in vitro resistance identification method in an artificial climate chamber is as follows:

[0067] At the booting stage, select the main stems with consistent growth and the second leaf sheaths from the top. Cut the stems short from the base, trim the stems, retain 3 cm of the top leaf, remove the remaining leaves, and retain the stem length to 1 cm below the second leaf sheath. Immerse the stems in water and place them in an artificial climate chamber for pre-cultivation for 24 h. Build a 55 cm * 75 cm * 100 cm cuboid framework in the artificial climate chamber. Place a 60 cm * 80 cm bottom basin at the bottom, fill the basin with water, install a timing humidifier, and cover the cuboid framework with polyester film to form a moisturizing space with a humidity maintained at 75%-90%. Place the cultured bark 1 cm below the top leaf sheath, insert the stems into the floral foam, and place them in the cultivation room of the artificial climate chamber for 7 d. Inoculate no less than 10 stems for each material. Set the greenhouse lights for a 14 h light and 10 h dark day-night cycle, set the temperature to 30 °C during the day and 24 °C at night, and install a spray humidifier in the greenhouse to control the humidity of the entire greenhouse between 75%-90%. Replace the culture solution in the floral foam every two days during the cultivation period. Seven days after inoculation, differences in sheath blight lesions can be seen among different materials, and at this time, investigate the lesion lengths of the materials.

[0068] As Figure 3 shown in Figure A, the average lesion lengths of the three transgenic knockout lines lrk20-ko1, lrk20-ko2, and lrk20-ko3 were all extremely significantly higher than those of the wild type NIP; while the average lesion lengths of the two transgenic overexpression lines LRK20-OE#1 and LRK20-OE#3 were all extremely significantly lower than those of the wild type NIP ( Figure 3 Figure B). The results indicate that the LRK20 gene positively regulates rice sheath blight resistance, and the sheath blight resistance of rice can be significantly improved by overexpressing this gene.

[0069] Although the present invention has been described in detail with general descriptions, specific embodiments, and experiments above, based on the present invention, some modifications or improvements can be made, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection required by the present invention.

Claims

1. The application of LRK20 gene in regulating rice disease resistance is characterized in that: The sequence of the LRK20 gene is shown in SEQ ID NO.1, and the disease resistance is resistance to sheath blight.

2. The use according to claim 1, characterized in that: The amino acid sequence of the protein encoded by the LRK20 gene is shown in SEQ ID NO.

2.

3. A recombinant vector, characterized in that: It comprises the complementary sequence of the LRK20 gene in the use according to claim 1.

4. A recombinant microorganism, characterized in that It comprises the LRK20 gene in the use according to claim 1 or the recombinant vector according to claim 3.

5. A method for cultivating highly disease-resistant rice, characterized in that: The method comprises overexpressing the LRK20 gene in the application of claim 1, or increasing the content of the protein in the application of claim 2, so that the plant's resistance to sheath blight is increased and its susceptibility to disease is reduced.

6. The method according to claim 5, characterized in that The overexpression process includes amplifying the CDS sequence of the LRK20 gene, recombining and connecting it to the pU1301-GFP vector, transforming it through Escherichia coli and verifying it by sequencing, extracting the plasmid and then mediating it into rice.

7. The method according to claim 6, characterized in that The sequences of the linker primer pair of the pU1301-GFP vector are shown in SEQ ID NO.3 and SEQ ID NO.4.

Citation Information

Cited By

  • OsLRK19 gene and application thereof in enhancing sheath blight resistance of rice

    CN119913176A

  • OsLRK19 gene and its application in enhancing rice resistance to sheath blight

    CN119913176B