Application of ABC transporter family gene OsABCC16 in plant breeding regulation
By overexpressing the OsABCC16 gene in rice, the problem of cadmium accumulation in rice caused by cadmium pollution is solved, and the effect of improving cadmium tolerance and reducing cadmium accumulation is achieved, ensuring food safety and sustainable agricultural development.
Patent Information
- Application Number
- CN202411546784.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-01
- Publication Date
- 2025-06-24
AI Technical Summary
Heavy metal cadmium is seriously polluted, affecting the sustainable development of agriculture and food safety. It is difficult for the existing technology to effectively reduce the accumulation of cadmium in rice.
By overexpressing the ABC transporter family gene OsABCC16 in rice, plants can improve their tolerance to cadmium and reduce their accumulation of cadmium in the grains.
It significantly improves the tolerance of rice to cadmium, reduces the cadmium content in the grains, reduces the threat of cadmium pollution to food safety and human health, and ensures the yield and nutritional quality of rice.
Smart Images

Figure CN120192999A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of plant genetic engineering, and particularly to the application of genes of the ABC transporter family OsABCC16 in the regulation of plant breeding. Background Art
[0002] The problem of heavy metal pollution in farmland soil is becoming increasingly serious, especially cadmium (Cd) pollution. Cd pollution has become a major problem restricting the sustainable development of agriculture. Cd is a non-essential heavy metal element that is toxic to both plants and humans and is listed as a Group 1 human carcinogen by the International Agency for Research on Cancer (IARC). Cd pollution mainly comes from the deposition of industrial waste gas, the irrigation of mining and smelting wastewater, the emission of automobile exhaust, and the burning of garbage and crop straw. In addition, the large-scale use of Cd-containing chemical fertilizers and organic fertilizers in agricultural production is also a major source of pollution. At the same time, heavy metal-containing waste gas in the atmosphere seeps into farmland in the form of rainwater, further deteriorating the heavy metal pollution problem of the soil. Under the action of these pollution sources, farmland soil accumulates continuously, posing a huge threat to the farmland ecosystem and food security.
[0003] After being absorbed by plants from the roots in the soil, Cd will be transported to the above-ground parts. More importantly, it will be transported to the edible parts of grains. Cd is more easily absorbed from the soil and migrates into the food chain compared to other heavy metals, posing a serious threat to food safety and human health. If Cd accumulates excessively in plants, it will also disrupt their nutritional balance, damage proteins, DNA, and cell membranes in plants, and lead to the accumulation of toxic reactive oxygen species in plants, thus seriously affecting the growth and yield of plants. Among them, rice, as an important food crop globally and the staple food in many countries and regions, its production safety is particularly important. Research shows that rice has a higher ability to absorb Cd than other grains, and in some countries and regions, the main source of Cd intake in the population comes from rice, with a contribution rate as high as 56%. Therefore, exploring the mechanism of Cd absorption, transport, and accumulation in rice, as well as exploring related regulatory genes, will help cultivate rice varieties with low Cd accumulation, ensuring food security and human health.
[0004] ABC transporters are a large class of conserved proteins in the biological world and are very important in plants. In the biological world, the ABC transporter family currently includes 8 subfamilies from ABCA to ABCI, but the ABCH subfamily is lacking in plants. ABC transporters usually contain two characteristic domains that cooperate with each other, namely the transmembrane domain (TMD) and the nucleotide binding domain (NBD). These two domains drive the transport of several substrates across biological membranes by virtue of the energy released from ATP hydrolysis. These substrates include small inorganic and organic molecules (such as amino acids, sugars, nucleosides, vitamins, and metal ions, etc.) and large organic compounds (such as peptides, lipid molecules, oligonucleotides, and polysaccharides, etc.). By regulating the transmembrane transport of these substrates, ABC transporters participate in regulating various important physiological processes in plants, such as the metabolism of hormones and lipids, the opening and closing of stomata, and the transport of metal ions, enabling plants to cope with various biotic or abiotic stresses and thus adapt to the changing environment.
[0005] It remains to be further explored and studied for each gene in the ABC transporter family and how to use the genes in the ABC transporter family to avoid the accumulation of Cd in plants. Summary of the Invention
[0006] The object of the present invention is to overcome the disadvantages and deficiencies of the prior art and provide the application of genes in the ABC transporter family OsABCC16 in plant breeding regulation.
