Method for synthesizing pesticide intermediate chiral 2, 6-dimethyl-1-aminoindene

Abstract

The invention belongs to the technical field of biological pharmacy, and relates to a method for catalytically synthesizing a pesticide intermediate chiral 2, 6-dimethyl-1-aminoindene by utilizing transaminase. Under the catalysis of omega-transaminase and coenzyme, 2, 6-dimethyl indanone as shown in a formula I and an amino donor are subjected to an amination reaction, and (1R, 2S)-2, 6-dimethyl-2, 3-dihydro-indene-1-amine as shown in a formula II is generated. The transaminase method is adopted to synthesize chiral 2, 6-dimethyl-1-aminoindene, related reagents are few, cheap and easy to obtain, the reaction condition is mild, the steps needed by synthesis are greatly simplified, the pesticide intermediate (1R, 2S)-2, 6-dimethyl-2, 3-dihydro-indene-1-amine can be obtained at the yield of 70% and the ee value of 99.5%, and the method is suitable for industrial production. Wide application prospects and market values are realized.

Description

Technical Field

[0001] The present invention belongs to the technical field of biopharmaceuticals, and relates to a method for catalytically synthesizing the chiral 2,6-dimethyl-1-aminoindene, a pesticide intermediate, using transaminase. Background Art

[0002] Chiral 2,6-dimethyl-1-aminoindene, as an intermediate, is used for synthesizing fine chemicals and active ingredients of agricultural chemicals. (R,S) 2,6-dimethyl-1-aminoindene has good activity, while (S,R) 2,6-dimethyl-1-aminoindene, (R,R) 2,6-dimethyl-1-aminoindene, and (S,S) 2,6-dimethyl-1-aminoindene are inactive. Currently reported synthesis methods in the literature, such as patent CN108794339B, mainly involve converting 2,6-dimethylindenone into a ketoxime, followed by reduction to obtain the racemic 2,6-dimethyl-1-aminoindene, and then through cis-trans separation and chiral resolution to obtain (R,S) 2,6-dimethyl-1-aminoindene. This synthesis method has a long route, a relatively complex process, low yield, and high cost; therefore, there is an urgent technical need to develop a new process with low cost and short route. Summary of the Invention

[0003] Aiming at the problems existing in the synthesis process of the current prior art, the present invention provides a method for catalytically synthesizing the chiral 2,6-dimethyl-1-aminoindene, a pesticide intermediate, using transaminase.

[0004] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0005] A method for synthesizing the chiral 2,6-dimethyl-1-aminoindene, a pesticide intermediate, has the following reaction formula:

[0006]

[0007] Under the catalysis of ω-transaminase and coenzyme, 2,6-dimethylindenone shown in formula I undergoes an amination reaction with an amino donor to generate (1R,2S)-2,6-dimethyl-2,3-dihydro-inden-1-amine shown in formula II.

[0008] Furthermore, 2,6-dimethylindenone shown in formula I and an amino donor react under a system with a pH value of 6.0 - 9.0, and under the catalysis of ω-transaminase and pyridoxal phosphate, the amination reaction is carried out at 20°C - 50°C for 8 - 24 hours to generate (1R,2S)-2,6-dimethyl-2,3-dihydro-inden-1-amine shown in formula II.

[0009] The amino acid sequence of the ω-transaminase is as shown in SEQ ID NO.1.

[0010] The molar ratio of the ω-transaminase to the 2,6-dimethylindanone represented by Formula I is (0.001-0.1):1.

[0011] The ω-transaminase is a transaminase of Arthrobacter, and its amino acid sequence is shown as any one of SEQ ID NO.1.

[0012] Furthermore, the ω-transaminase is the Arthrobacter sp transaminase which is digested by restriction enzyme sites XhoI and Nde I, and then ligated to the pET28a(+) vector to obtain a transaminase recombinant expression plasmid. The recombinant plasmid is transformed into Escherichia coli BL21(DE3) competent cells, and monoclonal bacteria of the transaminase recombinant expression bacteria are obtained by screening with kanamycin. Then the strain is cultured in an LB liquid medium containing kanamycin resistance until the logarithmic growth phase, and then IPTG (isopropyl β-D-thiogalactoside) is added to the system to a final concentration of 0.1 mM to 0.3 mM, and the target transaminase is induced to express at 16°C to 20°C. After induction for 20 hours, the cells are collected by centrifugation and purified to obtain the ω-transaminase containing the amino acid shown in SEQ ID NO.1.

