Application of cassava common mosaic virus tgbp1 in down-regulating megrxc3
By studying the interaction between cassava common mosaic virus TGBp1 and MeGRXC3, we were able to downregulate MeGRXC3 expression and increase reactive oxygen species content, which solved the problem of insufficient research on CsCMV, enhanced the disease resistance of cassava, and provided a foundation for breeding.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SANYA RES INST OF CHINESE ACAD OF TROPICAL AGRI
- Filing Date
- 2025-05-26
- Publication Date
- 2026-05-01
AI Technical Summary
There is limited research on cassava mosaic virus (CsCMV) in the current technology, especially regarding its host range, transmission vectors, and gene functions. This makes it difficult to effectively control cassava mosaic disease, resulting in a loss of 25 million tons of cassava production globally each year and affecting the food security of 500 million people.
Research has revealed that the TGBp1 gene of cassava common mosaic virus interacts with cassava glutarate reductin 3 (MeGRXC3), downregulating MeGRXC3 expression and increasing reactive oxygen species content in plant tissues. The expression of the TGBp1 gene, its encoded protein, or recombinant vector in yeast and plants enhances antiviral capabilities.
It improved the growth ability of yeast in specific auxotrophic media and increased the content of reactive oxygen species in plant tissues, providing a theoretical basis for cassava disease resistance breeding and enhancing resistance to CsCMV.
Smart Images

Figure CN120193015B_ABST
Abstract
Description
Application of cassava mosaic virus TGBp1 in downregulating MeGRXC3 Technical Field
[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the application of cassava mosaic virus TGBp1 in downregulating MeGRXC3. Background Technology
[0002] Viruses are obligate parasites and must evade or tolerate various antiviral defense mechanisms of host cells to successfully infect. How viruses evade or tolerate host post-transcriptional gene silencing (PTGS) and other immune defense mechanisms to enhance pathogenicity has been a research hotspot in recent years, and significant progress has been made. PTGS is a conserved gene expression regulatory mechanism in eukaryotes, playing a crucial role not only in developmental regulation, metabolism, maintaining genome stability, and responding to biotic and abiotic stresses, but also as an important antiviral immune mechanism. During plant evolution, multiple antiviral PTGS signaling pathways have been developed, involving different proteins with different functions but some overlap. Since viruses are obligate parasites, they must evade or tolerate host cell degradation to successfully infect. Most plant viruses have co-evolved with plants to produce one or more viral suppressors of RNA silencing (VSRs) to counteract the antiviral immune function of host PTGS. VSRs from different viruses are not homologous in sequence and have no structural similarity, so their modes of action and mechanisms of action are also different.
[0003] Cassava (Manihot esculenta) is a perennial crop belonging to the Euphorbiaceae family, mainly cultivated in tropical and subtropical countries and regions. It is the world's sixth largest food crop and plays a vital role in the agricultural economy. Cassava mosaic virus disease is devastating to the cassava industry, causing a loss of 25 million tons of cassava production annually worldwide, affecting the food security of over 500 million people. Cassava common mosaic virus (CsCMV) belongs to the Potexvirus genus of the Alphaflexiviridae family. CsCMV was first reported in southern Brazil. CsCMV exhibits typical molecular characteristics of Potexviruses, being a monoid, positive-sense ssRNA (+) curved virus with a particle size of approximately 15 nm × 495 nm. The genome is approximately 6.4 kb in size, with a cap structure at the 5′ end and a poly(A) tail at the 3′ end, producing three subgenomic RNAs (sgRNAs) and containing five open reading frames (ORFs): ORF1 at the 5′ end encodes a 165 kD RNA-dependent RNA polymerase (RdRp), essential for viral replication; the three middle ORFs, ORF2, ORF3, and ORF4, encode three overlapping triple gene block proteins (TGBs): TGBp1 (25 kD), TGBp2 (12 kD), and TGBp3 (10 kD); and ORF5 at the 3′ end encodes a 24 kD coat protein (CP). ORF1 is directly synthesized from viral genomic RNA, while the other ORFs are translated from sgRNAs. Studies have shown that RdRp is the only viral protein absolutely required for viral replication, while TGBp1-3 and CP are essential for viral intercellular or long-distance movement. Currently, there are few research reports on CsCMV both domestically and internationally, and the research is still in the detection and identification stage. The host range, transmission vector, and gene function of CsCMV are unclear, necessitating in-depth research. This invention discovers that TGB1 interacts with cassava glutoredoxin 3 (MeGRXC3) and downregulates its expression, while also increasing the reactive oxygen species content in plant tissues co-expressing MeGRXC3. Summary of the Invention
[0004] The purpose of this invention is to overcome the shortcomings of the prior art and provide the application of cassava mosaic virus TGBp1 in downregulating MeGRXC3 and increasing the reactive oxygen species content in plant tissues co-expressed with MeGRXC3.