[0007] The object of the present invention is achieved by the following technical solutions: The application of genes in the ABC transporter family OsABCC16 in plant breeding regulation, wherein the amino acid sequence of the protein encoded by the ABC transporter gene OsABCC16 is as shown in SEQ ID No:2.
[0008] Furthermore, the nucleotide sequence of the genes in the ABC transporter family OsABCC16 is as shown in SEQ ID No:1.
[0009] Furthermore, the plant breeding regulation refers to overexpressing the genes in the ABC transporter family in plants OsABCC16 , improving the cadmium tolerance of plants, increasing the plant biomass, and reducing the cadmium content in plant grains.
[0010] Furthermore, the plant is a gramineous plant; more specifically, it is at least one of wheat, corn, and rice; even more specifically, it is rice.
[0011] The above-mentioned genes in the ABC transporter familyOsABCC16 Use in improving the cadmium tolerance of plants and / or preparing / cultivating plant varieties with low cadmium accumulation in grains.
[0012] Furthermore, the plant is a gramineous plant; more specifically, it is at least one of wheat, corn, and rice; even more specifically, it is rice.
[0013] A plant expression vector and a host cell containing the above ABC transporter family gene OsABCC16 Use in improving the cadmium tolerance of plants and / or preparing / cultivating plant varieties with low cadmium accumulation in grains.
[0014] Furthermore, the plant is a gramineous plant; more specifically, it is at least one of wheat, corn, and rice; even more specifically, it is rice.
[0015] A method for enhancing the cadmium tolerance of plants and / or reducing the cadmium content in plant grains, including the step of overexpressing the ABC transporter gene OsABCC16 of overexpression.
[0016] Furthermore, the plant is a gramineous plant; more specifically, it is at least one of wheat, corn, and rice; even more specifically, it is rice.
[0017] The present invention has the following advantages and effects compared with the prior art: (1) By overexpressing the ABC transporter family gene in rice in the present invention, under Cd stress, OsABCC16 the growth of overexpressing lines is significantly better than that of the wild type, and the Cd content in the grains of overexpressing lines is significantly lower than that of the wild type; at the same time, OsABCC16 the overexpressing lines have no obvious adverse effects on the rice yield-related traits and the absorption of essential metal elements. OsABCC16 It can be used as a potential candidate gene for cultivating rice varieties with low Cd accumulation to reduce the threat of Cd pollution to food safety and human health, and at the same time provide a potential remediation method for the treatment of Cd pollution in rice. OsABCC16
[0018] OsABCC16 (2) By overexpressing the ABC transporter family gene in the present invention, it can effectively improve the Cd tolerance of rice and reduce the Cd content in rice grains, providing candidate gene resources for low-Cd molecular breeding of rice and the treatment of Cd pollution. Description of the Drawings
[0019] Figure 1 OsABCC16 For the rice ABC transporter family gene OsABCC16Gene information diagram; in the diagram, the blank rectangle and the black line in the middle represent the 5'untranslated region (UTR), the blank pentagon represents the 3'UTR, the black rectangle represents the exon, the black line is the intron, and the double arrow below the diagram represents the coding sequence (CDS) region of the gene.
[0020] Figure 2 It is a schematic diagram of the GFP empty vector pCAMBIA35s-EGFP for protein subcellular localization.
[0021] Figure 3 It is the observation of the subcellular localization of the rice ABC transporter family member OsABCC16 in rice protoplasts. (a) is the subcellular localization result diagram in rice protoplasts; (b) is the subcellular localization result diagram in tobacco mesophyll cells. The excitation wavelength and observation wavelength for GFP observation are 488 nm and 507 nm respectively, emitting green fluorescence; the excitation wavelength and emission wavelength of the membrane marker protein OsRac3-Mcherry are 587 nm and 610 nm respectively, emitting red fluorescence; among them, the scale of the OsABCC16 subcellular localization diagram is 130 μm.
[0022] Figure 4 It is the gene of the rice ABC transporter family OsABCC16 The detection result diagram of the relative expression levels under different concentrations of Cd (0, 1, 10, 100 μM CdCl2) treatment, with 3 independent biological replicates; t Test; * represents P <0.05; ** represents P <0.01.
[0023] Figure 5 It is the gene of the rice ABC transporter family OsABCC16 The detection result diagram of the relative expression levels at different time points during cultivation under the condition of a final concentration of 10 μM CdCl2, with 3 independent biological replicates for the experiment; t Test; * represents P <0.05; ** represents P <0.01.
