Method for detecting miR155 based on CRISPR / Cas12a and isothermal amplification and application thereof

Abstract

The invention provides a method for detecting miR155 based on CRISPR / Cas12a and isothermal amplification and application of the method, the method comprises an enzyme amplification reaction and a CRISPR shearing reaction, the target miR155 can be effectively converted into a biological signal capable of being recognized by the CRISPR / Cas12a through the amplification reaction, the biological signal is amplified, and therefore sensitivity and specificity are improved; according to the Cas12a fluorescent probe, a reporter chain modified with a quenching group and a fluorophore is cut by activating trans-cleavage side cutting activity of Cas12a, recovery of a fluorescence signal is achieved, the Cas12a fluorescent probe has high sensitivity and good selectivity, miR155 can be quantitatively detected, and LOD is 0.034 pM. The detection method provided by the invention is used for fluorescence detection and transverse flow analysis, has relatively high sensitivity and specificity, and can be used for actual sample detection.

Description

Technical Field

[0001] The present invention belongs to the technical field of drug detection, and particularly relates to a method for detecting miR155 based on CRISPR / Cas12a and isothermal amplification and its application. Background Art

[0002] Breast cancer is the most common cancer type among women in the world and also the most common cause of female death. The main cause of breast cancer death is distant tumor metastasis. Breast cancer metastasis is a complex process involving multiple genes and multiple steps, including the growth advantage of tumor cells themselves, reduction of intercellular adhesion, degradation of extracellular matrix and basement membrane, cell movement and migration, blood vessels and many factors. Multiple genes and proteins are involved in this process. Research shows that tumor metastasis is not only affected by protein-coding genes but also regulated by non-coding genes. MicroRNA is a single-stranded non-coding small RNA that is highly conserved in evolution. Specific binding to target gene miRNA can affect the expression level of target proteins and play a role in protein-involved signaling pathways.

[0003] As a highly prevalent tumor in the population, one of the main reasons for the high mortality rate of breast cancer is the difficulty in early diagnosis, resulting in patients missing the treatment opportunity. Existing breast cancer diagnosis methods include physical examination, tumor marker detection, imaging examination, and pathological examination, etc. Among them, improving the early detection efficiency through tumor marker detection is one of the current research hotspots. The determination of proto-oncogenes and tumor suppressor genes lacks specificity, and carbohydrate antigen markers such as CA153 are not only not highly specific but also have low sensitivity in the early stage. Some protein markers and hormone receptors discovered in recent years have become the bottleneck of this method due to limited detection methods. The detection methods of miRNA have made rapid progress in recent years, and even if there are only a few copies in the sample, they can be accurately detected, which provides the possibility for early clinical diagnosis. MiR155 is a miRNA that has been proven to be related to the occurrence of breast cancer. Its expression in breast cancer tissues is significantly up-regulated compared with normal tissues, and this difference is significant. The discovery by the Basova research group that miRNA can stably exist in the blood provides the possibility for detecting miR155 in the blood.

[0004] Clustered regularly interspaced short palindromic repeats / CRISPR-associated protein (CRISPR / Cas) is an adaptive immune system originally derived from most bacteria and archaea for defending against the invasion of nucleic acids. The CRISPR / Cas system has explored various applications from basic research to clinical medicine, including the generation of animal models, functional gene screening, epigenetic control, cellular genome imaging, the treatment of genetic diseases, in vitro diagnosis, etc. In terms of in vitro diagnosis, class II CRISPR / Cas systems, especially CRISPR / Cas12a and CRISPR / Cas13a, have unique advantages such as high detection sensitivity and specificity, as well as the feasibility of developing point-of-care diagnostic technologies. Jiang et al. designed EGFR790 and EGFR858 targeting crRNA, identified and detected mutant epidermal growth factor receptor genes through the CRISPR / Cas12a system, and designed a CRISPR / Cas12a-based amplification-free strategy for breast cancer gene 1 detection. Combining the nucleic acid amplification strategy of CRISPR / Cas with isothermal nucleic acid amplification methods can have detection sensitivity comparable to that of PCR. Doudna et al. achieved sensitive detection of human papillomavirus DNA using CRISPR / Cas12a-assisted RPA isothermal amplification technology. In addition, the CRISPR / Cas system can distinguish single-base mismatches in target nucleic acids, which enables highly specific detection. Compared with the PCR method that requires a thermal cycling process and complex operations, CRISPR / Cas-mediated detection is simple and time-saving, and is a promising point-of-care nucleic acid detection method.

[0005] Lateral flow assays (LFAs), also known as immunochromatographic assays (ICAs), are paper-based analytical methods for detecting various analytes in different matrices. A liquid sample or sample extract is dropped on the test strip, and the result is shown within a few minutes. LFAs are a point-of-care (POC) method first introduced in 1984 by Unipath (a branch of Unilever in Cornwall, UK) as a urine-based pregnancy test. They have quickly become a very popular analytical platform worldwide, and so far, hundreds of LFAs have been reported and commercialized. LFAs can use different materials to label antibodies, such as latex beads, carbon nanoparticles, colloidal silver, dye-loaded liposomes, gold nanoparticles (AuNPs), quantum dots, etc. Each label can create different characteristics in the diagnostic platform, but the main purpose of using different labels is to attempt more sensitive analysis. Among them, AuNPs, due to their unique optical properties, can produce observable colorimetric signals by the naked eye, have high stability in liquid or dry form, and are easy to conjugate with biomaterials. Therefore, they are still the most widely used and popular label. Summary of the Invention

[0006] Based on the prior art, the object of the present invention is to provide a method for detecting miR155 based on CRISPR / Cas12a and isothermal amplification, including an enzymatic amplification reaction and a CRISPR cleavage reaction. The amplification reaction can effectively convert the target miR155 into a biological signal recognizable by CRISPR / Cas12a and amplify it, thereby improving sensitivity and specificity. By activating the trans-cleavage activity of Cas12a, the reporter strand modified with a quenching group and a fluorescent group is cleaved, realizing the restoration of the fluorescent signal. It has high sensitivity and good selectivity, can quantitatively detect miR155, and the LOD is 0.034 pM.