[0005] The first aspect of the present invention is to provide the use of the TGBp1 gene, or the protein encoded by the TGBp1 gene, or a recombinant vector or host bacterium containing the coding region of the TGBp1 gene in downregulating the expression level of MeGRXC3.
[0006] The nucleotide sequence of the TGBp1 gene is shown in SEQ ID NO:1;
[0007] The nucleotide sequence of the gene corresponding to MeGRXC3 is shown in SEQ ID NO:2.
[0008] A second aspect of the invention is to provide the use of the TGBp1 gene, or the protein encoded by the TGBp1 gene, or a recombinant vector or host bacterium containing the coding region of the TGBp1 gene in interaction with MeGRXC3.
[0009] Specifically, the interaction between TGBp1 and MeGRXC3 leads to a downregulation of MeGRXC3 expression levels.
[0010] Among them, TGBp1 interacts with MeGRXC3 to increase the content of reactive oxygen species in plant tissues.
[0011] Among them, the interaction between TGBp1 and MeGRXC3 improves the growth ability of yeast in SD / -Leu / -Trp / -His / -Ade auxotrophic media.
[0012] A third aspect of the present invention is to provide the application of the TGBp1 gene, or the protein encoded by the TGBp1 gene, or a recombinant vector or host bacterium containing the coding region of the TGBp1 gene in increasing the reactive oxygen species content in plant tissues.
[0013] A fourth aspect of the present invention is to provide the use of the TGBp1 gene, or the protein encoded by the TGBp1 gene, or a recombinant vector or host bacterium containing the coding region of the TGBp1 gene in improving the growth ability of yeast in SD / -Leu / -Trp / -His / -Ade auxotrophic media.
[0014] This invention reveals an interaction between TGBp1 and MeGRXC3, which can enhance yeast growth in SD / -Leu / -Trp / -His / -Ade auxotrophic media, downregulate MeGRXC3 expression, increase reactive oxygen species (ROS) content in plant tissues co-expressing MeGRXC3, and further improve yeast growth in SD / -Leu / -Trp / -His / -Ade auxotrophic media. These findings will lay a theoretical foundation for breeding cassava mosaic virus resistance. Attached Figure Description
[0015] Figure 1 shows the interaction between pGBKT7-TGBp1 and pGADT7-MeGRXC3 yeasts. AD-T + BD-53, AD-T + BD-Lam, BD-TGBp1 + AD-MeGRXC3, BD-TGBp1 + AD, and BD + AD-MeGRXC3 represent the yeast co-transformation combinations of AD-T + BD-53, AD-T + BD-Lam, BD-TGBp1 + AD-MeGRXC3, BD-TGBp1 + AD, and BD + AD-MeGRXC3, respectively. SD-LW: SD-LW / -Leu / -Trp medium; SD-LWH: SD-LWHA / -Ade / -His / -Leu medium; SD-LWHA: SD-LWHA / -Ade / -His / -Leu / -Trp medium.