[0024] Figure 6 It is the gene of the rice ABC transporter family OsABCC16 The detection result diagram of the relative expression levels under different metal element treatments (100 μM); among them, CK is the blank control, using the rice Actin1 gene ( Os10g0510000 ) as the internal reference gene, with 3 independent biological replicates for the experiment; t Test; * representsP <0.05.
[0025] Figure 7 It is a gene of the rice ABC transporter family OsABCC16 Graph of the detection results of the relative expression levels in different growth stages and various tissue parts of rice; The experiment was repeated 3 times independently biologically.
[0026] Figure 8 Schematic diagrams of the gene overexpression vector and knockout vector; among them, (a) is the map of the rice gene overexpression vector pOX (containing 5×flag tag); (b) is the map of the CRISPR / gRNA intermediate vector; (c) is the map of the pYLCRISPR / Cas9-MH binary expression vector.
[0027] Figure 9 It is OsABCC16 Gene overexpression lines ( OE-C16-1 , OE-C16-2 ), knockout lines ( cas-c16-1 , cas-c16-2 ), and phenotypic observation and growth trait statistical charts of the wild type (ZH11); among them, (a) is after culturing for 7 days under hydroponic conditions without Cd and with 10 μM CdCl2 and 100 μM CdCl2, OsABCC16 Overexpression lines ( OE-C16-1 , OE-C16- 2 ), knockout lines ( cas-c16-1 , cas-c16-2 ), and phenotypic observation results of the wild type (ZH11), the scale bar is 5 cm; (b) is after culturing for 7 days under conditions with Cd (100 μM CdCl2; +Cd) or without Cd (-Cd), OsABCC16 Overexpression lines ( OE-C16-1 , OE-C16-2 ), knockout lines ( cas-c16-1 , cas-c16-2 ), and plant height statistical results of the wild type (ZH11); (c) is after culturing for 7 days under conditions with Cd (100 μM CdCl2; +Cd) or without Cd (-Cd), OsABCC16 Overexpression lines ( OE-C16-1 , OE- C16-2 ), knockout lines ( cas-c16-1 , cas-c16-2 ), and fresh weight statistical results of the wild type (ZH11); (d) is after culturing for 7 days under conditions with Cd (100 μM CdCl2; +Cd) or without Cd (-Cd), OsABCC16 Overexpression lines ( OE-C16-1 , OE- C16-2 ), knockout lines (cas-c16-1 , cas-c16-2 ), and dry weight statistics results of the wild type (ZH11); 3 independent biological replicates; t test; * represents P <0.05; ** represents P <0.01.
[0028] Figure 10 After being cultured in a Cd-containing solution with a final concentration of 100 μM for 7 days, OsABCC16 Overexpression lines of the gene ( OE-C16-1, OE-C16-2 ), knockout lines ( cas-c16-1, cas-c16-2 ), and test result graphs of wild-type rice (ZH11); among them, (a) is the graph of Cd content determination results in the aboveground part and roots, (b) is the graph of Cd content determination results in xylem sap; the experiment was repeated 3 times independently, t test, * represents P <0.05, ** indicates P <0.01.
[0029] Figure 11 In the Cd-polluted soil cultivation experiment OsABCC16 Overexpression lines ( OE-C16-1 , OE-C16-2 ), knockout lines ( cas-c16-1 , cas-c16-2 ), and phenotypic observation and yield trait statistics result graphs of the wild type (ZH11); among them, (a) is the phenotypic observation result graph of overexpression lines ( OsABCC16 Overexpression lines ( OE-C16-1 , OE-C16-2 ), knockout lines ( cas-c16- 1 , cas-c16-2 ), and the wild type (ZH11) in the Cd-polluted soil cultivation experiment, the scale bar is 20 cm; (b–e) are the graphs of plant height (b), effective tiller number (c), seed setting rate (d), and yield per plant (e) of overexpression lines ( OsABCC16 Overexpression lines ( OE-C16-1 , OE-C16-2 ), knockout lines ( cas-c16-1 , cas-c16-2 ), and the wild type (ZH11) at the mature stage in the Cd-polluted soil cultivation experiment; the experiment was repeated 3 times independently; t test; * represents P <0.05, ** indicates P <0.01.
