A composition of multiplex PCR primers and probes for detecting microorganisms, a kit thereof, and a method thereof

By combining multiplex PCR primer and probe combinations with nucleic acid mass spectrometry, the problems of long detection cycles, complex operations, and high costs in cosmetic microbial detection have been solved, enabling rapid, simple, and efficient detection of cosmetic microorganisms.

CN120193108BActive Publication Date: 2026-01-23SCIENCE & TECHNOLOGY RESEARCH CENTER OF CHINA CUSTOMS
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510687476.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-27
Publication Date
2026-01-23
Estimated Expiration
2045-05-27

AI Technical Summary

Technical Problem

Existing technologies for microbial testing in cosmetics suffer from problems such as long testing cycles, complex operations, high costs, and limited testing throughput, making it difficult to quickly and simultaneously detect multiple microorganisms.

Method used

By employing a combination of multiplex PCR primers and probes, along with nucleic acid mass spectrometry, rapid detection of various microorganisms in cosmetics can be achieved through multiplex PCR amplification, SAP enzyme digestion, and single-base extension reaction.

Benefits of technology

It achieves simple, efficient, and accurate microbial testing of cosmetics, and can simultaneously detect 10-50 kinds of microorganisms, reducing testing costs and time, and improving testing throughput and accuracy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120193108B_ABST
    Figure CN120193108B_ABST
Patent Text Reader

Abstract

The application provides a composition of multiplex PCR primers and probes for detecting microorganisms, a kit and a method thereof. The composition comprises 10 pairs of primers for staphylococcus aureus, salmonella, pseudomonas aeruginosa, clostridium tetani, citrobacter freundii, streptobacterium maltophilia, burkholderia cepacia, klebsiella pneumoniae, candida albicans and escherichia coli, and 10 corresponding probes, wherein the 10 pairs of primers are shown as SEQ ID No. 1-20, and the 10 probes are shown as SEQ ID No. 21-30. The composition of primers and probes of the application is used for multiplex PCR for detecting microorganisms, is simple to operate, and has high detection accuracy.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular biology detection, and particularly relates to a composition of multiplex PCR primer and probe for detecting microorganisms, a kit and a method thereof. BACKGROUND

[0002] Most cosmetics contain rich nutrients, which are suitable for the growth and reproduction of microorganisms, and are very easy to cause microbial contamination. Excessive microbial contamination of cosmetics causes potential safety hazards to consumers, and therefore, the detection of microorganisms in cosmetics is an important indicator for measuring the quality of cosmetics.

[0003] Traditional agar plate culture combined with biochemical identification is the gold standard for detecting microorganisms in cosmetics. However, the traditional method has many defects: the separation and culture of microorganisms takes a long time, and biochemical detection also depends on the growth reaction of microorganisms, so the detection period is long, usually 4-5 days; a large amount of solid and liquid culture medium needs to be prepared, and the process is complicated; the operation is complex; and the biochemical reagents are expensive.

[0004] The multiplex PCR and real-time fluorescent quantitative molecular biology technologies based on PCR technology are continuously promoted in the market of detecting microorganisms in cosmetics due to their good specificity, high sensitivity and rapid detection characteristics. However, the detection throughput of the above technologies is still limited, and at most 6 kinds of microorganisms can be detected simultaneously, and multiplex PCR relies on gel electrophoresis detection, which takes a long time and has limited reliability, and the DNA staining agent used in detection has potential harm to the environment and human body.

[0005] Bio-DNA chip or second-generation sequencing can also achieve the purpose of simultaneously detecting ten kinds of microorganisms, but the detection cost is high.

[0006] Developing a technology for rapidly detecting more than 6 kinds of microorganisms at the same time will make the detection of microorganisms in cosmetics more convenient, provide better technical support for the biological safety of cosmetics, and is a technical problem to be solved in the field. SUMMARY

[0007] One object of the present application is to provide a composition of multiplex PCR primer and probe for detecting microorganisms.

[0008] Another object of the present application is to provide a kit of multiplex PCR primer and probe for detecting microorganisms.

[0009] Another object of the present application is to provide a method for detecting microorganisms by multiplex PCR, which is used for detecting Staphylococcus aureus, Salmonella, Pseudomonas aeruginosa, Clostridium tetani, Citrobacter freundii, Stenotrophomonas maltophilia, Burkholderia cepacia, Klebsiella pneumoniae, Candida albicans and Escherichia coli, and judging whether the sample to be detected, such as cosmetics, is contaminated with these microorganisms.

[0010] In one aspect, the present application provides a composition of multiplex PCR primers and probes for detecting microorganisms, wherein the composition comprises 10 pairs of primers and corresponding 10 probes (extension primers) for Staphylococcus aureus, Salmonella, Pseudomonas aeruginosa, Clostridium tetani, Citrobacter freundii, Stenotrophomonas maltophilia, Burkholderia cepacia, Klebsiella pneumoniae, Candida albicans, and Escherichia coli, the nucleotide sequences of the 10 pairs of primers are shown in SEQ ID Nos. 1-20, and the nucleotide sequences of the 10 probes are shown in SEQ ID Nos. 21-30.

[0011] There are many types of microorganisms that cause cosmetic pollution, and the following ten microorganisms (Staphylococcus aureus, Salmonella, Pseudomonas aeruginosa, Clostridium tetani, Citrobacter freundii, Stenotrophomonas maltophilia, Burkholderia cepacia, Klebsiella pneumoniae, Candida albicans, and Escherichia coli) are the species categories that need to be detected. Nucleic acid mass spectrometry is a detection technology based on time-of-flight mass spectrometry, which can identify and distinguish different nucleic acid sequences by measuring the molecular weight of nucleic acid molecules, and has the advantages of large throughput, more genes and SNP sites for detection, and more comprehensive advantages.