[0013] The amino donor is one or more of isopropylamine, a-methylbenzylamine, alanine, 1,2-propanediamine, 1,4-butanediamine, 1,5-pentanediamine or trifluoroethylamine.

[0014] The molar ratio of the amino donor to the 2,6-dimethylindanone represented by Formula 1 is (3-20):1.

[0015] The final concentration of coenzyme pyridoxal phosphate in the reaction system is 0.05-0.25 mmol.

[0016] During the transamination reaction process, the pH value of the reaction system is 6.0-9.0, which is adjusted by a phosphate buffer system.

[0017] During the transamination reaction process, an organic solvent co-solvent is added, and the addition amount of the organic solvent co-solvent is 1-5% of the volume of the potassium dihydrogen phosphate buffer solution.

[0018] The organic solvent co-solvent is dimethyl sulfoxide, methanol, ethanol; preferably dimethyl sulfoxide; the addition amount is preferably 3% of the volume of potassium dihydrogen phosphate.

[0019] Generally speaking, compared with the prior art through the technical solution of the present invention, the following technical advantages are mainly possessed:

[0020] The present invention catalyzes the synthesis of (1R,2S)-2,6-dimethyl-1-aminoindane by transaminase, and has the advantages of low raw material cost, high safety, high total yield and high optical purity of the product, which is beneficial to industrial production; specifically:

[0021] The synthetic method of the present invention for (R,S)-2,6-dimethyl-1-aminoindene II has a short route, mild reaction conditions and simple synthesis steps. (R,S)-2,6-dimethyl-1-aminoindene II can be obtained from 2,6-dimethylindanone I through a one-step reaction, thus omitting processes such as oxime preparation, reduction synthesis, cis-trans separation, and chiral resolution, solving the disadvantages of a long synthesis route, a large amount of three wastes, and low selectivity of chiral products. The yield of the (R,S) chiral compound is as high as 70%, and the ee value is 99.5%. In the prior art, such as the process described in CN108794339B, the route is long and the yield is only 40.1%. Among them, the conversion of the cis isomer to the trans isomer requires a high pressure of 30-35 atm, a reaction temperature of 110 °C, and a reaction time of 24 hours. At the same time, it consumes palladium-carbon catalyst, requires high temperature and high pressure, has high energy consumption and low conversion efficiency.

[0022] The preparation method of the present invention has mild reactions. It uses transaminase fermented by Escherichia coli, which has a wide and common source of strains and convenient enzyme preparation technology. At the same time, when it is combined with a coenzyme (pyridoxal phosphate), unexpectedly, high conversion and high chiral selectivity are achieved in a mild water system, and (R,S)-2,6-dimethyl-1-aminoindene (II) is efficiently synthesized. Through process research, the synthesis route and post-treatment process are simplified, and the recycling of ineffective substances is avoided, greatly reducing the production cost and being conducive to industrial production. Description of the Drawings

[0023] Figure 1 It is an electrophoretogram of the purified transaminase provided by the embodiment of the present invention.

[0024] Figure 2 It is a spectrum diagram of the synthesis of (R,S)-2,6-dimethyl-1-aminoindene (II) provided by the embodiment of the present invention.

[0025] Figure 3 It is a spectrum diagram of the synthesis of (R,S)-2,6-dimethyl-1-aminoindene (II) provided by the embodiment of the present invention. Detailed Embodiments

[0026] In order to make the objectives, technical solutions and advantages of the present invention clearer, the present invention will be further described in detail below with reference to the drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention. In addition, the technical features involved in the various embodiments of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0027] The reagent involved in the synthesis of chiral 2,6-dimethyl-1-aminoindan by the transaminase method adopted in the present invention is less and cheaply available, the reaction conditions are mild, which greatly simplifies the synthesis steps required, and can obtain the pesticide intermediate (1R,2S)-2,6-dimethyl-2,3-dihydro-inden-1-amine with a yield of 70% and an ee value of up to 99.5%, having broad application prospects and market value.