[0030] Figure 12 In the Cd-polluted soil cultivation experiment OsABCC16 Overexpression lines of the gene ( OE-C16-1, OE-C16- 2 ), knockout lines (cas-c16-1, cas-c16-2 Analysis results of Cd content and essential metal element content in grains of the transgenic rice (ZH11-OsHMA3) and wild-type rice (ZH11); (a) shows the analysis results of Cd content, and (b) shows the analysis results of essential metal element content; the experiment was repeated independently for 3 biological replicates. t Test; * represents P < 0.05; ** represents P < 0.01. Detailed implementation manners
[0031] The present invention will be further described in detail below in conjunction with the embodiments and the accompanying drawings, but the implementation manners of the present invention are not limited thereto.
[0032] For the test methods without specific experimental conditions noted in the following embodiments, they are usually carried out according to conventional experimental conditions or the experimental conditions recommended by the manufacturer. Unless otherwise specified, the construction of the vectors (including gene knockout vectors, overexpression vectors, subcellular localization vectors) mentioned in the embodiments is carried out according to the operation methods in the conventional genetic engineering field. The sequences of the backbone vector pCAMBIA-1300, promoter elements (including 35S, Ubi), reporter genes (including GFP), etc. are all sequences publicly available on relevant websites or databases in the genetic engineering field (https: / / cambia.org and https: / / www.ncbi.nlm.nih.gov); pCAMBIA35s-eGFP can be obtained through conventional commercial channels. The materials, reagents, etc. used, unless otherwise specified, are reagents and materials obtained from commercial channels. The chemical reagents used in the embodiments are all imported or domestic analytical pure.
[0033] The pOx vector was provided by Academician Liu Yaoguang of the State Key Laboratory of Conservation and Utilization of Subtropical Agro-bioresources, South China Agricultural University. The pOx vector has been disclosed in the article "Li YH, Yang YQ, Liu Y, Li CX, Zhao YH, Li ZJ, Liu Y, Jiang DG, Li J, Zhou H, Chen JH, Zhuang CX, Liu ZL. Overexpression of OsAGO1b induces adaxially rolled leaves by affecting leaf abaxial sclerenchymatous cell development in rice. Rice (N Y), 2019, 12(1): 60. "
[0034] The pYLCRISPR / Cas9-MH and CRISPR / gRNA vectors were provided by Academician Liu Yaoguang of the State Key Laboratory of Conservation and Utilization of Subtropical Agro-Bioresources, South China Agricultural University. The pYLCRISPR / Cas9-MH and CRISPR / gRNA have been disclosed in the article "Zeng Dongchang, Ma Xingliang, Xie Xianrong, Zhu Qinlong, Liu Yaoguang. Operational methods for constructing plant CRISPR / Cas9 multi-gene editing vectors and mutation analysis. Science China: Life Sciences. 2018, 48(7): 783-794. doi: 10.1360 / N052018-00069."
[0035] Unless otherwise specified in the examples, the rice used was wild-type Zhonghua 11 rice, which was obtained commercially.
[0036] Example 1 (1)Structure of the rice ABC transporter family gene OsABCC16 The retrieval number in the GenBank database (https: / / www.ncbi.nlm.nih.gov) is Os11g0155600. This gene is located on chromosome 11 of rice, and its DNA is 8396 bp (SEQ ID No: 1), containing 12 exons and 11 introns (as OsABCC16 shown), and the predicted length of the encoded protein amino acid sequence is 1483 amino acids (SEQID No: 2). Figure 1 The mRNA length of the gene is 5204 bp, and the CDS length is 4452 bp. OsABCC16
[0037] (2)Subcellular localization analysis of the rice ABC transporter gene OsABCC16 According to the conventional operation methods in the field of genetic engineering, green fluorescent protein (GFP) was fused to the C-terminus of the OsABCC16 protein, that is, the OsABCC16 gene was inserted between the 35S promoter and eGFP in the protein subcellular localization GFP empty vector (pCAMBIA35s-eGFP) containing the 35S promoter preserved in our laboratory (the schematic diagram of pCAMBIA35s-eGFP is as Figure 2 shown), to obtain a transient expression recombinant vector ( p35S::OsABCC16-GFP driven by the 35S promoter), and transformed into rice protoplasts and tobacco. In addition, the GFP empty vector ( p35S::GFP ; that is, pCAMBIA35s-eGFP) and the plasma membrane fluorescent labeling protein vector ( p35S::OsRac3-Mcherry OsABCC16 were transferred as controls to observe fluorescence localization. The results showed that in both rice and tobacco, after transferring OsABCC16In the cells with the fusion expression vector, the green fluorescence of GFP was mainly distributed in the cell membrane and cytoplasmic regions; while the green fluorescence signal emitted by the GFP empty vector control was distributed throughout the cell (the results are as Figure 3 shown).
