Aokap11 gene for improving kojic acid yield of aspergillus oryzae and application of Aokap11 gene

Abstract

The invention belongs to the technical field of microbial genetic engineering, and particularly relates to an Aokap11 gene for improving the kojic acid yield of aspergillus oryzae and application of the Aokap11 gene. The Aokap11 gene has any one of the following nucleotide sequences: 1) a nucleotide sequence as shown in SEQ ID NO.1; and 2) a nucleotide sequence which is generated by adding, substituting or deleting one or more basic groups from the nucleotide sequence as shown in SEQ ID NO.1 and is used for coding functional protein influencing aspergillus oryzae kojic acid synthesis. According to the invention, the Aokap11 gene is knocked out from recipient bacteria aspergillus oryzae through a gene editing technology, so that the function of the Aokap11 gene is lost or the expression quantity of the Aokap11 gene is weakened, and further the kojic acid yield of the aspergillus oryzae is remarkably improved.

Description

Technical Field

[0001] The present invention belongs to the technical field of microbial genetic engineering, and particularly relates to an Aokap11 gene for increasing kojic acid production of Aspergillus oryzae and its application. Background Art

[0002] Kojic acid is a kind of organic acid mainly produced by Aspergillus oryzae fermentation, which has various biological activities such as antibacterial, antioxidant and anti-tyrosinase, and has wide applications in the fields of food, medicine, cosmetics and agriculture. The market size of kojic acid in 2020 was 35 million US dollars. With the increasing maturity of the kojic acid and its derivative market, the market demand for kojic acid will continue to increase. Therefore, kojic acid is a product with great market prospects, and realizing the efficient synthesis of kojic acid is an important part of kojic acid research.

[0003] Currently, kojic acid fermentation mainly uses Aspergillus oryzae as the industrial production strain. However, the kojic acid production of Aspergillus oryzae strains isolated from nature can no longer meet the increasing demand for kojic acid. At present, the solution is to transform Aspergillus oryzae through mutagenesis and genetic engineering techniques in order to obtain high-yield kojic acid strains. However, the prerequisite for gene modification is the cloning of genes involved in kojic acid synthesis regulation. Therefore, exploring gene targets for increasing kojic acid production of Aspergillus oryzae is of great significance for realizing the efficient synthesis of kojic acid. Summary of the Invention

[0004] The purpose of the present invention is to overcome the deficiencies of the prior art and provide an Aokap11 gene for increasing kojic acid production of Aspergillus oryzae and its application.

[0005] To achieve the above purpose, the technical solution of the present invention is as follows:

[0006] The present invention provides an Aokap11 gene for increasing kojic acid production of Aspergillus oryzae, and the Aokap11 gene has any one of the following nucleotide sequences:

[0007] 1) Composed of the nucleotide sequence shown in SEQ ID NO.1;

[0008] 2) The nucleotide sequence shown in SEQ ID NO.1 is generated by adding, substituting or deleting one or several bases, and encodes a nucleotide sequence of a functional protein affecting kojic acid synthesis of Aspergillus oryzae.

[0009] Preferably, the nucleotide sequence of the functional protein affecting kojic acid synthesis of Aspergillus oryzae is shown in SEQ ID NO.3. The targeting sequence based on the CRISPR / Cas9 technology can inhibit the expression or activity of the Aokap11 gene as shown in the nucleotide sequence of SEQ ID NO.3, so that the function of the Aokap11 gene is lost or the expression level is weakened, thereby increasing the kojic acid production of Aspergillus oryzae.

[0010] The present invention also provides the application of the Aokap11 gene in increasing the kojic acid production of Aspergillus oryzae.

[0011] As a preferred embodiment of the application of the present invention, in the application, the Aokap11 gene is knocked out in Aspergillus oryzae by gene editing technology to disrupt the open reading frame of the Aokap11 gene in Aspergillus oryzae, thereby increasing the kojic acid production of Aspergillus oryzae.