[0016] Figure 2 shows the interaction between CsCMV TGBp1 and MeGRXC3 proteins in tobacco as verified by BiFC. Top: MeGRXC3-YC, YNs-TGBp1, and nuclear localization marker H2B-RFP were co-injected into tobacco; Bottom: MeGRXC3-YC, YNs, and nuclear localization marker H2B-RFP were co-injected into tobacco.
[0017] Figure 3 shows the fluorescence observation on day 5 after co-expression of MeGRXC3-GFP with different concentrations of YNs-TGBp1.
[0018] Figure 4 shows the accumulation level of MeGRXC protein on day 5 after infiltrating Nicotiana Bunsenata leaves with MeGRXC-Flag3, empty vector, and TGBp1-GFP, respectively, by Western blotting. MeGRXC3-Flag: plant expression vector expressing MeGRXC3-Flag; pG1300: plant expression vector pG1300 expressing only the GFP tag; pG1300-TGBp1: plant expression vector pG1300-TGBp1 expressing the TGBp1-GFP fusion protein; FlagFlag antibody; GFP: GFP antibody; Rubisco: Rubisco Coomassie brilliant blue staining.
[0019] Figure 5 shows the effects of TGB1 on reactive oxygen species in leaf tissues co-expressed with MeGRXC3, as detected by laser scanning imaging (left) and DAB staining observation (right). p1300-Flag + TGB1-GFP: Empty vector and TGBp1-GFP co-infiltrated Tobacco Bunsenii leaves; p1300-Flag + pG1300: Empty vector and pG1300 vector expressing only GFP co-infiltrated Tobacco Bunsenii leaves; MeGRXC3-Flag + TGB1-GFP: MeGRXC3-Flag and TGBp1-GFP co-infiltrated Tobacco Bunsenii leaves; MeGRXC3-Flag + pG1300: MeGRXC3-Flag and pG1300 vector expressing only GFP co-infiltrated Tobacco Bunsenii leaves. Detailed Implementation
[0020] The present invention will be further described below with reference to the accompanying drawings and specific embodiments to better understand the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be obtained commercially.
[0021] 1 plant material
[0022] Wild-type Nicotiana benthamiana was preserved in our laboratory.
[0023] 2 Experimental Methods and Results
[0024] 2.1 Construction of expression vector
[0025] (1) Construction of yeast expression vector AD-TGBp1
[0026] Using pCsCMV as a template, the target fragment TGBp1EB (specific sequence shown in Table 2) was amplified using primers TGBp1-1F EcoRI and TGBp1-696R BamHI (specific primer sequences are shown in Table 1). The PCR product was double-digested with EcoRI and BamHI and then ligated with the large fragment of the yeast expression vector pGADT7, which was also double-digested. The ligation product was transformed into E. coli, and the positive clone was identified by sequencing and named AD-TGBp1.
[0027] (2) Construction of yeast expression vector BD-MeGRXC3
[0028] The target fragment MeGRXC3-EcoRI & BamHI (specific sequences are shown in Table 2) was artificially synthesized by Shanghai Sangon Biotech Co., Ltd., with restriction endonucleases EcoRI and BamHI added to both ends respectively. After double digestion with EcoRI and BamHI, the target fragment was ligated to a pGBKT fragment that had also been double-digested. The ligation product was transformed into E. coli, and positive clones, after being confirmed by sequencing, were named BD-MeGRXC3.
[0029] (3) Construction of plant expression vector YNs-TGBp1
[0030] Using pCsCMV as a template, the target fragment TGBp1MK (specific sequence shown in Table 2) was amplified using primers TGBp1-1F MluI and TGBp1-696R KpnI (specific sequences are shown in Table 1). The PCR product was double-digested with MluI and KpnI and then ligated to a large fragment of the plant expression vector p1300-YNs (Liu Linyu, Zhao Pingjuan, Fu Yan, et al. Study on the interaction between cassava mosaic virus AC4 protein and AtPARN [J]. Journal of Tropical Crops, 2024, 45(01): 197-204.) which had been double-digested with the same enzymes. The ligation product was transformed into Escherichia coli, and the positive clone was identified by sequencing and named YNs-TGBp1.