[0007] The second object of the present invention is to provide a reagent for detecting miR155.

[0008] The third object of the present invention is the application of the method for detecting miR155 based on CRISPR / Cas12a and isothermal amplification in the detection of miR155, which can be applied to a lateral flow assay strip to achieve efficient and convenient visual detection.

[0009] The technical solution of the present invention is as follows:

[0010] The method for detecting miR155 based on CRISPR / Cas12a and isothermal amplification includes the following steps:

[0011] (1) Preparation of AuNPs: A chemical reaction is carried out between HAuCl4 solution and trisodium citrate solution to prepare AuNPs;

[0012] (2) Preparation of reporter1 strand: The DNA strand reporter1 is incubated in a TCEP solution, and then the AuNPs obtained in step (1) are added for reaction to obtain a reporter1-modified DNA-AuNPs conjugate as the reporter1 strand;

[0013] (3) Preparation of reporter 2-1 strand: The DNA strand reporter 2-1 is incubated in a TCEP solution, and then the AuNPs obtained in step (1) are added for reaction to obtain a reporter 2-1 -modified DNA-AuNPs conjugate as the reporter 2-1 strand;

[0014] (4) Preparation of reporter2 strand: The rQDs suspension was dispersed in PBS buffer, and the coupling agent EDC was added for incubation. The resulting reaction solution was centrifuged to obtain activated rQDs, which were then redispersed in PBS buffer. DNA strand reporter was added for further incubation to obtain the rQDs-DNA conjugate modified with reporter, which served as the reporter strand. It was cross-linked with the Reporter strand obtained in step (3), and the resulting cross-linked product served as the reporter2 strand. 2-2 Perform further incubation to obtain reporter 2-2 Modified rQDs-DNA conjugate, serving as the reporter 2-2 strand; Cross-linking reaction was carried out with the Reporter 2-1 strand obtained in step (3), and the resulting cross-linked product served as the reporter2 strand;

[0015] (5) Enzyme amplification reaction: A mixed solution containing miR155, dNTPs, Bst DNA polymerase, primer strand P, hairpin probe HP-4, and Bst reaction buffer was incubated, and then heated to 70 - 90 °C to inactivate the polymerase.

[0016] (6) Detection of miRNA by CRISPR / Cas12a: To the reaction solution obtained in the enzyme amplification reaction in step (5), CrRNA, Cas12a, the reporter1 strand obtained in step (2), the reporter2 strand obtained in step (4), and NEBuffer 2.1 reaction buffer were added for the CRISPR reaction, and the resulting reaction solution was used to detect the concentration of miR155 on a microplate reader.

[0017] Among them,

[0018] The sequence of the sulfonated DNA strand reporter1 is as follows: SH-AACCCCAAAA-FAM;

[0019] The sequence of the sulfonated DNA strand reporter 2-1 is as follows: SH-AAAACCCCAATTTTTTTTTTTTTAAA;

[0020] The sequence of the DNA strand reporter 2-2 is as follows: Bio-TTTAAAAAAAAAAAAATTA-NH2;

[0021] The sequence of CrRNA is as follows:

[0022] UAAUUUCUACUAAGUGUAGAUCGUCGCCGUCCAGCUACCCC;

[0023] The sequence of primer strand P is as follows: TGTCCA;

[0024] The sequence of hairpin probe HP-4 is as follows:

[0025] CACATCGCCTTAATTTACGTCGCCGTCCAGCTACCCCTATCACGATTAGCATTAA GGCGATGTG。

[0026] For the present invention, in step (1), the molar ratio of HAuCl4 to trisodium citrate is 25:90 - 105; preferably 25:95 - 100; more preferably 25:97.

[0027] For the present invention, in step (2), the molar ratio of DNA strand reporter1 to TCEP is 1:240 - 260; preferably 1:245 - 255; more preferably 1:250.

[0028] In step (2), the molar ratio of DNA strand reporter1 to AuNPs is 1:240 - 260; preferably 1:245 - 255; more preferably 1:250.

[0029] For the present invention, in step (3), DNA strand reporter 2-1 The molar ratio to TCEP is 1:240 - 260; preferably 1:245 - 255; more preferably 1:250.

[0030] In step (3), DNA strand reporter 2-1 The molar ratio to AuNPs is 1:240 - 260; preferably 1:245 - 255; more preferably 1:250.

[0031] For the present invention, in step (4), the weight ratio of rQDs to coupling agent EDC is 15 - 35:6; preferably 20 - 30:6; more preferably 25:6. In step (4), the ratio of rQDs to DNA strand reporter 2-2 Is 15 - 35:6; preferably 20 - 30:6; more preferably 25:6.