[0012] As a preferred embodiment of the application of the present invention, the gene editing technology includes CRISPR / Cas9 technology.

[0013] The present invention also provides a method for constructing Aspergillus oryzae with high kojic acid production, and the method is to knock out the Aokap11 gene in Aspergillus oryzae by gene editing technology.

[0014] Preferably, the method is to knock out the Aokap11 gene in Aspergillus oryzae through a CRISPR / Cas9 recombinant vector; the CRISPR / Cas9 recombinant vector is a pPTRII-Cas9-Aokap11 vector containing an sgRNA specifically targeting the Aokap11 gene; the nucleotide sequence of the sgRNA specifically targeting the Aokap11 gene is as shown in SEQ ID NO.3.

[0015] Preferably, the specific steps for knocking out the Aokap11 gene in Aspergillus oryzae by gene editing technology are as follows:

[0016] 1) Select a target sequence in the Aokap11 gene for increasing the kojic acid production of Aspergillus oryzae; wherein, the nucleotide sequence of the Aokap11 gene target sequence is as shown in SEQ ID NO.3;

[0017] 2) Synthesize primers PU6-Aokap11-R and primer TU6-Aokap11-F with the Aokap11 gene target sequence;

[0018] 3) Using the pPTRII-Cas9-kojA plasmid as a template, amplify the Aspergillus oryzae U6 promoter PU6 according to primer PU6-F and primer PU6-Aokap11-R to obtain the PU6-Aokap11 target sequence; and amplify the sgRNA and the Aspergillus oryzae U6 terminator TU6 according to primer TU6-Aokap11-F and primer TU6-R to obtain the sgRNA-Aokap11 target sequence;

[0019] 4) Use primers PU6-F and TU6-R to perform overlapping PCR amplification on the PU6-Aokap11 target sequence and the sgRNA-Aokap11 target sequence to obtain a PU6-Aokap11-sgRNA-TU6 expression cassette fragment containing the Aspergillus oryzae U6 promoter PU6, the Aokap11 gene target sequence, sgRNA, and the Aspergillus oryzae U6 terminator TU6;

[0020] 5) Recombinantly ligate the linearized pPTRII-Cas9 vector with the PU6-Aokap11-sgRNA-TU6 expression cassette fragment to obtain a CRISPR / Cas9 recombinant vector for knocking out the Aokap11 gene;

[0021] 6) Introduce the CRISPR / Cas9 recombinant vector into the recipient Aspergillus oryzae to obtain an Aspergillus oryzae engineering strain with high kojic acid production.

[0022] Preferably, the CRISPR / Cas9 recombinant vector is introduced into the recipient Aspergillus oryzae by using conventional biotechnological methods such as Agrobacterium-mediated, Ti plasmid, and direct DNA transformation.

[0023] More preferably, the recipient Aspergillus oryzae is Aspergillus oryzae 3.042.

[0024] More preferably, in step 2), the sequence of primer PU6-Aokap11-R is as shown in SEQ ID NO.4, and the sequence of primer TU6-Aokap11-F is as shown in SEQ ID NO.5; in step 3), the sequence of primer PU6-F is as shown in SEQ ID NO.6, and the sequence of primer TU6-R is as shown in SEQ ID NO.7.

[0025] More preferably, the method of knocking out the Aokap11 gene in Aspergillus oryzae using gene editing technology further includes amplifying the target region of the Aokap11 gene in the Aspergillus oryzae engineering strain obtained in step 6) using primers CRISPR-S-Aokap11-F and CRISPR-S-Aokap11-R, thereby obtaining an Aokap11 gene knockout engineering strain; wherein:

[0026] The sequence of primer CRISPR-S-Aokap11-F is as shown in SEQ ID NO.10;

[0027] The sequence of primer CRISPR-S-Aokap11-R is as shown in SEQ ID NO.11.