[0031] (4) Construction of plant expression vector TGBp1-GFP
[0032] Using pCsCMV as a template, the target fragment TGBp1SK (specific sequence shown in Table 2) was amplified using primers TGBp1-1F SpeI and TGBp1-696R KpnI (specific sequences are shown in Table 1). The PCR product was double-digested with SpeII and KpnI and then ligated with the large fragment of the plant expression vector pG1300, which was also double-digested with the same enzymes. The ligation product was transformed into Escherichia coli, and the positive clone was identified by sequencing and named TGBp1-GFP.
[0033] (5) The construction method of the plant expression vector MeGRXC3-YC is as follows:
[0034] The target fragment MeGRXC3-SpeI & KpnI (specific sequence shown in Table 2) was synthesized and double-digested with SpeI & KpnI, then ligated with a large fragment of p1300-FYC (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166). The ligation product was transformed into E. coli, and the positive clone was identified by sequencing and named MeGRXC3-YC.
[0035] (6) The construction method of the plant expression vector MeGRXC3-GFP is as follows:
[0036] The synthesized target fragment MeGRXC3-SpeI & KpnI was double-digested with SpeI and KpnI and then ligated with a large fragment of pG1300 (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNAsilencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166). The ligation product was transformed into E. coli, and the positive clone was identified by sequencing and named MeGRXC3-GFP.
[0037] (7) The method for constructing the empty vector p1300-Flag is as follows:
[0038] The target fragment Flag-XbaI & SacI (specific sequences are shown in Table 2) was artificially synthesized by Shanghai Sangon Biotech Co., Ltd., and double-digested with XbaI and SacI and ligated with a large fragment of pG1300 (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnipcrinkle virus-encoded suppressor of RNA silencing interacts with ArabidopsisSGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166). The ligation product was transformed into E. coli, and the positive clone was identified by sequencing and named p1300-Flag.
[0039] (8) The construction method of the plant expression vector MeGRXC3-Flag is as follows:
[0040] The target fragment MeGRXC3-XbaI & BamHI (specific sequence shown in Table 2) was artificially synthesized by Shanghai Sangon Biotech Co., Ltd., and then ligated with the p1300-Flag large fragment constructed above after double digestion with XbaI & BamHI. The ligation product was transformed into E. coli, and the positive clone was identified by sequencing and named MeGRXC3-Flag.
[0041] Table 1 Primers used
[0042] Primer name and sequence: TGBp1-1F EcoRI GAATTC ATGGACTCTTTTATTGATGATGBp1-696R BamHI GGATCC TCAGCTGGAGGGGAAGGTGTGBp1-1F MluI ACGCGT ATGGACTCTTTTATTGATGATGBp1-696R kpnI GGTACC TCAGCTGGAGGGGAAGGTGTGBp1-1F SpeI ACTAGT ATGGACTCTTTTATTGATGA surface
[0043] Table 2 Target Fragment Sequence
[0044]
[0045] 2.2 Yeast double hybridization to identify the interaction between TGBp1 and MeGRXC3
[0046] (1) Construction of yeast expression vector BD-TGBp1
[0047] Using pCsCMV as a template, the target fragment TGBp1EB (specific sequence shown in Table 2) was amplified using primers TGBp1-1F EcoRI and TGBp1-696R BamHI (specific primer sequences are shown in Table 1). The PCR product was double-digested with EcoRI and BamHI and then ligated with the large fragment of the yeast expression vector pGBKT, which was also double-digested. The ligation product was transformed into E. coli, and the positive clone was named BD-TGBp1 after being identified by sequencing.
[0048] (2) Construction of yeast expression vector AD-MeGRXC3
[0049] The target fragment MeGRXC3-EcoRI & BamHI (specific sequences are shown in Table 2) was artificially synthesized by Shanghai Sangon Biotech Co., Ltd., with restriction endonucleases EcoRI and BamHI added to both ends respectively. After double digestion with EcoRI and BamHI, the target fragment was ligated to a pGADT7 fragment that had also been double-digested. The ligation product was transformed into E. coli, and the positive clone, after being confirmed by sequencing, was named BD-MeGRXC3.