[0032] For the present invention, in step (5), during the enzyme amplification reaction, each 20 μL of the mixed solution contains the following components: 1 - 3 μL of miR155, 0.5 - 1.5 μL of 1 - 3 mM dNTPs, 2 - 6 U / μL of Bst DNA polymerase, 90 - 110 nM of primer strand P, 90 - 110 hairpin probe HP - 4, and 0.5 - 1.5×Bst reaction buffer.

[0033] In a preferred embodiment, in step (5), during the enzymatic amplification reaction, each 20 μL of the mixed solution contains the following components: 2 μL of miR155, 1 μL of 2 mM dNTPs, 4 U / μL of Bst DNA polymerase, 100 nM primer strand P, 100 hairpin probe HP-4, and 1×Bst reaction buffer.

[0034] For the present invention, in step (6), during the CRISPR reaction, 1 - 3 μM of CrRNA, 450 - 550 nM of Cas12a, 3 - 7 nM of reporter1 strand, 40 - 60 nM of reporter2 strand, and

[0035] 0.5 - 1.5×NEBuffer 2.1 reaction buffer are added.

[0036] In a preferred embodiment, in step (6), 2 μM of CrRNA, 500 nM of Cas12a, 5 nM of reporter1 strand, 50 nM of reporter2 strand, and 1×NEBuffer 2.1 reaction buffer are added.

[0037] The present invention also relates to a reagent for detecting miR155, comprising miR155, dNTPs, Bst DNA polymerase, primer strand P, hairpin probe HP-4, Bst reaction buffer, CrRNA, Cas12a, reporter1 strand, reporter2 strand, and NEBuffer 2.1 reaction buffer mentioned above.

[0038] The related oligonucleotide sequences involved in the present invention are shown in Table 1.

[0039] Table 1 Oligonucleotide Sequences

[0040]

[0041] For the convenience of sorting, the oligonucleotide sequences in Table 1 are abbreviated as follows:

[0042] The sequence of HP-1 is as follows: TTTACGTCGCCGTCCAGCTACCCCTATCACGAT TAGCA TTAAAGCTGGACA, denoted as SEQ ID NO.1.

[0043] The sequence of HP-2 is as follows: TTTACGTCGCCGTCCAGCTACCCCTATCACGATTAGCATTAAGTAGGTGGACA, denoted as SEQ ID NO.2.

[0044] The sequence of HP-3 is as follows: GGCCGTTAATGCTTTAGCACGCCGTCACCCCTATCACGATTAGCATTAACGGCC, denoted as SEQ ID NO.3.

[0045] The sequence of HP-4 is as follows: CACATCGCCTTAATTTACGTCGCCGTCCAGCTACCCCTATCACGATTAGCATTAAGGCGATGTG, denoted as SEQ ID NO.4.

[0046] The sulfonated DNA strand reporter1 is denoted as SH-SEQ ID NO.5-FAM, wherein the sequence of SEQ ID NO.5 is as follows: AACCCCAAAA.

[0047] Sulfonated DNA strand reporter 2-1 Denoted as SH-SEQ ID NO.6, wherein the sequence of SEQ ID NO.6 is as follows: AAAACCCCAATTTTTTTTTTTTTAAA.

[0048] DNA strand reporter 2-2 Denoted as Bio-SEQ ID NO.7-NH2, wherein the sequence of SEQ ID NO.7 is as follows: TTTAAAAAAAAAAAAATTA.

[0049] The sequence of cDNA is as follows: TTTAAAAAAAAAAAAATTGGGGTTTT, denoted as SEQ ID NO.8.

[0050] The sequence of CrRNA is as follows: UAAUUUCUACUAAGUGUAGAUCGUCGCCGUCC AGCUACCCC, denoted as SEQ ID NO.9.

[0051] The sequence of miR155 is as follows: UUAAUGCUAAUCGUGAUAGGGGU, denoted as SEQ ID NO.10.

[0052] The sequence of miR101 is as follows: UACAGUACUGUGAUAACUGAAG, denoted as SEQ ID NO.11.

[0053] The sequence of miR210 is as follows: CUGUGCGUCUGACAGCGGCUGA, denoted as SEQ ID NO.12.

[0054] The sequence of miR21 is as follows: UAGCUUAUCAGACUGAUGUUGA, denoted as SEQ ID NO.13.

[0055] The sequence of miR122 is as follows: UGGAGUGUGACAAUGGUGUUUG, denoted as SEQ ID NO.14.

[0056] The method for detecting miR155 based on CRISPR / Cas12a and isothermal amplification provided by the present invention includes an enzymatic amplification reaction and a CRISPR cleavage reaction. Amplification is carried out through the "invasive stacking primer" amplification reaction (ISAR), which can circularize the target gene and generate double-strands with specific sequences. These double-strands can bind to the Cas12a-crRNA binary complex and activate the cleavage activity of the CRISPR / cas12a protease to cleave single-stranded DNA for fluorescence detection and lateral flow analysis. It has high sensitivity and specificity and can be used for the detection of actual samples. Based on the programmability of crRNA, this method can be extended to the detection of other nucleic acid markers.