[0028] The beneficial effects of the present invention are as follows:

[0029] (1) The present invention provides a new gene capable of increasing the kojic acid production of Aspergillus oryzae: the Aokap11 gene. By using gene editing technology to knockout the Aokap11 gene in the recipient strain Aspergillus oryzae, the function of the Aokap11 gene is lost or its expression level is weakened, thereby significantly increasing the kojic acid production of Aspergillus oryzae. The present invention provides a new gene resource for increasing the kojic acid production of Aspergillus oryzae.

[0030] (2) The present invention provides a method for efficiently and site-specifically knocking out the Aokap11 gene. The present invention discovers that using the nucleotide sequence from the 99th to the 118th position downstream of the translation start codon of the Aspergillus oryzae Aokap11 gene (SEQ ID NO.3) as the target sequence can achieve efficient and site-specific knockout of the Aokap11 gene, improving the efficiency of constructing an Aspergillus oryzae engineering strain with high kojic acid production by Aokap11 gene mutation. Brief Description of the Drawings

[0031] Figure 1 It is a schematic diagram of the mutation type of the nucleotide sequence of the Aokap11 gene in the homozygous mutant strain of the Aokap11 gene under the background of wild-type Aspergillus oryzae 3.042.

[0032] Figure 2 It is a schematic diagram of the mutation type of the amino acid sequence of the Aokap11 gene in the homozygous mutant strain of the Aokap11 gene under the background of wild-type Aspergillus oryzae 3.042.

[0033] Figure 3 It is a graph showing the analysis results of the kojic acid production of Aspergillus oryzae 3.042 and the Aokap11 mutant. Detailed Embodiments

[0034] The present invention will be further described in detail below in conjunction with the drawings and specific embodiments. The provided embodiments are only for clarifying the present invention and not for limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements and do not constitute any limitation to the present invention in any way.

[0035] The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following embodiments can be obtained from commercial sources unless otherwise specified.

[0036] The Aspergillus oryzae strain in the following embodiments: Aspergillus oryzae 3.042 (CICC 40092), which can be obtained by the public from the China Center for Industrial Culture Collection of Microorganisms.

[0037] The CRISPR-Cas9 vector in the embodiments of the present invention is the pPTRII-Cas9 vector, which has been described in Yuzhen Li #,Huanxin Zhang # ,Junxia Fan # ,Ziming Chen,Tianming Chen,Bin Zeng,Zhe Zhang*A highly efficient identification of mutants generated by CRISPR / Cas9 using the non-functional DsRed assisted selection in Aspergillus oryzae, World Journal of Microbiology and Biotechnology, 2021, 37:132. The public can obtain it from the College of Life Sciences, Jiangxi University of Science and Technology. This biological material is only used for repeating the relevant experiments of this invention and cannot be used for other purposes.

[0038] Example 1: Gene alignment

[0039] Obtain the nucleotide sequence (CDS sequence) of the AoKap11 gene on NCBI, as shown in SEQ ID NO.1, and the amino acid sequence of the encoded protein is as shown in SEQ ID NO.2.

[0040] SEQ ID NO.1:

[0041]

[0042] SEQ ID NO.2:

[0043] MRILAINLILAASALALDQAPLQLQDSSSGNIPDIIRNNDTHGRPNIVFILVDDQDLQMDSLSYTPHTNHYIRDQGVFYKNHFVTTALCCPSRVSLWTGKQAHNTNVTEIYPPYGGYPKFVSEGHNENWLPLWLQDAGYNTYYTGKLFNAHTVDNYNLPFAKGFNTSDFVLDPYTYQYLHPVYQRNHDPPISYSGQHTIDVLRKKALDLLDDAVAESHERPFFLTIAPIAPHSNFEMTNASDYTTFRFSAPIPLERHKDLFPEVKVPRTEHFNPDQPSGVNWISTLPQQNQSSIDSNDEFYRARLRALQGVDEIVEQIVQRLEDAGVLDNTYIFYTSDNGYHIGQHRLHPGKECGFEEDIRVPMFIRGPGIPSGEEVGFVTTHIDLAPTIFEIAGLDLKEEFDGTPVPLTARDVEEEKLSKGRHEHVNVEYWGKAGFEGEMSRAPDGGPIAFRNNTYKALRVLGEGYNLYYSVWCTNEHELYDLTTDPYELNNLHPSVSGNIEQKLLGYPIQKVISRLDALLLVLKSCKGLTCVKPWEVLHPAGDVQTLSDALDDVFDVFYDEQIKVEYGWCEEGYIVEAEGPQVPAIYQGTRWSDWW