[0050] For ease of description, during co-transformation, the "pGADT7" vector was abbreviated as "AD", and the "pGBKT7" vector was abbreviated as "BD". The yeast expression vectors pGADT7, pGBKT7, AD-T (pGADT7-T), BD-lam (pGBKT7-lam), and BD-53 (pGBKT7-53) (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNAsilencing interacts with Arabidopsis SGS3 to enhance virus infection. Molecular plant pathology, 24(2), 154–166.) were all preserved in our laboratory.
[0051] Table 3. Pairing combinations of yeast bait plasmids and prey plasmids
[0052] Combination bait carrier prey carrier 1 (positive control) AD-TBD-532 (negative control) AD-TBD-lam3 AD-MeGRXC3 BD-TGBp14 BD-TGBp1 AD5 AD-MeGRXC3BD surface
[0053] Following the co-transformation of yeast competent cells with different yeast expression vectors as shown in Table 3, single colonies identified by PCR were picked and resuspended in 25 μL of sterile water to prepare a suspension. The suspension was then serially diluted with sterile water to 10-fold, 100-fold, and 1000-fold, and 2 μL of each was inoculated into SD / -Leu / -Trp (SD-LW) and SD / -Leu / -Trp / -His / -Ade (SD-LWHA) auxotrophic media. Yeast co-transformed with AD-T and BD-Lam and AD-T and BD-53 were used as negative and positive controls, respectively. The yeast suspensions transformed with the target plasmid were inoculated together with the yeast suspensions and cultured upside down in a 28°C incubator for 3 days to observe and record the growth.
[0054] The results of the yeast two-hybrid study are shown in Figure 1. All co-transformed yeasts grew normally in SD-LW deficient medium. However, in SD-LWHA deficient medium, only the yeast positive control and yeast co-transformed with BD-TGBp1 and AD-MeGRXC3 grew normally; the negative control and yeast co-transformed with BD-TGBp1 and AD-MeGRXC3 failed to grow normally. These results indicate that TGBp1 and MeGRXC3 interact within yeast cells.
[0055] 2.3 Bimolecular fluorescence identification of the interaction between TGBp1 and MeGRXC3
[0056] BiFC vector p1300-YNs (Liu, L., Zhao, P., Fu, Y., et al. Study on the interaction between AC4 protein and AtPARN of cassava mosaic virus [J]. Journal of Tropical Crops, 2024, 45(01): 197-204.) and nuclear localization red light labeling vector H2B-RFP (Liu, L., Wang, H., Fu, Y., Tang, W., Zhao, P., Ren, Y., Liu, Z., Wu, K., & Zhang, X. (2023). Turnip crinkle virus-encoded suppressor of RNA silencing interactions with Arabidopsis SGS3 to enhance virus infection. Molecular plantpathology, 24(2), 154–166.) were both preserved in our laboratory.
[0057] (1) Plant expression vector transformed Agrobacterium GV3101
[0058] Plant expression vectors YNs-TGBp1, p1300-YNs, MeGRXC3-YC, H2B-RFP, and silencing repressor expression vector pZP-P19 (Qu, F., Ren, T., & Morris, TJ (2003). The coat protein of turnipcrinkle virus suppresses posttranscriptional gene silencing at an earlyinitiation step. Journal of virology, 77(1), 511–522.) were transformed into Agrobacterium GV3101 competent cells. The transformed Agrobacterium cells were evenly spread onto LB solid medium containing the corresponding resistance (YNs-TGBp1, YNs, MeGRXC3, and H2B-RFP were spread on LB plates containing Kan and Rif resistance, and pZP-P19 was spread on LB plates containing Spec and Rif resistance, all at a working concentration of 50 μg / mL) and incubated upside down at 28°C for 72–90 h. After 2-3 days, when Agrobacterium bacteria have grown to 2-3 mm, single colonies are selected for PCR identification.