[0057] The advantages of adopting the technical solution of the present invention are as follows:

[0058] The method for detecting miR155 provided by the present invention includes an enzymatic amplification reaction and a CRISPR cleavage reaction. The amplification reaction can effectively convert the target miR155 into a biological signal that can be recognized by CRISPR / Cas12a and amplify it, thereby improving sensitivity and specificity. By activating the trans-cleavage activity of Cas12a, the reporter strand modified with a quenching group and a fluorescent group is cleaved to restore the fluorescent signal. It has high sensitivity and good selectivity, can quantitatively detect miR155, and the LOD is 0.034 pM. The detection method of the present invention is used for fluorescence detection and lateral flow analysis, has high sensitivity and specificity, and can be used for the detection of actual samples. Brief Description of the Drawings

[0059] Figure 1 is the principle of detecting miR155 by the detection method of the present invention;

[0060] Figure 2 is the characterization diagram of the nanomaterial; wherein, Figure 2 A is the TEM image of gold nanoparticles (the inset is the hydrated particle size image); Figure 2 B is the UV image of AuNPs, DNA, and AuNPs-DNA; Figure 2 C is the TEM image of red quantum dots; Figure 2 D is the UV image of rQDs, DNA, and rQDs-DNA;

[0061] Figure 3 are the NUPACK simulation diagrams and fluorescence diagrams of four hairpin chains; among them, Figure 3 A is the NUPACK simulation diagram of four hairpin chains, Figure 3 B is the fluorescence diagram of adding / not adding miR155 to trigger the side cutting activity in four hairpin chains;

[0062] Figure 4 are the experimental feasibility verification diagrams; among them, Figure 4 A is the PAGE diagram of the ISAR reaction with different components added, Figure 4 B is the fluorescence diagram of the system with different components added, Figure 4 C is the fluorescence diagram corresponding to different concentrations of miR155;

[0063] Figure 5 are the temperature and time diagrams of the ISAR reaction; among them, Figure 5 A is the temperature optimization diagram; Figure 5 B is the time optimization diagram;

[0064] Figure 6 are the temperature and time diagrams of the CRISPR reaction; among them, Figure 6 A is the temperature optimization diagram; Figure 6 B is the time optimization diagram;

[0065] Figure 7 are the concentration optimization diagrams of BstDNA polymerase, hairpin probe HP-4, primer strand P, and Cas12a; among them, Figure 7 A is BstDNA polymerase; Figure 7 B is hairpin probe HP-4, Figure 7 C is primer strand P and Figure 7 D is Cas12a;

[0066] Figure 8 is the selectivity of the reaction system to miR155 and interfering miRNAs;

[0067] Figure 9 is the detection sensitivity of the detection method of the present invention to different concentrations of miR155; among them, Figure 9 A is the fluorescence change diagram of adding different concentrations of miR155, Figure 9 B is the linear fitting curve of the fluorescence intensity ratio (ΔF / F0) and Lg[miR155];

[0068] Figure 10 are the AuNPs lateral flow result diagrams and fluorescence lateral flow result diagrams of different concentrations of miR155; among them, Figure 10 A is the AuNPs lateral flow result diagram and fluorescence lateral flow result diagram. Specific implementation manners

[0069] The present invention can be better understood according to the following embodiments. However, those skilled in the art can easily understand that the content described in the embodiments is only used to illustrate the present invention and should not and will not limit the present invention described in detail in the claims.

[0070] Experimental Section

[0071] Reagents and Instruments

[0072] Tetrachloroauric acid (HAuCl4), trisodium citrate, 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide hydrochloride (EDC) were purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. Cas12a protein was purchased from Shanghai Huicheng Biotechnology Co., Ltd. 10×NEBuffer2.1 and Ultrapure Water (DNase / RNase-Free) were purchased from Shanghai Beyotime Biotechnology Co., Ltd. Red quantum dots (rQDs) were purchased from Shanghai Kundao Biotechnology Co., Ltd. Tris-(2-carboxyethyl)phosphine hydrochloride (TCEP) and RNase-Free PBS were purchased from Shanghai Macklin Biochemical Co., Ltd. Bst DNA polymerase, dNTP mixture (dNTPs) and the oligonucleotide chains used (Table 1) were all purchased from Shanghai Sangon Biotech Co., Ltd. The ultraviolet-visible spectrum was measured by a UV-2600 type ultraviolet-visible spectrophotometer (Shimadzu, Japan). The fluorescence spectrum was collected using a Synergy H1 type multi-functional microplate reader (USA).

[0073] Preparation of Gold Nanoparticles (AuNPs)

[0074] 2 mL of 50 mM HAuCl4 solution was added to 98 mL of double-distilled water. During stirring, the solution was heated to boiling, and then 10 mL of 38.8 mM trisodium citrate solution was quickly added. After keeping the temperature and stirring for 15 minutes, heating was stopped, and the resulting reaction solution was continuously stirred and cooled to room temperature to obtain a solution containing AuNPs. The color of the solution changed from light yellow to dark red throughout the process, indicating the formation of AuNPs. The obtained solution containing AuNPs was stored in a dark bottle at 4 °C for the next reaction.