[0044] Example 2: Construction of Aokap11 gene knockout vector for increasing kojic acid production in Aspergillus oryzae

[0045] 1) Design of Aokap11 gene target sequence

[0046] Using the CDS sequence of the Aokap11 gene of Aspergillus oryzae RIB40 as a reference, the Cas9 target sites of the CDS sequence of the Aokap11 gene were analyzed using the CRISPRdirect web server (https: / / crispr.dbcls.jp / ), and the target sequence of the Aokap11 gene was designed. Its nucleotide sequence is shown in SEQ ID NO.3. At the same time, primers PU6-Aokap11-R and primer TU6-Aokap11-F with the Aokap11 gene target sequence were designed. The 3' ends of primer PU6-Aokap11-R and primer TU6-Aokap11-F have 28-29 nt (nucleotide) paired with the Aspergillus oryzae U6 promoter PU6 and sgRNA, respectively. The sequence of primer PU6-Aokap11-R is shown in SEQ ID NO.4, and the sequence of primer TU6-Aokap11-F is shown in SEQ ID NO.5.

[0047] SEQ ID NO.3: GGACATCATCCGCAACAATG

[0048] SEQ ID NO.4: GGACATCATCCGCAACAATGACTTGTTCTTCTTTACAATGATTTATTTA

[0049] SEQ ID NO.5: CATTGTTGCGGATGATGTCCGTTTTAGAGCTAGAAATAGCAAGTTAAA

[0050] 2) Construction of the sgRNA expression cassette by overlap PCR

[0051] Using the pPTRII-Cas9-kojA plasmid as a template (the pPTRII-Cas9-kojA plasmid has been described in Yuzhen Li # , Huanxin Zhang # , Junxia Fan #,Ziming Chen,Tianming Chen,Bin Zeng,Zhe Zhang*A highly efficient identification of mutants generated by CRISPR / Cas9 using the non-functional DsRed assisted selection in Aspergillus oryzae,World Journal of Microbiology and Biotechnology,2021,37:132), The pPTRII-Cas9-kojA plasmid contains the Aspergillus oryzae U6 promoter PU6, sgRNA and the Aspergillus oryzae U6 terminator TU6 sequence. The Aspergillus oryzae U6 promoter PU6 was amplified according to the primer PU6-F (SEQ ID NO.6) and the primer PU6-Aokap11-R (SEQ ID NO.4) to obtain the PU6-Aokap11 target sequence containing the Aspergillus oryzae U6 promoter PU6 and the Aokap11 gene target sequence; the sgRNA and the Aspergillus oryzae U6 terminator TU6 were amplified using the primers TU6-Aokap11-F (SEQ ID NO.5) and TU6-R (SEQ ID NO.7) to obtain the sgRNA-Aokap11 target sequence containing the Aokap11 gene target sequence, sgRNA and the Aspergillus oryzae U6 terminator TU6. The amplification reaction system is shown in Table 1. The PCR reaction program is shown in Table 2.