[0059] (2) Agrobacterium infiltrates Nicotiana bungeanum
[0060] Single colonies identified as positive by colony PCR were picked using a pipette tip and added to 5 mL of LB liquid medium containing the corresponding antibiotic. The medium was then incubated overnight at 28°C with shaking at 200 rpm. After centrifugation at 7000 rpm for 15 min, the supernatant was discarded, and the precipitate was resuspended in 5 mL of injection buffer. The suspension was thoroughly vortexed and diluted to an OD600 of 0.5. After incubation at room temperature for 2-3 h, resuspensions of different recombinant vectors were mixed in a 1:1:1 ratio (see Table 4 for specific combinations). MeGRXC3-YC was mixed with YNs and YNs-TGBp1 resuspensions for injection. For each combination, 1 / 10 of the total volume of the nuclear localization red light vector FIB2-RFP was added as a nuclear marker for localization. The mixture was thoroughly mixed and injected into vigorously growing, 5-7 leaf-stage Nicotiana Bunsenata leaves. At least three replicates were performed for each combination. Injected Nicotiana Bunsenata was protected from light overnight and then cultured under normal conditions. After 2-3 days, take approximately 1-2 cm from each sample. 2 The fluorescence of tobacco cells was observed and photographed using a laser confocal microscope (Olympus FV3000). GFP excitation light was 488 nm, and RFP excitation light was 546 nm.
[0061] The observation results are shown in Figure 2: Co-injection of MeGRXC3-YC and YNs-TGBp1 into Nicotiana Bunsenata leaves restored green fluorescence under excitation light of 488 nm, which overlapped with the red fluorescence expressed by H2B-RFP under excitation light of 546 nm. However, co-injection of MeGRXC3-YC and YNs did not restore green fluorescence. The BiFC study results further illustrate the interaction between Sri Lankan cassava mosaic virus TGBp1 and MeGRXC3.
[0062] Table 4. Different Agrobacterium-mediated recombinant plasmid combinations
[0063] Recombinant plasmid name: 1YNs-TGBp1 + MeGRXC3-YC + pZP-P19 +1 / 10 nuclear label FIB2-RFP surface
[0064] 2.4 TGBp1 negatively regulates MeGRXC3 expression
[0065] The single-chain green fluorescent protein expression vector pG1300 is preserved in our laboratory.
[0066] First, Agrobacterium (GV3101) competent cells were transformed with the recombinant plasmid according to the method in 2.3.
[0067] Then, following the method described in section 2.3, the Agrobacterium combinations from Table 5 were mixed and injected into the same tobacco leaf. Fluorescence microscopy was performed on day 5 post-injection. The results are shown in Figure 3. The fluorescence intensity of MeGRXC3-GFP decreased with increasing YNs-TGBp1 bacterial concentration, indicating that TGBp1 negatively regulates MeGRXC3 expression.
[0068] To further confirm that TGBp1 negatively regulates MeGRXC3 expression, we mixed MeGRXC3-Flag with pZP-p19 and co-injected it with pG1300 and TGBp1-GFP into the same leaf. Proteins were extracted on day 5 post-injection, and Western blotting was performed using both the Flag antibody and the GFP antibody. The results are shown in Figure 4. The expression level of MeGRXC3-Flag co-injected with TGBp1-GFP was 1 / 10 that of co-injected with pG1300 expressing only GFP, further demonstrating that TGBp1 negatively regulates MeGRXC3 expression.
[0069] Table 5. Different Agrobacterium-mediated recombinant plasmid combinations
[0070] Recombinant plasmids: 1. Buffer + MeGRXC3-GFP + pZP-P192 OD 0.1; 2. YNs-TGBp1 + MeGRXC3-GFP + pZP-P193 OD 0.5; 3. YNs-TGBp1 + MeGRXC3-GFP + pZP-P194 OD 1.0; 4. YNs-TGBp1 + MeGRXC3-GFP + pZP-P19 surface
[0071] 2.5 Co-expression of TGBp1 and MeGRXC3 increases reactive oxygen species content in tobacco leaves
[0072] First, recombinant plasmids were transformed into competent Agrobacterium (GV3101) cells according to the method in section 2.3. Then, Agrobacterium combinations from Table 6 were mixed and injected into the same tobacco leaf according to the method in section 2.3. On the third day after injection, changes in ROS were observed and detected by laser scanning imaging at 532 nm and DAB staining.