[0075] Preparation of AuNPs-DNA Conjugates

[0076] The DNA strand modified with a thiol group at the 5' end (reporter1 or reporter 2-1) Preparation of AuNPs-DNA conjugates with AuNPs. Add 10 μL of 25 mM TCEP solution to 10 μL of DNA strand (reporter1, 100 μM), incubate at 20 - 30 °C for 30 minutes, then add 800 μL of 5 nM AuNPs solution, and oscillate at 20 - 30 °C for 12 hours to bind the thiol-modified DNA strand to the surface of AuNPs, obtaining a reaction solution containing reporter1-modified DNA-AuNPs conjugates. Add 1% Tween-20 to the reaction solution containing reporter1-modified DNA-AuNPs conjugates to make the final concentration of Tween-20 0.1%, and add 2 M NaCl in multiple portions to make the final concentration of NaCl 0.2 M, then oscillate at 20 - 30 °C for 8 hours to further increase the stability of the DNA-AuNPs conjugates. Centrifuge the excess reagents at 12000 rpm for 15 minutes, remove the supernatant, wash twice with 10 mM PBS, and then redisperse in PBS. The obtained reporter1-modified AuNPs-DNA conjugates are used as reporter1 strand and stored at 4 °C.

[0077] Referring to the preparation method of the reporter1-modified AuNPs-DNA conjugates above, use reporter 2-1 to replace reporter1 to prepare reporter 2-1 modified AuNPs-DNA conjugates, which are used as reporter 2-1 strand.

[0078] Preparation of rQDs-DNA conjugates

[0079] Take 50 μL of 10 mg / mL rQDs suspension, disperse it in 100 μL of PBS buffer (pH 6.0), then add 6 μL of 20 mg / mL coupling agent EDC, and incubate at 20 - 30 °C for 30 min. After incubation, centrifuge the obtained reaction solution at 12000 rpm for 10 min, remove the supernatant, and obtain activated rQDs. Disperse the activated rQDs in 100 μL of PBS buffer (pH 6.0) and ultrasonically disperse evenly. Take 20 μL of 100 μM DNA strand reporter 2-2 Add it to the activated rQDs solution, mix well, incubate at 20 - 30 °C for 30 min, centrifuge the obtained reaction solution at 12000 rpm for 10 min, remove the supernatant, wash twice with 10 mM PBS, and then redisperse in 10 mM PBS to obtain rQDs-DNA conjugates, which are used as reporter 2-2 strand and stored at 4 °C. The obtained Reporter 2-1Chain and reporter 2-2 The chain was crosslinked at 37 °C for 1 h, and the resulting crosslinked product was used as reporter2 chain and stored at 4 °C.

[0080] CRISPR / Cas12a detection of miRNA

[0081] The hairpin probe HP-4 and CrRNA were pretreated by reacting in a metal bath at 95 °C for 5 min. After the reaction, it was cooled to 20 - 30 °C and then stored on ice.

[0082] (1) Perform enzyme amplification reaction ISAR based on enzyme amplification. The amplification reaction was carried out in a 20 μL solution. The mixed solution contained 2 μL miR155 (which could be used at linear medium concentrations of 500 fM, 1 pM, 2 pM, 5 pM, 10 pM, 25 pM, 50 pM; precision medium concentration of 1 pM, 5 pM, 40 pM; selectivity medium concentration of 2 pM), 1 μL 2 mM dNTPs, 4 U / μL Bst DNA polymerase, 100 nM primer strand P, 100 nM hairpin probe HP-4, and 1×Bst reaction buffer. It was incubated in a centrifuge tube at 37 °C for 1.5 h, and then reacted at 80 °C for 2 min to inactivate the polymerase.

[0083] (2) Add 2 μM CrRNA, 500 nM Cas12a, reporter strand (reporter1 5 nM, reporter2 50 nM), and 1×NEBuffer 2.1 reaction buffer to the reaction solution obtained in step (1). React at 37 °C for 1 h to carry out the CRISPR reaction.

[0084] Specific detection

[0085] Use miR155 (2×10 -12 mol / L) and four different types of miRNAs (1×10 -11 mol / L), including miR21, miR101, miR210, and miR122, to evaluate the specificity of the system. Add different types of miRNAs with the same concentration to the mixed solution, perform the experiment according to the above operation steps, and detect the results on an enzyme - labeled instrument after completion.

[0086] Sensitivity test

[0087] Use the determined optimal detection reaction conditions to perform sensitivity detection. First, detect 50 pM miR155 by this detection method, and then gradually dilute miR155 for detection. Record the minimum concentration value that can obtain a stable signal and calculate the lowest detection limit.

[0088] Test strip detection

[0089] The test strip is mainly composed of a sample pad, a conjugate pad, a nitrocellulose membrane, and an absorbent pad. Streptavidin (SA) and cDNA strands are respectively coated on the nitrocellulose membrane to form a test line (T line, capturing biotin) and a control line (C line, capturing AuNPs). After drying at 37 °C for 1 hour, the above components are assembled on a backing card, and the test strip is stored in an aluminum foil bag at room temperature. The solution after the CRISPR reaction is dropped on the sample pad and runs with a PBS running solution containing 1% TW-20.

[0090] Detection principle

[0091] The principle of the detection method of the present invention for determining miR155 is as Figure 1 shown. The functional hairpin probe (HP) is designed to be recognized and opened by the target gene. The primer hybridizes with the opened hairpin stem. By adding dNTPs, under the action of Bst DNA polymerase, the target gene can be cycled and a specific sequence of double-stranded DNA can be generated. This double-stranded DNA can bind to the Cas12a-crRNA binary complex and activate the cleavage activity of the CRISPR / cas12a protease, which results in the cleavage of the reporter1 single-strand modified with AuNPs at the 5' end and FAM fluorophore at the 3' end, and the fluorescence signal is restored. Therefore, as the concentration of miR155 increases, the double-stranded DNA gradually increases and the fluorescence intensity increases. If the target is absent, double-stranded DNA cannot be generated and the activity of CRISPR / cas12a cannot be triggered, and no fluorescence signal can be detected.