[0052] SEQ ID NO.6: CGACTCTAGAGGATCCCCGGGTAATGCCGGCTCATTCAAA

[0053] SEQ ID NO.7: AATTCGAGCTCGGTACCCGGGAGCAGCTCTATATCACGTGACG

[0054] Table 1 50 μL amplification reaction system

[0055] Component Volume Aspergillus oryzae RIB40 DNA 1 μL Primer (10 μM) 4 μL dNTP (10 mM each) 1 μL 5× Buffer 10 μL Enzyme 1 μL <![CDATA[ddH2O]]> 33 μL

[0056] Table 2 PCR reaction program

[0057] Step Temperature Time Pre-denaturation 95℃ 3 min Denaturation 95℃ 15 sec Annealing 55℃ 15 sec Extension 72℃ 1 kb / 1 min Final extension 72℃ 5 min

[0058] The PCR reaction program shown in Table 2 is as follows: pre-denaturation at 95 °C for 3 min; denaturation at 95 °C for 15 s, annealing at 55 °C for 15 s, extension at 72 °C for 1 min, 35 cycles; final extension at 72 °C for 5 min.

[0059] Take 1 μL of the PCR products of the PU6-Aokap11 target sequence and the sgRNA-Aokap11 target sequence respectively, and perform overlapping PCR amplification using primer PU6-F (SEQ ID NO.6) and primer TU6-R (SEQ ID NO.7). The overlapping PCR amplification reaction system is shown in Table 3. The PCR reaction program is as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 55°C for 15 s, extension at 72°C for 1 min, for 35 cycles; final extension at 72°C for 5 min. The amplified PCR products are detected by electrophoresis, and the PU6-Aokap11-sgRNA-TU6 expression cassette fragment containing the Aspergillus oryzae U6 promoter PU6, the Aokap11 gene target sequence, sgRNA, and the Aspergillus oryzae U6 terminator TU6 is obtained through PCR product recovery, that is, the constructed sgRNA expression cassette is obtained.

[0060] Table 3 50 μL amplification reaction system for overlapping PCR

[0061] Component Volume PCR product of PU6-Aokap11 target sequence 1 μL PCR product of sgRNA-Aokap11 target sequence 1 μL Primer PU6-F (10 μM) 2 μL Primer TU6-R (10 μM) 2 μL dNTP (10 mM each) 1 μL 5× Buffer 10 μL Enzyme 1 μL <![CDATA[ddH2O]]> 32 μL

[0062] 3) Recombinantly ligate the constructed sgRNA expression cassette to the Cas9 vector

[0063] Digest the pPTRII-Cas9 vector with the restriction endonuclease Sma I (37°C, 1 h). The digestion system is as follows: 2 μg of pPTRII-Cas9 vector, 5 μL of 10×QuickCut Green Buffer, 2 μL of Sma I, and make up to 50 μL with ddH2O. After the digestion products are confirmed to be cut by agarose gel electrophoresis, the linearized pPTRII-Cas9 vector is recovered using a PCR product recovery kit (Novoprotein), and then the linearized pPTRII-Cas9 vector and the PU6-Aokap11-sgRNA-TU6 expression cassette fragment are recombinantly ligated using a seamless cloning kit (Novoprotein). The specific recombinant ligation procedure is shown in Table 4.

[0064] Table 4 Recombinant ligation reaction system

[0065]

[0066] React at 37°C for 30 min to obtain the ligation product pPTRII-Cas9-Aokap11 vector, which is the CRISPR / Cas9 recombinant vector for knocking out the Aokap11 gene.

[0067] 4) Escherichia coli transformation and identification

[0068] Take 2.5 μL of the above ligation product and add it to the freshly thawed Escherichia coli DH5α strain (TransGen Biotech). Transform using the heat shock method, screen for positive clones on an ampicillin-resistant LB plate, pick single clones, and perform a bacterial liquid PCR amplification reaction after shaking the bacteria at 37 °C for 12 hours. The primers used for the PCR amplification reaction are primer pPTRII-F (SEQ ID NO.8) and primer pPTRII-R (SEQ ID NO.9). The PCR amplification reaction system and the PCR reaction program are shown in Table 1 and Table 2 respectively. Detect the target band by electrophoresis, which is approximately around 750 bp. Select the positive bacterial liquid, shake the bacteria overnight at 37 °C (12 hours), and extract the pPTRII-Cas9-Aokap11 vector using a plasmid miniprep kit (Tiangen).