[0038] (3) OsABCC16 qRT-PCR analysis of the gene's response to Cd stress, other metal stresses, and hormone treatments Hydroponically cultivate the rice seedlings of Zhonghua 11 (ZH11) in an artificial climate chamber, and change the Kimura B nutrient solution every 3 days. The conditions are set as 12 h of light, 28 °C, 12 h of darkness, 25 °C, and the relative humidity is 60%. Treat the rice seedlings cultured for 30 d with Cd (add CdCl2 to the Kimura B nutrient solution to make the final concentrations of CdCl2 be 0, 1, 10, 100 µM respectively, and continue to culture for 1 d; in the same way, culture the rice seedlings with a CdCl2 solution with a final concentration of 10 µM for 0, 3, 6, 9, 12, 24, 48, 60, 72 h respectively; in the same way, culture the rice seedlings with solutions of MnSO4, AlCl3·6H2O, MgSO4, ZnSO4, FeSO4 with a final concentration of 100 µM for 1 d; Select the above-ground parts and roots as materials, and use the conventional methods in the field of genetic engineering. According to the operation manual of the reagent company, extract the RNA of rice tissues using the Trizol reagent of Genstar Company (China), reverse transcribe to obtain cDNA using the StarScript Ⅲ All-in-one kit of Genstar Company (China), and then use the Realstar Fast SYBR qPCR Mix quantitative PCR kit of Genstra Company (China) to perform qRT-PCR detection on the expression levels of the OsABCC16 gene in the above-ground parts and roots of the materials. The forward primer for qRT-PCR detection is 5’- TGACTTGCGTTCATGTTTGGG -3’, and the reverse primer is 5’-CAGTTCGACCCATCTTCCACA -3’. The reaction procedure of qRT-PCR is: pre-denaturation at 95 °C for 3 min; denaturation at 95 °C for 10 s, annealing at 60 °C for 10 s, extension at 72 °C for 30 s / kb, for 35 cycles; 72 °C, 5 min. In addition, OsABCC16 The qRT-PCR detection reaction of the gene uses rice Actin1 ( Os10g0510000 )as the internal reference gene, and the primers used are 5’-AGACGAACTCCACTCCGGTA -3’ (forward primer) and 5’-TGAGCGAACTCCTTGAACCC -3’ (reverse primer).
[0039] The results showed that, whether in the roots or shoots of the seedlings, after culturing rice seedlings with CdCl2 solutions at different concentrations (0, 1, 10, 100 μM) for 1 day, with the increase of Cd concentration, OsABCC16 the relative expression levels of the gene in the shoots and roots of rice showed a gradually increasing trend at high Cd concentrations. This indicates that OsABCC16 the gene has an obvious response to Cd stress and shows a concentration-dependent effect (as Figure 4 shown). After treating rice seedlings hydroponically grown for 30 days with Cd (10 μM) for different times, the results showed that with the prolongation of Cd treatment time, the expression levels of OsABCC16 in the shoots and roots of rice generally showed a gradually increasing trend and reached the highest peak value, and then decreased slightly. Among them, OsABCC16 the expression level in the shoots of rice reached the highest peak value at 48 h of Cd treatment, while in the roots, its expression level reached the peak value at 24 h of Cd treatment (as Figure 5 shown).
[0040] The results showed that under the stress of Mn and Mg metal elements, the expression levels of the gene in the roots of rice OsABCC16 were significantly up-regulated compared with the control group, while under the stress of Al, Zn, and Fe metal elements, OsABCC16 there was no significant difference in the expression levels of the gene compared with the control group (as Figure 6 shown). This result implies that OsABCC16 the gene may play an important role in the response and detoxification mechanisms of plants to specific metal elements, thus providing valuable clues for further studying the function of OsABCC16 the gene in the regulation of metal transport and accumulation in rice.
[0041] (4) OsABCC16 Analysis of the spatio-temporal expression pattern of the gene in rice Hydroponically culture the Zhonghua 11 (ZH11) rice seedlings in an artificial climate chamber, and change the Kimura B nutrient solution every 3 days. The conditions are set as 12 h of light, 28 °C, 12 h of darkness, 25 °C, and the relative humidity is 60%. Sampling is carried out at different stages (seedling stage, tillering stage, heading stage, maturity stage) and different parts (roots, shoots, stems, leaves, etc.) of the wild-type Zhonghua 11 rice.