[0092] The detection method of the present invention can be applied to lateral flow analysis. The reporter2 strand is a DNA strand modified with biotin, gold nanoparticles, and red quantum dots. When miR155 is present, the reporter strand is cleaved and the gold nanoparticles are separated from the red quantum dots. The T line is a DNA strand that is completely complementary to one end of the reporter2. As the concentration of the target increases, fewer gold nanoparticles are captured on the T line, the signal of gold is weaker, and the fluorescence signal is stronger. The C line captures the excess gold nanoparticles to generate a signal.

[0093] Nanomaterial characterization

[0094] To prove the successful synthesis of AuNPs, TEM characterization was carried out on it. Figure 2 A shows the TEM of AuNPs. It can be seen that AuNPs are spherical and evenly dispersed, and the particle size is about 17 nm. AuNPs have a strong ultraviolet absorption in the visible light region. Therefore, the maximum absorption wavelength of 520 nm can be detected with a UV-visible spectrophotometer ( Figure 2 B). As shown in Figure 2 B, when using a sulfurized DNA strand (reporter1 or reporter2-1 ) When modifying AuNPs, a characteristic absorption peak of DNA appeared at 258 nm. The results indicated the successful synthesis of AuNPs and AuNPs-DNA conjugates. Figure 2 C is the TEM of rQDs. It can be seen that rQDs are nearly spherical, evenly dispersed, and the particle size is about 167 nm. When using DNA (reporter 2-2 ) to modify rQDs, a characteristic absorption peak of DNA appeared at 258 nm, indicating the successful cross-linking of rQDs-DNA conjugates.

[0095] Design and screening of hairpin strands

[0096] First, the corresponding hairpin probe structure HP was designed according to the miR155 sequence, and the structure was predicted by NUPACK software ( Figure 3 A). As Figure 3 shown in B, the background signals of HP-1 and HP-2 strands are very strong, and the fluorescence value is still very high without the target. It may be due to the low formation efficiency of the hairpin strand caused by too many bases in the loop part. Most of them did not form hairpins and directly reacted with the polymerase to generate double-stranded DNA that could trigger the activity of cas12a. The number of bases in the loop was reduced and the hairpin strand HP-3 was redesigned. It can be seen from Figure 3B that the background signal was improved, but the fluorescence recovery efficiency after adding the target was not high. Subsequently, mismatches were added to improve the efficiency, and HP-4 was designed. According to the data, the fluorescence recovery efficiency after mismatching was significantly improved. Therefore, HP-4 was selected as the functional hairpin probe of the present invention.

[0097] Verification of experimental feasibility

[0098] To verify the feasibility of the experiment. First, polyacrylamide gel electrophoresis (PAGE) experiments were used to verify the feasibility of the enzyme amplification reaction. As Figure 4 shown in A, in lane 6, on the basis of the substrate strand, enzymes and dNTPs were added, and the band of the hairpin probe HP-4 did not change significantly. In lane 7, after adding the target RNA, the substrate strand band became weaker and double-stranded DNA was generated. This shows that in the presence of the target RNA, the enzyme amplification reaction was successfully carried out.

[0099] Based on this, we verified the feasibility of the CRISPR reaction. As Figure 4 shown in B, only the complete system with all components can activate the side-cutting activity of Cas12a and restore the fluorescence signal, and the fluorescence intensity increases with the increase of the target RNA concentration ( Figure 4 C).

[0100] Optimization of experimental conditions

[0101] To enable the detection method constructed for the present invention to have a better response to miR155, the detection conditions for miR155 were optimized, including the temperature and time of the enzyme amplification reaction, the temperature and time of the CRISPR reaction, the concentration of BstDNA polymerase, the hairpin probe HP-4, the primer strand P, and the Cas12a protein. When investigating the influence of each factor, the single-variable method was adopted, and the fluorescence ratio ΔF / F0 in the reaction system was used as the standard. The larger the ratio, the more sensitive the system's response to miR155, that is, the better the sensitivity of the system.

[0102] Optimization of the ISAR reaction temperature and time, as Figure 5 shown in A, when the reaction temperature of ISAR is 37 °C, ΔF / F0 is the largest. When the temperature decreases, the ratio drops, which may be due to the low efficiency of the ISAR reaction at lower temperatures and the difficulty of carrying out the amplification reaction. When the temperature is too high, the background signal is not easy to control. From Figure 5 B, it can be seen that when the ISAR reaction time reaches 90 min, the fluorescence intensity rises to the maximum value, and as the reaction time extends, the fluorescence signal decreases. Therefore, the optimal reaction temperature and reaction time of ISAR are set to 37 °C and 90 min.

[0103] Optimization of the CRISPR reaction temperature and time. According to Figure 6 A, it can be known that under the condition of 37 °C, when the ISAR reaction mixture reacts with the CRISPR system, the ΔF / F0 value is the highest, indicating that the optimal reaction temperature of the CRISPR system is 37 °C. Too high or too low a temperature is not suitable for the activity of the Cas12a protein. Too low a temperature results in insufficient protein activity, while too high a temperature causes the protein to be inactivated. From Figure 6 B, it can be seen that when the CRISPR reaction time reaches 60 min, the fluorescence intensity rises to the maximum value, and as the reaction time extends, the fluorescence signal decreases. Therefore, the optimal reaction temperature and reaction time of CRISPR are set to 37 °C and 60 min.