[0073] Three days after injection, the leaves were immersed in DAB staining solution and allowed to react in the dark for 3 hours. Then, they were transferred to stop solution and boiled in a water bath for 10 minutes. The leaves were then destained with 95% ethanol until chlorophyll was completely removed, transferred to preservation solution, and photographed for observation. The results are shown in Figure 5. Co-expression of TGB1 and MeGRXC3 increased ROS content.
[0074] Table 6. Different Agrobacterium-mediated recombinant plasmid combinations
[0075] Recombinant plasmid names: 1. p1300-Flag + pG1300 + pZP-P19; 2. p1300-Flag + TGB1-GFP + pZP-P19; 3. MeGRXC3-Flag + pG1300 + pZP-P19; 4. MeGRXC3-Flag + TGB1-GFP + pZP-P19 surface
[0076] The specific embodiments of the present invention have been described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modifications and substitutions to this invention are also within the scope of the present invention. Therefore, all equivalent changes and modifications made without departing from the spirit and scope of the present invention should be covered within the scope of the present invention.
Claims
1. A method for increasing the reactive oxygen species content in plant tissues through the interaction of the TGBp1 gene, or the protein encoded by the TGBp1 gene, or a recombinant vector or host bacterium containing the coding region of the TGBp1 gene, with MeGRXC3, wherein... The nucleotide sequence of the TGBp1 gene is shown in SEQ ID NO:1; the nucleotide sequence of the MeGRXC3 corresponding gene is shown in SEQ ID NO:2; the TGBp1 gene negatively regulates the expression of the MeGRXC3 corresponding gene; the plant is tobacco.
2. A method for enhancing the growth ability of yeast in SD / -Leu / -Trp / -His / -Ade auxotrophic media by interacting the TGBp1 gene, or the protein encoded by the TGBp1 gene, or a recombinant vector or host bacterium containing the coding region of the TGBp1 gene with MeGRXC3, wherein... The nucleotide sequence of the TGBp1 gene is shown in SEQ ID NO:1; the nucleotide sequence of the MeGRXC3 corresponding gene is shown in SEQ ID NO:2; the TGBp1 gene negatively regulates the expression of the MeGRXC3 corresponding gene.
3. The application of the TGBp1 gene, or the protein encoded by the TGBp1 gene, or a recombinant vector or host bacterium containing the coding region of the TGBp1 gene, in interacting with MeGRXC3 to increase the reactive oxygen species content in plant tissues, wherein, The nucleotide sequence of the TGBp1 gene is shown in SEQ ID NO:1; the nucleotide sequence of the MeGRXC3 corresponding gene is shown in SEQ ID NO:2; the TGBp1 gene negatively regulates the expression of the MeGRXC3 corresponding gene; the plant is tobacco.
4. The application of the TGBp1 gene, or the protein encoded by the TGBp1 gene, or a recombinant vector or host bacterium containing the coding region of the TGBp1 gene, in interacting with MeGRXC3 to improve the growth ability of yeast in SD / -Leu / -Trp / -His / -Ade auxotrophic media, wherein, The nucleotide sequence of the TGBp1 gene is shown in SEQ ID NO:1; the nucleotide sequence of the MeGRXC3 corresponding gene is shown in SEQ ID NO:2; the TGBp1 gene negatively regulates the expression of the MeGRXC3 corresponding gene.
Citation Information
Patent Citations
Cassava common mosaic virus (CsCMV)induced gene silencing system and application thereof
CN112899301A
Cassava MeGRXC3 gene capable of improving resistance and application of cassava MeGRXC3 gene
CN116024226A