[0042] Using conventional methods in the field of genetic engineering and following the operation manuals of reagent companies, RNA was extracted from rice tissues using Trizol reagent from Genstar (China). cDNA was reverse-transcribed using the StarScript Ⅲ All-in-one kit from Genstar (China). Then, the Realstar Fast SYBR qPCR Mix quantitative PCR kit from Genstra (China) was used to perform qRT-PCR detection of the expression levels of OsABCC16 in different tissue materials. The forward primer for qRT-PCR detection was 5’- TGACTTGCGTTCATGTTTGGG -3’, and the reverse primer was 5’-CAGTTCGACCCATCTTCCACA -3’. The reaction program for qRT-PCR was: pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 10 s, annealing at 60℃ for 10 s, extension at 72℃ for 30 s / kb, for 35 cycles; 72℃ for 5 min. In addition, OsABCC16 The qRT-PCR detection reaction of the gene used Actin1 ( Os10g0510000 ) as the internal reference gene, and the primers used were 5’- AGACGAACTCCACTCCGGTA -3’ (forward primer) and 5’-TGAGCGAACTCCTTGAACCC -3’ (reverse primer).
[0043] The results showed OsABCC16 was expressed in various parts of rice at different growth stages, and the expression levels were relatively high in root, stem, and leaf tissues (as shown in Figure 7 ). These results suggest that OsABCC16 The gene not only participates in the transport process in the rice root, but may also participate in the transport or redistribution of Cd in the above-ground tissues.
[0044] (5) OsABCC16 Obtaining gene overexpression lines Using conventional operating methods in the field of genetic engineering, RNA was extracted from rice leaf tissues and reverse-transcribed to obtain single-stranded cDNA according to the method of Example 1. Then, the high-fidelity enzyme Phanta Max Super-Fidelity DNA Polymerase from Vazyme (China) was used to amplify a double-stranded cDNA fragment containing the full-length CDS sequence of the OsABCC16 gene. The PCR amplification program was denaturation at 95℃ for 5 min, then denaturation at 95℃ for 15 s, annealing at 58℃ for 15 s, and extension at 72℃ for the time obtained according to 1 kb / 30 s based on the CDS sequence length, for a total of 35 cycles, and finally a final extension at 72℃ for 5 min.
[0045] OsABCC16 The primers used for PCR were: 5’- ATGGGTTCCCTCACAAGTTC -3’ (forward primer) and 5’-TGCAGCATGTGAGTGCATAT -3’ (reverse primer). After being verified correct by sequencing, according to the conventional operations in the field of genetic engineering, the double-stranded cDNA fragment containing the full-length CDS sequence of the OsABCC16 gene was inserted into the overexpression vector pOx vector containing the Ubi promoter preserved in our laboratory (as shown in (a) of Figure 8 ), to obtain the OsABCC16 gene overexpression vector driven by the Ubi promoter, that is, pUbi::OsABCC16 , and then it was transformed into ZH11 rice. The transformed seedlings and their offspring were planted and screened and identified to obtain OsABCC16 two independent and stable homozygous lines with overexpression of the OE-C16-1, OE-C16-2 gene, that is,
[0046] (6) OsABCC16 Obtaining of gene knockout lines Using the conventional operation methods in the field of genetic engineering, with the intermediate vector (as shown in (b) of Figure 8 ) and the gene knockout vector (as shown in (c) of Figure 8 ), knockout vectors targeting two targets (T1 and T2) of the OsABCC16 gene were constructed respectively. OsABCC16 The primers for the T1 (i.e., U3 ) target of the gRNA vector in the gene knockout lines were: 5’-GGCAGCCTAGGACTGTGGATGCTG -3’ (forward primer) and 5’- AAACCAGCATCCACAGTCCTAGGC -3’ (reverse primer); the amplification primers for the T2 (i.e., U6a ) target were: 5’- GCCGCATGATCCTTCTCTGTATTC -3’ (forward primer) and 5’- AAACGAATACAGAGAAGGATCATG -3’ (reverse primer). After transforming Zhonghua 11 and through planting and screening and identification, OsABCC16 two independent and stable homozygous lines with gene knockout were obtained, that is, cas-c16-1, cas-c16-2 .