[0104] Different concentrations of BstDNA polymerase, hairpin probe HP-4, primer strand P, and Cas12a were added to the reaction solution for reaction, and the most suitable concentration was selected by comparing the fluorescence changes of the CRISPR / Cas12a system. Figure 7 A shows the optimization result of the polymerase concentration. As the concentration increases, the fluorescence ratio gradually increases and reaches the maximum at 4 U / μL. When the concentration further increases, the ratio gradually decreases. Therefore, the optimal concentration of the polymerase is 4 U / μL. Figure 7 B shows the optimization result of the hairpin probe HP-4 concentration. When the hairpin probe HP-4 is 100 nM, the ratio reaches the maximum. When the concentration further increases, the ratio gradually decreases. Therefore, the optimal dosage of the hairpin probe HP-4 is 100 nM. Figure 7C is the optimization result of primer chain P concentration. When primer chain P is 100 nM, the ratio reaches the maximum. As the concentration increases, the ratio gradually decreases. Therefore, the optimal dosage of primer chain P is 100 nM. Figure 7 D is the concentration optimization result of Cas12a. As the concentration increases, the fluorescence ratio gradually increases, reaching the maximum at 500nM. As the concentration increases again, the ratio gradually decreases. Therefore, the optimal concentration of Cas12a is 500nM.

[0105] Then, various interferences, including miR101 (1×10 -11 mol / L)、miR210(1×10 -11 mol / L)、miR21(1×10 -11 mol / L) and miR122 (1×10 -11 mol / L) to evaluate the specificity of the reaction system. Figure 8 As shown in Figure 2, although the concentration of the interfering substance was 5 times that of the target substance miR155 (2×10 -12 mol / L), but its fluorescence intensity was close to that of the blank. This indicates that the reaction system has almost no response to other RNAs and has good selectivity for miR155. The system can be used for the detection of actual serum samples.

[0106] Under the optimal reaction conditions, the detection sensitivity of the detection method of the present invention to different concentrations of miR155 was evaluated. Figure 9 As can be seen from A, as the concentration of miR155 increases, the green fluorescence intensity at 523 nm gradually increases, indicating that this method has a good fluorescence response to miR155, can quantify the concentration of miR155, and use the fluorescence intensity to make a linear fit to the logarithm of the concentration, as shown in Figure 9 As shown in Figure B, there is a good linear relationship in the range of 0.5 to 50 pM, the linear equation is F = 6.112Lg [miR155] + 2.566, the r value is 0.9919, and the detection limit is calculated as 0.03446 pM according to 3σ / k (where σ is the standard deviation of the blank sample, k is the slope of the calibration curve, n = 10). The results show that the CRISPR / Cas12a system prepared by the present invention has the ability to detect miR155.

[0107] The accuracy and precision of detecting miR155 were studied. Given that the detection range was 0.5 - 50 pM, three concentrations (1.00, 5.00, 40.00 pM) of low, medium, and high levels were selected to calculate the intra-day and inter-day precision and accuracy. As a result, as shown in Table 2, the intra-day and inter-day accuracy of the three concentrations of low, medium, and high levels was 88.9 - 106.4%, meeting the detection requirements for biological samples, and the intra-day and inter-day precision RSD < 15%. The results indicated that the CRISPR / Cas12a system constructed in the present invention could be used for the detection of miR155 in actual samples.

[0108] Table 2 Intra-day and inter-day precision and accuracy verification results for the determination of miR155 (n = 3)

[0109]

[0110] Test strip detection

[0111] Lateral flow detection is intuitive and convenient, and has good practical application potential in establishing a visual detection platform. To determine whether the results of CRISPR / Cas12a could be directly visualized with the naked eye, we used a lateral flow test strip to read out the results ( Figure 10 ). The test strip reading was based on the cleavage of the reporter strand. When there was no target, no amplification product could be generated, the collateral cleavage activity of cas12a would not be activated, the biotin on the reporter strand would bind to streptavidin on the T line for capture, generating a strong gold signal while the fluorescence signal was quenched, and the excess reporter strand would be captured by the DNA on the C line. When there was a target, the AuNPs on the reporter strand were cleaved, and the T line continued to capture the rQDs linked to biotin. Therefore, as the target concentration increased, the fluorescence band on the T line gradually enhanced, and the AuNPs band gradually weakened. As shown in Figure 10 A, on the T line, as the miR155 concentration increased from 0 M to 20 nM, the color of the band gradually faded from dark. However, Figure 10 the fluorescence color on Figure B showed the opposite trend, and miR155 as low as 100 pM could be clearly distinguished. These results indicated that the lateral flow analysis based on the CRISPR / Cas12a method had high sensitivity and broad application prospects in the visual detection of nucleic acids.