[0069] SEQ ID NO.8: TGCATGCCTGCAGGTCGACT

[0070] SEQ ID NO.9: AAGGGGGATGTGCTGCAAGG

[0071] Example 3: Construction of an Aokap11 gene knockout engineering strain for improving kojic acid production in Aspergillus oryzae

[0072] 1) Transformation of Aspergillus oryzae protoplasts

[0073] ① Use the PEG-CaCl2-mediated protoplast transformation method with the wild-type Aspergillus oryzae 3.042 (CICC 40092) strain as the genetic transformation recipient bacterium.

[0074] ② First, lyse the Aspergillus oryzae mycelia cultured overnight (16 - 20 hours) with 1% Yatalase (TaKaRa) and 1.5% lyticase (Sigma) to prepare Aspergillus oryzae protoplasts.

[0075] ③ Then mix the above-constructed pPTRII-Cas9-Aokap11 vector, Aspergillus oryzae protoplasts, and PEG-CaCl2 solution, and let it stand at room temperature in the dark for 20 min.

[0076] ④ After that, terminate the reaction with a buffer solution (1.2 M sorbitol, 50 mM CaCl2·2H2O, 35 mM NaCl, 10 mM Tris-HCl, pH 7.5), and centrifuge to collect the protoplasts.

[0077] ⑤Finally, mix the protoplasts with M+Met medium containing 0.1 μg / ml pyrithiamine (0.2% NH4Cl, 0.1% NH4SO4, 0.05% KCl, 0.05% NaCl, 0.1% KH2PO4, 0.05% MgSO4·7H2O, 0.002% FeSO4·7H2O, 2% glucose, 0.15% methionine, 1.2 M sorbitol, 0.5% agar, pH 5.5), pour it onto the M+Met medium plate containing 0.1 μg / ml pyrithiamine and 1.5% agar, and culture at 30 °C for 3-5 days.

[0078] 2) Identification of Aokap11 gene knockout engineering bacteria

[0079] Transfer the mycelia obtained from the above transformation culture to CD medium containing 0.1 μg / ml pyrithiamine (2% glucose, 0.2% sodium nitrate, 0.1% potassium dihydrogen phosphate, 0.05% magnesium sulfate, 0.05% potassium chloride, 0.05% sodium chloride, 0.002% ferrous sulfate, pH 5.5). After culturing at 30 °C for 3-5 days, pick the mycelia and put them into a centrifuge tube, add 100 μL of 25 mM NaOH solution, and heat at 100 °C for 20 min. Using the supernatant as a template, amplify the target region of the Aokap11 gene with primer CRISPR-S-Aokap11-F (SEQ ID NO.10) and primer CRISPR-S-Aokap11-R (SEQ ID NO.11). The enzyme used for the PCR amplification reaction is KOD DNA polymerase (TOYOBO). The amplification reaction system and PCR reaction program are shown in Table 5 and Table 6.

[0080] SEQ ID NO.10: GGCTATTAACTTAATTCTGGCAGCGT

[0081] SEQ ID NO.11: ATCCACGGTGTGCGCGTTAA

[0082] Table 5 50 μL amplification reaction system

[0083] Component Volume Template 2 μL Primer (10 μM) 4 μL dNTP (2 mM each) 4 μL 2× Buffer 25 μL DNA polymerase 1 μL <![CDATA[ddH2O]]> 14 μL

[0084] Table 6 PCR reaction program

[0085]

[0086] The amplified PCR product stock solution was sequenced and analyzed, and the results showed that two Aokap11 mutants, namely Aokap11 gene knockout engineered bacteria (ΔAokap11-1 and ΔAokap11-2), were found. The ΔAokap11-1 mutant had a continuous deletion of 11 bases at 98 bp downstream of the start codon of the Aokap11 gene, and the deleted nucleotides were CGGATATCATT; the ΔAokap11-2 mutant had a single base deletion at 102 bp downstream of the start codon of the Aokap11 gene, and the deleted nucleotide was T (see Figure 1 , Figure 1 The yellow arrows indicate the targeting sequences).