[0047] For OsABCC16 the targets in the gene knockout lines, sequencing and alignment analysis were carried out. The results showed that in the cas-c16-1 line, there was a 1-bp deletion at target 1 (T1), while there was a 3-bp deletion at target 2 (T2); in the cas-c16-2 line, there was a 10-bp deletion at target 1 (T1), and 1 bp was inserted at target 2 (T2). These deletions or insertions of bases both led to OsABCC16A frameshift mutation occurred in the coding sequence (CDS) of the gene, resulting in premature termination of the amino acid sequence of the encoded protein during translation.
[0048] (7) Statistical analysis of hydroponic seedling growth traits and Cd content analysis Using OsABCC16 the overexpression lines of the gene ( OE-C16-1, OE-C16-2 ), knockout lines ( cas-c16-1, cas- c16-2 ), and ZH11 as materials for hydroponic culture. After 30 days of culture, they were treated with CdCl2 at different concentrations (0, 10, 100 μM), and after continuing to culture for 7 days, the plant phenotypes were observed, and the physiological traits and Cd concentrations in each part were measured. The method for Cd concentration determination is as follows: Wash the rice samples clean with water, dry them in an oven at 60 °C, weigh the samples (for the above-ground parts, weigh 0.05 - 1.0 g, for the roots, weigh 0.01 - 0.1 g, for the grains, weigh 1.0 g, and for the grains, they need to be shelled in advance and the brown rice is ground into powder before weighing; when weighing for each group of overexpression lines, knockout lines, and wild type, the same amount should be weighed). Put them into glass digestion cups, add 10 mL of mixed acid (mixed acid prepared by mixing concentrated nitric acid and perchloric acid in a volume ratio of 87:13) into the cups, and digest them with a graphite digestion furnace. Stop digestion when the sample volume in the cup ≤ 0.5 mL. After the sample cools, add 2 mL of 1% dilute nitric acid, mix well, rinse the glass cup with ultrapure water 3 - 5 times, filter and make up the volume (note: the grain samples are made up to 15.0 mL, the above-ground part samples are made up to 15.0 mL, and the root samples are made up to 50.0 mL), and measure the Cd content with an inductively coupled plasma optical emission spectrometer (ICP-OES).
[0049] Under Cd treatment, OsABCC16 the growth of the two overexpression lines of the gene ( OE-C16-1 , OE-C16-2 ) was stronger than that of the wild type, while OsABCC16 the growth of the two knockout lines of the gene ( cas-c16-1 , cas-c16-2 ) was weaker than that of the wild type, and with the increase of Cd concentration, this growth difference became more obvious (as shown in (a) of Figure 9 ). Further measurement and statistical analysis were carried out on the plant height, fresh weight, and dry weight of rice seedlings under 0 and 100 μM Cd treatments. The results showed that under the condition of 100 μM Cd, the plant height, fresh weight, and dry weight of the overexpression lines were significantly increased compared with the wild type, by at least 11.72%, 10.78%, and 12.00% respectively, while these growth traits of the knockout lines were significantly decreased compared with the wild type, by at least 13.36%, 9.88%, and 17.23% respectively (as shown in Figure 9(b), (c) and (d) in the figure).
[0050] The results of Cd content determination showed that OsABCC16 Gene overexpression strains ( OE-C16-1 , OE-C16-2 ) were significantly lower than those in the wild type, with the aboveground Cd content of the two lines decreasing by at least 11.45% and 18.6%, respectively, and the root Cd content of the knockout line ( cas-c16-1 , cas-c16-2 ) showed an increasing trend in both the aboveground and root Cd contents, with the two strains increasing by at least 4.12% and 9.18%, respectively (e.g. Figure 10 (a) in the figure), indicating that overexpression in rice OsABCC16 The gene can significantly reduce the absorption of Cd by rice.
[0051] Further testing OsABCC16 The Cd content in the xylem sap of each strain was found to be OsABCC16 The Cd content in the xylem sap of the gene-overexpressing strains was significantly lower than that of the wild type, at least by 55.25%, while the Cd content in the xylem sap of the knockout strains showed an increasing trend compared with the wild type (at least by 5.85%), which indicates that OsABCC16 The gene may be directly involved in the redistribution of Cd in the aboveground part of rice through the xylem pathway (e.g. Figure 10 (as shown in (b) in the figure).