[0028] Example 1

[0029] The construction, expression, and purification of the transaminase utilize gene mining technology to obtain the nucleotide sequence of the transaminase from Arthrobacter sp from the NCBI database. According to the codon preference of Escherichia coli, the codons are optimized, and the nucleotide sequence of the transaminase from Arthrobacter sp is synthesized by the method of total gene synthesis. Through the restriction enzyme sites Xho I and Nde I, this gene is cloned onto the pET28a(+) vector to obtain the recombinant expression plasmid of the transaminase.

[0030] Take 1 μL of the recombinant plasmid, heat shock it at 42 °C for 90 seconds, and transform it into 100 μL of Escherichia coli BL21(DE3) competent cells. After recovery at 37 °C for 1 hour, take out 100 μL of the cell suspension and spread it on the LB solid medium containing 50 μg / mL kanamycin. At 37 °C, after static overnight culture, monoclonal colonies of the recombinant expression bacteria of the transaminase are obtained, inoculated into 10 ml of the LB liquid medium containing 50 μg / mL kanamycin, and cultured overnight on a shaker at 37 °C. Take the overnight culture and inoculate it into 500 ml of the LB liquid medium containing 50 μg / mL kanamycin resistance at an inoculation amount of 1 wt.%, and culture it on a shaker at 37 °C until the logarithmic growth phase, add 0.1 mM - 0.3 mM IPTG (isopropyl β-D-thiogalactoside), and induce the expression of the target transaminase at 16 °C - 20 °C. After 20 hours of induction, centrifuge to collect the bacterial cells for standby.

[0031] The wet bacterial cells are disrupted by the ultrasonic disruption method. Take the above-collected wet bacterial cells, suspend them with 10 mL of PBS buffer (pH = 7.5), use an ultrasonic disruptor for ultrasonic disruption, with an effective time of 15 min, and centrifuge at 8000 r / min for 30 min to collect the disrupted supernatant.

[0032] The protein is separated and purified by Ni NTA affinity chromatography. The eluate containing the target protein is obtained, and after concentration through a 10 kDa ultrafiltration membrane, the purified transaminase is obtained. The expression of the transaminase is examined by SDS PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis). Some results are as Figure 1 shown, the transaminase is successfully induced to express in the recombinant bacteria, and the amino acid sequence of the purified transaminase is as shown in SEQ ID NO.1.

[0033] SEQ ID NO.1

[0034] Met Ala Phe Ser Ala Asp Thr Pro Glu Ile Val Tyr Thr His Asp Thr Gly Leu Asp Tyr Ile Thr Tyr Ser Asp Tyr Glu Leu Asp Pro Ala Asn Pro Leu Ala Gly Gly Ala Ala Trp Ile Glu Gly Ala Phe Val Pro Pro Ser Glu Ala Arg Ile Ser Ile Phe Asp Gln Gly Phe Tyr Thr Ser Asp Ala Thr Tyr Thr Thr Phe His Val Trp Asn Gly Asn Ala Phe Arg Leu Gly Asp His Ile Glu Arg Leu Phe Ser Asn Ala Glu Ser Ile Arg Leu Ile Pro Pro Leu Thr Gln Asp Glu Val Lys Glu Ile Ala Leu Glu Leu Val Ala Lys Thr Glu Leu Arg Glu Ala Met Val Thr Val Thr Ile Thr Arg Gly Tyr Ser Ser Thr Pro Phe Glu Arg Asp Ile Thr Lys His Arg Pro Gln Val Tyr Met Ser Ala Cys Pro Tyr Gln Trp Ile Val Pro Phe Asp Arg Ile Arg Asp Gly Val His Leu Met Val Ala Gln Ser Val Arg Arg Thr Pro Arg Ser Ser Ile Asp Pro Gln Val Lys Asn Phe Gln Trp Gly Asp Leu Ile Arg Ala Ile Gln Glu Thr His Asp Arg Gly Phe Glu Leu Pro Leu Leu Leu Asp Cys Asp Asn Leu Leu Ala Glu Gly Pro Gly Phe Asn Val Val Val Ile Lys Asp Gly Val Val Arg Ser Pro Gly Arg Ala Ala Leu Pro Gly Ile Thr Arg Lys Thr Val Leu Glu Ile AlaGluSer Leu Gly His Glu Ala Ile LeuAla Asp Ile Thr Pro Ala Glu Leu Tyr Asp Ala Asp Glu Val Leu Gly CysSer ThrGly Gly Gly Val Trp Pro Phe Val Ser Val Asp Gly Asn Ser Ile Ser Asp Gly ValPro Gly Pro Val ThrGln Ser Ile Ile Arg Arg Tyr Trp Glu Leu Asn Val Glu ProSer Ser Leu Leu Thr Pro Val Gln Tyr