[0087] Example 4: Determination of kojic acid production of Aokap11 gene knockout engineered bacteria for improving kojic acid production in Aspergillus oryzae

[0088] The newly collected Aspergillus oryzae 3.042 strain (WT), Aokap11 gene knockout engineered bacteria ΔAokap11-1 and Aokap11 gene knockout engineered bacteria ΔAokap11-2 were inoculated into liquid kojic acid fermentation medium (100 g / L glucose, 1 g / L potassium hydrogen phosphate, 0.5 g / L magnesium sulfate, 0.5 g / L potassium chloride, 1 g / L yeast extract). Fermentation was carried out at 30 ° C and 200 rpm for 7 days. The kojic acid content was determined by the iron sulfate colorimetric method. The specific operation was as follows: 2 mL of fermentation broth was taken, 500 μL of fermentation supernatant was aspirated after centrifugation, 500 μL of ddH2O and 1000 μL of FeCl3-HCl colorimetric solution (0.06 M FeCl3 and 0.27 M HCl) were added and mixed. The fermentation supernatant was replaced with water as a control, the absorbance at a wavelength of 500 nm was measured, and the kojic acid concentration in the fermentation broth of each strain was calculated by the kojic acid standard curve. At the same time, the mycelium in the fermentation broth was collected and dried at 60°C to constant weight, and the dry weight of mycelium was determined. The kojic acid production of the strain was the kojic acid concentration of the strain divided by the dry weight of mycelium (mg / ml·g). 3+ A red complex can be formed, so the kojic acid content can be qualitatively indicated by FeCl3 color development. The kojic acid color development results showed that the red color of the fermentation broth of the Aokap11 gene knockout engineered bacteria was significantly darker than that of the wild-type Aspergillus oryzae 3.042 strain, indicating that knocking out the Aokap11 gene can increase the kojic acid production of Aspergillus oryzae (see the kojic acid color development results for Figure 3as shown in A of Figure 3 ). The kojic acid production measurement results show that: the kojic acid production of the wild-type Aspergillus oryzae 3.042 strain in the control group is 14.62 mg / ml·g. Compared with the wild-type Aspergillus oryzae 3.042 strain, the kojic acid production of the Aokap11 gene knockout engineered strains ΔAokap11-1 and ΔAokap11-2 has increased by more than 200%, and the average has reached 49.03 mg / ml·g. Among them, the kojic acid production of the Aokap11 gene knockout engineered strain ΔAokap11-1 is 46.11 mg / ml·g, and the kojic acid production of the Aokap11 gene knockout engineered strain ΔAokap11-2 is 51.94 mg / ml·g (see the kojic acid production measurement results in Figure 3 B of

[0089] Obviously, the above-mentioned embodiments of the present invention are merely examples for more clearly explaining the present invention, rather than limiting the implementation manners of the present invention. For those of ordinary skill in the art, other different forms of changes or modifications can be made on the basis of the above description. It is impossible to list all the implementation methods here. Any obvious changes or modifications derived from the technical solutions of the present invention still fall within the protection scope of the present invention.

Claims

1. An Aokap11 gene for increasing kojic acid production in Aspergillus oryzae, characterized in that: The Aokap11 gene has any one of the following nucleotide sequences: 1) The nucleotide sequence shown in SEQ ID NO.1; 2) The nucleotide sequence shown in SEQ ID NO.1 is generated by adding, replacing or deleting one or several bases, and encodes a nucleotide sequence that affects the functional protein of kojic acid synthesis in Aspergillus oryzae.