[0052] (8) Cultivation experiment in Cd-contaminated soil Select OsABCC16 Gene overexpression strains ( OE-C16-1, OE-C16-2 ), knockout strains ( cas-c16-1, cas-c16-2 ) and wild rice ZH11. When the rice seedlings grew to the four-leaf stage, the seedlings with uniform growth were selected and planted in Cd-contaminated soil (the Cd content in the soil was 0.33 mg / kg (pH 5.02), slightly higher than the risk screening level (0.3 mg / kg, pH ≤ 5.5); the contents of other heavy metals in the soil, such as As, Hg, Pb and Zn, did not exceed the corresponding risk screening levels; GB 15618-2018). Rice cultivation followed the conventional guidelines for field rice production, and trait statistics and metal element determination were performed after the rice was fully mature.
[0053] The results show that OsABCC16 The growth of the gene overexpression strain and knockout strain showed no significant difference compared with the wild type, indicating that OsABCC16 The expression of the gene had no significant effect on the growth of rice cultivated in Cd-contaminated soil (e.g.Figure 11 as shown in (a). Further, the yield traits of the overexpression lines, knockout lines, and wild-type ZH11 of the OsABCC16 gene were statistically analyzed. The results showed that OsABCC16 there were no significant differences in plant height, effective tiller number, seed setting rate, and yield per plant between the overexpression and knockout lines of the Figure 11 gene and the wild-type (as shown in (b) - (e) of OsABCC16 ). These results indicate that the expression of the
[0054] gene has no significant negative impact on the agronomic trait indicators of rice. OsABCC16 The Cd content and the contents of essential metal elements in the grains (brown rice) of the overexpression lines, knockout lines, and wild-type rice ZH11 of OsABCC16 at the mature stage were determined. The results showed that there was no significant difference in the Cd content in the brown rice of the knockout lines compared with the wild-type, but the Cd content in the grains of the overexpression lines was significantly reduced by at least 20.41% compared with the wild-type, which means that Figure 12 the knockout of the
[0055] gene has limited effect on the Cd content in rice brown rice, while the overexpression of this gene helps to reduce the accumulation of Cd in rice grains (as shown in (a) of OsABCC16 ). When examining the contents of other essential metal elements (Fe, Mn, Cu, Zn, Mg) in brown rice, it was found that Figure 12 there were no significant differences in the contents of these metal elements between the overexpression lines and knockout lines of the
[0056] gene and the wild-type, indicating that this gene mainly specifically affects the Cd content in rice brown rice and has relatively little effect on other essential metal elements (as shown in (b) of OsABCC16 ). OsABCC16 The above results indicate that the
[0057] gene provides an important candidate gene resource for low-Cd molecular breeding of rice. By overexpressing the OsABCC16 gene, it is expected to effectively reduce the Cd content in grains, and at the same time, it can also ensure the yield and nutritional quality of rice, thus providing a potential genetic engineering strategy for the prevention and control of Cd pollution in rice.
[0057] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principle of the present invention shall be equivalent replacement methods and are all included in the protection scope of the present invention.
Claims
1. ABC transporter family genes OsABCC16 Application in plant breeding regulation, characterized in that, ABC transporter family genes OsABCC16 The amino acid sequence of the encoded protein is shown in SEQ ID No:
2.
2. The use according to claim 1 is characterized in that ABC transporter family genes OsABCC16 The nucleotide sequence is shown in SEQ ID No:
1.
3. The use according to claim 1 is characterized in that The plant breeding regulation refers to overexpressing ABC transporter family genes in plants OsABCC16 , improve plant tolerance to cadmium, increase plant biomass, and reduce the cadmium content in plant seeds.
4. The use according to claim 1 is characterized in that The plant is a grass plant.
5. The use according to claim 1 is characterized in that: The plant is at least one of wheat, corn and rice.
6. The use according to claim 1 is characterized in that: The plant is rice.
7. ABC transporter family genes OsABCC16 Application in improving plant tolerance to cadmium and / or preparing / cultivating plant varieties with low grain cadmium accumulation, characterized in that: ABC transporter family genes OsABCC16 The amino acid sequence of the encoded protein is shown in SEQ ID No:
2.
8. Contains ABC transporter family genes OsABCC16 Use of a plant expression vector and a host cell in improving plant tolerance to cadmium and / or preparing / cultivating plant varieties with low grain cadmium accumulation, characterized in that: ABC transporter family genes OsABCC16 The amino acid sequence of the encoded protein is shown in SEQ ID No:
2.
9. A method for enhancing plant tolerance to cadmium and / or reducing the cadmium content in plant seeds, characterized in that: ABC transporter family genes OsABCC16 Overexpression steps; ABC transporter family genes OsABCC16 The amino acid sequence of the encoded protein is shown in SEQ ID No: 2.