[0035] The nucleotide sequence is

[0036] atgagcgatg aaccgatcat ttacatcaat ggcgattatc tgccgctgag ccaggcccgcgttagcccag ttgatcaagg ctttctgctgggcgatggcg tgtttgatgt ggtgagcgcg tggaaaggcaatatttttaa actggatgcg catctggatc gctttttcga tagcattcaggcggcccgcc tgaatcatgatatgagccgc gatgcgtgga aagaagcgat tattgaaacc acccgccgca atggcctggatgatgcgagtattcgcttta ttgtgacccg cggcgaaccg aaaggcgtgg tggcggatcc acgcgattttaaaccgacct gcattgtgtg ggtggcgccgtatatttttc tggcggatga agaaaaacgc cgcaatggcattcgcctgat gattagcgcg acccgcggct ttccggcgga tactttagatccgcgttata aatgcctggatcgcctgcat agccagctga ttcgcctgga agcgctggaa gcgggctatg atgatgcgctgtggctggatcatagcggcc atgtgagcga aagcgcggcg agcaatctgt ttattgtgaa aaatggcgtgctgtataccc cgagcgcggg cattttgcgcggcattaccc gtgataccat tctggaactg gcgaccgaactggatattcc gtggaaagaa cgccagctga gcgcgtttga tgtgtatattgcggatgaag tgtttacctgcagcaccgcg ggcggcgcgt taccagttcg tgaagttgcg ggtcgtacca ttcgcggtaccaccccgggtccaattaccc aagcgattga taatgcgtat tgggcgatgc gcgaaaccga tcgctatgcgaccccgctgt aa

[0037] Example 2:

[0038] Into a 1000 ml round-bottomed four-necked flask, 24 g (0.15 mol) of 2,6-dimethylindanone, 181.5 g (1.5 mol) of α-methylbenzylamine, 250 ml of phosphate buffer solution with pH = 7.2, the purified protein ω-transaminase (0.0015 mol) from Example 1 above, 0.03 g of pyridoxal phosphate, and 7.5 mL of dimethyl sulfoxide were added successively. The reaction temperature was controlled at 40 °C and the reaction was stirred for 24 h. After the reaction was completed, 300 ml of ethyl acetate was added to the system for extraction three times. The oil layers were combined and concentrated under reduced pressure to obtain a yellow oily compound: (1R,2S)2,6-dimethyl-1-aminoindene (see Figure 2 and 3 ), with a yield of 70%; the ee value was 99%.

[0039] Example 3:

[0040] Into a 1000 ml round-bottomed four-necked flask, 24 g (0.15 mol) of 2,6-dimethylindanone, 133.5 g (1.5 mol) of alanine, 250 ml of phosphate buffer solution with pH = 7.2, ω-transaminase (0.0015 mol), 0.03 g of pyridoxal phosphate, and 7.5 mL of dimethyl sulfoxide were added successively. The reaction temperature was controlled at 40 °C and the reaction was stirred for 24 h. After the reaction was completed, 300 ml of ethyl acetate was added to the system for extraction three times. The oil layers were combined and concentrated under reduced pressure to obtain a yellow oily compound: (1R,2S)2,6-dimethyl-1-aminoindene, with a yield of 65%; the ee value was 99%.