2. The Aokap11 gene for improving kojic acid production in Aspergillus oryzae according to claim 1, characterized in that The nucleotide sequence of the functional protein affecting kojic acid synthesis of Aspergillus oryzae is shown in SEQ ID NO.

3.

3. Use of the Aokap11 gene according to claim 1 in improving the kojic acid production of Aspergillus oryzae.

4. A method for constructing Aspergillus oryzae with high kojic acid production, characterized in that: The Aokap11 gene was knocked out in Aspergillus oryzae using gene editing technology.

5. The method for constructing Aspergillus oryzae with high kojic acid production according to claim 4, characterized in that: The Aokap11 gene was knocked out in Aspergillus oryzae by using a CRISPR / Cas9 recombinant vector; the CRISPR / Cas9 recombinant vector was a pPTRII-Cas9-Aokap11 vector containing an sgRNA specifically targeting the Aokap11 gene; the nucleotide sequence of the sgRNA specifically targeting the Aokap11 gene was shown in SEQ ID NO.

3.

6. The method for constructing Aspergillus oryzae with high kojic acid production according to claim 4, characterized in that: The specific steps of knocking out the Aokap11 gene in Aspergillus oryzae using gene editing technology are as follows: 1) selecting a target sequence from the Aokap11 gene for improving the kojic acid production of Aspergillus oryzae; wherein the nucleotide sequence of the Aokap11 gene target sequence is shown in SEQ ID NO.3; 2) synthesizing primers PU6-Aokap11-R and TU6-Aokap11-F with the target sequence of the Aokap11 gene; 3) Amplifying the Aspergillus oryzae U6 promoter PU6 using primer PU6-F and primer PU6-Aokap11-R to obtain the PU6-Aokap11 target sequence; and amplifying the sgRNA and Aspergillus oryzae U6 terminator TU6 using primer TU6-Aokap11-F and primer TU6-R to obtain the sgRNA-Aokap11 target sequence; 4) Using primer PU6-F and primer TU6-R, overlapping PCR amplification was performed on the PU6-Aokap11 target sequence and the sgRNA-Aokap11 target sequence to obtain a PU6-Aokap11-sgRNA-TU6 expression cassette fragment containing the Aspergillus oryzae U6 promoter PU6, the Aokap11 gene target sequence, sgRNA and the Aspergillus oryzae U6 terminator TU6; 5) Recombining and ligating the linearized pPTRII-Cas9 vector with the PU6-Aokap11-sgRNA-TU6 expression cassette fragment to obtain a CRISPR / Cas9 recombinant vector for knocking out the Aokap11 gene; 6) Introducing the CRISPR / Cas9 recombinant vector into the recipient Aspergillus oryzae to obtain an engineered Aspergillus oryzae strain with high kojic acid production.

7. The method for constructing Aspergillus oryzae with high kojic acid production according to claim 6, characterized in that: The receptor Aspergillus oryzae is Aspergillus oryzae 3.

042.

8. The method for constructing Aspergillus oryzae with high kojic acid production according to claim 6, characterized in that: In step 2), the sequence of primer PU6-Aokap11-R is shown as SEQ ID NO.4, and the sequence of primer TU6-Aokap11-F is shown as SEQ ID NO.5; in step 3), the sequence of primer PU6-F is shown as SEQ ID NO.6, and the sequence of primer TU6-R is shown as SEQ ID NO.

7.

9. The method for constructing Aspergillus oryzae with high kojic acid production according to claim 6, characterized in that: The method further comprises amplifying the target region of the Aokap11 gene in the Aspergillus oryzae engineered strain obtained in step 6) using primers CRISPR-S-Aokap11-F and primers CRISPR-S-Aokap11-R, thereby obtaining an Aokap11 gene knockout engineered strain; wherein: The sequence of primer CRISPR-S-Aokap11-F is shown in SEQ ID NO.10; The sequence of primer CRISPR-S-Aokap11-R is shown in SEQ ID NO.11.

Images