[0112] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that it is still possible to modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements for some of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for detecting miR155 based on CRISPR / Cas12a and isothermal amplification, characterized in that: The steps include: (1) Preparation of AuNPs: HAuCl4 solution and trisodium citrate solution are chemically reacted to prepare AuNPs; (2) Preparation of reporter 1 chain: incubate the DNA chain reporter 1 in a TCEP solution, and then add the AuNPs obtained in step (1) to react to obtain a reporter 1-modified DNA-AuNPs conjugate as the reporter 1 chain; (3) Reporter 2-1 Preparation of DNA strands: 2-1 Incubate in TCEP solution, then add AuNPs obtained in step (1) to react and obtain reporter 2-1 Modified DNA-AuNPs conjugates as reporters 2-1 chain; (4) Preparation of reporter 2 chain: The rQDs suspension was dispersed in PBS buffer, and the coupling agent EDC was added for incubation. The resulting reaction solution was centrifuged to obtain activated rQDs, which were dispersed in PBS buffer again and the reporter DNA chain was added. 2-2 Incubate again to obtain reporter 2-2 Modified rQDs-DNA conjugates as reporters 2-2 chain; and the Reporter obtained in step (3) 2-1 The chains undergo cross-linking reaction, and the resulting cross-linked product is used as reporter2 chain; (5) Enzyme amplification reaction: incubate a mixed solution containing miR155, dNTPs, BstDNA polymerase, primer chain P, hairpin probe HP-4 and Bst reaction buffer, and then heat it to 70-90° C. to inactivate the polymerase; (6) CRISPR / Cas12a detection of miRNA: To the reaction solution obtained in the enzyme amplification reaction in step (5), add crRNA, Cas12a, the reporter 1 chain obtained in step (2), the reporter 2 chain obtained in step (4) and NEBuffer 2.1 reaction buffer to carry out CRISPR reaction, and the concentration of miR155 in the obtained reaction solution is detected on a microplate reader; in, The sequence of the thiolated DNA strand reporter1 is as follows: SH-AACCCCAAAA-FAM; Sulfide DNA strand reporter 2-1 The sequence is as follows: SH-AAAACCCCAATTTTTTTTTTTTTAAA; DNA chain reporter 2-2 The sequence is as follows: Bio-TTTAAAAAAAAAAAAATTA-NH2; The sequence of crRNA is as follows: UAAUUUCUACUAAGUGUAGAUCGUCGCCGUCCAGCUACCCC; The sequence of primer strand P is as follows: TGTCCA; The sequence of the hairpin probe HP-4 is as follows: CACATCGCCTTAATTTACGTCGCCGTCCAGCTACCCCTATCACGATTAGCATTAAGGC GATGTG.

2. The method for detecting miR155 based on CRISPR / Cas12a and isothermal amplification according to claim 1, characterized in that, In step (1), the molar ratio of HAuCl4 to trisodium citrate is 25:90-105; preferably 25:95-100; more preferably 25:

97.

3. The method for detecting miR155 based on CRISPR / Cas12a and isothermal amplification according to claim 1, characterized in that, In step (2), the molar ratio of DNA chain reporter 1 to TCEP is 1:240-260; preferably 1:245-255; more preferably 1:250; the molar ratio of DNA chain reporter 1 to AuNPs is 1:240-260; preferably 1:245-255; more preferably 1:

250.

4. The method for detecting miR155 based on CRISPR / Cas12a and isothermal amplification according to claim 1, characterized in that, In step (3), the DNA strand reporter 2-1 The molar ratio of TCEP is 1:240-260; preferably 1:245-255; more preferably 1:250; DNA chain reporter 2-1 The molar ratio to AuNPs is 1:240-260; preferably 1:245-255; more preferably 1:

250.

5. The method for detecting miR155 based on CRISPR / Cas12a and isothermal amplification according to claim 1, characterized in that, In step (4), the weight ratio of rQDs to coupling agent EDC is 15-35:6; preferably 20-30:6; The preferred ratio is 25:6; rQDs and DNA chain reporter 2-2 The ratio is 15-35:6; preferably 20-30:6; More preferably it is 25:

6.

6. The method for detecting miR155 based on CRISPR / Cas12a and isothermal amplification according to claim 1, characterized in that, In step (5), during the enzyme amplification reaction, each 20 μL mixed solution contains the following components: 1-3 μL miR155, 0.5-1.5 μL 1-3 mM dNTPs, 2-6 U / μL Bst DNA polymerase, 90-110 nM primer chain P, 90-110 hairpin probe HP-4 and 0.5-1.5×Bst reaction buffer; preferably, each 20 μL mixed solution contains the following components: 2 μL miR155, 1 μL 2 mM dNTPs, 4 U / μL Bst DNA polymerase, 100 nM primer chain P, 100 hairpin probe HP-4 and 1×Bst reaction buffer.

7. The method for detecting miR155 based on CRISPR / Cas12a and isothermal amplification according to claim 1, characterized in that, In step (6), when performing the CRISPR reaction, 1-3 μM CrRNA, 450-550 nM Cas12a, 3-7 nM reporter 1 chain, 40-60 nM reporter 2 chain and 0.5-1.5×NEBuffer 2.1 reaction buffer were added.

8. The method for detecting miR155 based on CRISPR / Cas12a and isothermal amplification according to claim 7, characterized in that, In step (6), 2 μM CrRNA, 500 nM Cas12a, 5 nM reporter 1 strand, 50 nM reporter 2 strand and 1× NEBuffer 2.1 reaction buffer were added.

9. A reagent for detecting miR155, characterized in that: It comprises the miR155, dNTPs, BstDNA polymerase, primer chain P, hairpin probe HP-4, Bst reaction buffer, CrRNA, Cas12a, reporter1 chain, reporter2 chain and NEBuffer 2.1 reaction buffer described in claim 1.

10. Use of the method according to claim 1 in detecting miR155.

Images