[0041] Example 4:

[0042] Into a 1000 ml round-bottomed four-necked flask, 24 g (0.15 mol) of 2,6-dimethylindanone, 111.2 g (1.5 mol) of 1,2-propanediamine, 250 ml of phosphate buffer solution with pH = 7.2, ω-transaminase (0.0015 mol), 0.03 g of pyridoxal phosphate, and 7.5 mL of dimethyl sulfoxide were added successively. The reaction temperature was controlled at 40 °C and the reaction was stirred for 24 h. After the reaction was completed, 300 ml of ethyl acetate was added to the system for extraction three times. The oil layers were combined and concentrated under reduced pressure to obtain a yellow oily compound: (1R,2S)2,6-dimethyl-1-aminoindene, with a yield of 62%; the ee value was 99%.

[0043] Those skilled in the art can easily understand that the above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principle of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for synthesizing chiral 2,6-dimethyl-1-aminoindene, a pesticide intermediate, characterized in that, The reaction formula is as follows: Under the catalysis of ω - transaminase and coenzyme, 2,6 - dimethylindanone shown in Formula I undergoes an amination reaction with an amino donor to produce (1R,2S) - 2,6 - dimethyl - 2,3 - dihydro - indene - 1 - amine shown in Formula II.

2. The method for synthesizing the chiral 2,6-dimethyl-1-aminoindene as a pesticide intermediate according to claim 1, wherein, 2,6 - dimethylindanone shown in Formula I and an amino donor react in a system with a pH value of 6.0 - 9.0 under the catalysis of ω - transaminase and pyridoxal phosphate at 20°C - 50°C for 8 - 24 hours to produce (1R,2S) - 2,6 - dimethyl - 2,3 - dihydro - indene - 1 - amine shown in Formula II.

3. The method for synthesizing chiral 2,6-dimethyl-1-aminoindene as a pesticide intermediate according to claim 1 or 2, characterized in that, The amino acid sequence of the ω - transaminase is as shown in SEQ ID NO.

1.

4. The method for synthesizing chiral 2,6-dimethyl-1-aminoindene as a pesticide intermediate according to claim 3, characterized in that, The molar ratio of the ω - transaminase to 2,6 - dimethylindanone shown in Formula I is (0.001 - 0.1):

1.

5. The method for synthesizing chiral 2,6-dimethyl-1-aminoindene as a synthetic pesticide intermediate according to claim 1 or 2, characterized in that, The amino donor is one or more of isopropylamine, α - methylbenzylamine, alanine, 1,2 - propanediamine, 1,4 - butanediamine, 1,5 - pentanediamine, or trifluoroethylamine.

6. The method for synthesizing the chiral 2,6-dimethyl-1-aminoindene as a pesticide intermediate according to claim 5, characterized in that, The molar ratio of the amino donor to 2,6 - dimethylindanone shown in Formula 1 is (3 - 20):

1.

7. The method for synthesizing the chiral 2,6-dimethyl-1-aminoindene as a pesticide intermediate according to claim 1 or 2, characterized in that, The final concentration of coenzyme pyridoxal phosphate in the reaction system is 0.05 - 0.25 mmol.

8. The method for synthesizing the chiral 2,6-dimethyl-1-aminoindene as a pesticide intermediate according to claim 2, wherein During the transamination reaction process, the pH value of the reaction system is 6.0 - 9.0, which is adjusted by a phosphate buffer system.

9. The method for synthesizing chiral 2,6-dimethyl-1-aminoindene as a pesticide intermediate according to claim 2 or 8, characterized in that, During the transamination reaction process, an organic solvent cosolvent is added, and the addition amount of the organic solvent cosolvent is 1 - 5% of the volume of the potassium dihydrogen phosphate buffer solution.

10. The method for synthesizing chiral 2,6-dimethyl-1-aminoindene as a synthetic pesticide intermediate according to claim 1 or 2, characterized in that, After the reaction, the system is repeatedly extracted with a solvent, the oil layers are combined, and after concentration under negative pressure, a yellow oily compound (1R,2S)2,6 - dimethyl - 1 - aminoindene with a high yield is obtained.

Images