[0012] The present application develops a technology for simultaneously detecting ten types of microorganisms based on nucleic acid mass spectrometry, making cosmetic microbial detection more convenient, providing better technical support for the biological safety of cosmetics, and improving the detection efficiency and accuracy of cosmetic microbial detection.

[0013] According to some specific embodiments of the present application, in the composition of multiplex PCR primers and probes for detecting microorganisms of the present application, the forward primer and the reverse primer for detecting Staphylococcus aureus are shown in SEQ ID Nos. 1-2, and the probe is shown in SEQ ID No. 21;

[0014] The nucleotide sequences of the primers for Salmonella are shown in SEQ ID No. 3 and SEQ ID No. 4, and the probe is shown in SEQ ID No. 22;

[0015] The nucleotide sequences of the primers for Pseudomonas aeruginosa are shown in SEQ ID No. 5 and SEQ ID No. 6, and the probe is shown in SEQ ID No. 23;

[0016] The nucleotide sequences of the primers for Clostridium tetani are shown in SEQ ID No. 7 and SEQ ID No. 8, and the probe is shown in SEQ ID No. 24;

[0017] The nucleotide sequences of the primers targeting Citrobacter freundii are shown in SEQ ID No. 9 and SEQ ID No. 10, and the probes are shown in SEQ ID No. 25;

[0018] The nucleotide sequences of the primers targeting Stenotrophomonas maltophilia are shown in SEQ ID No. 11 and SEQ ID No. 12, and the probe is shown in SEQ ID No. 26;

[0019] The nucleotide sequences of the primers for Burkholderia cepacia are shown in SEQ ID No. 13 and SEQ ID No. 14, and the probe is shown in SEQ ID No. 27;

[0020] The nucleotide sequences of the primers targeting Klebsiella pneumoniae are shown in SEQ ID No. 15 and SEQ ID No. 16, and the probe is shown in SEQ ID No. 28;

[0021] The nucleotide sequences of the primers targeting Candida albicans are shown in SEQ ID No. 17 and SEQ ID No. 18, and the probe is shown in SEQ ID No. 29;

[0022] The nucleotide sequences of the primers targeting Escherichia coli are shown in SEQ ID No. 19 and SEQ ID No. 20, and the probe is shown in SEQ ID No. 30.

[0023] The present invention also provides a kit for multiplex PCR detection of microorganisms, wherein the kit comprises a composition of multiplex PCR primers and probes for detecting microorganisms as described above.

[0024] According to some specific embodiments of the present invention, the kit of the present invention further includes at least one of Multiplex PCR Mix, water, SAP Buffer, SAP enzyme, and Extend Reaction Mix.

[0025] The present invention also provides a method for non-diagnostic multiplex PCR detection of microorganisms, wherein the method includes performing multiplex PCR amplification using the above-described composition of multiplex PCR primers and probes for detecting microorganisms, and detecting whether Staphylococcus aureus, Salmonella, Pseudomonas aeruginosa, Clostridium tetani, Citrobacter freundii, Stenotrophomonas maltophilia, Burkholderia cepacia, Klebsiella pneumoniae, Candida albicans and / or Escherichia coli are present in the sample to be tested.

[0026] According to some specific embodiments of the present invention, in the method of the present invention, the sample to be tested is a cosmetic product, and the method includes the following steps:

[0027] Multiplex PCR amplification: Prepare a multiplex PCR reaction system containing the above 10 pairs of primers and the sample to be tested, perform multiplex PCR amplification reaction, and obtain PCR amplification reaction products.

[0028] SAP enzyme digestion reaction: The PCR amplification reaction product is mixed with SAP Buffer, SAP enzyme and water and then subjected to SAP enzyme digestion reaction to obtain SAP enzyme digestion reaction product;

[0029] Single-base extension reaction: The SAP enzyme digestion reaction product is mixed with the probe mentioned above to prepare a single-base extension reaction system, and a single-base extension reaction is carried out to obtain the single-base extension reaction product.

[0030] Mass spectrometry detection: The single-base extension reaction product is purified and centrifuged, and the supernatant obtained by centrifugation is subjected to mass spectrometry detection to obtain the detection results.

[0031] According to some specific embodiments of the present invention, in the method of the present invention, the concentration of the sample to be tested in the multiplex PCR reaction system is 1 ng / μL-200 ng / μL, and the concentration of each primer is 0.1 μM-0.4 μM; the reaction conditions for the multiplex PCR amplification are: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 30 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 30 seconds, for 40 cycles; 72℃ final extension for 5 minutes.

[0032] According to some specific embodiments of the present invention, the reaction conditions for the SAP enzyme digestion reaction in the method of the present invention are: incubation at 37°C for 30 minutes, followed by enzyme inactivation at 85°C for 5 minutes.

[0033] According to some specific embodiments of the present invention, in the method of the present invention, the concentration of each probe in the single-base extension reaction system is 0.5 μM-1 μM, and the reaction conditions of the single-base extension reaction are: 95°C pre-denaturation for 30 seconds; 95°C denaturation for 5 seconds, cycled 5 times; 52°C annealing for 5 seconds and 80°C extension for 5 seconds, cycled 40 times, the total reaction of denaturation, annealing and extension is cycled 40 times; 72°C final extension for 3 minutes.

[0034] According to some specific embodiments of the present invention, in the method of the present invention, the cosmetic is a toner, lotion, or cream, and the method further includes a process of pre-treating the cosmetic to obtain a cosmetic probiotic solution, which includes the following steps:

[0035] Aseptically weigh the cosmetic sample, dilute it with physiological saline, and inoculate it into SCDLP medium or meat culture medium. Extract DNA from the culture product, and control the DNA concentration of the extracted product to be 1 ng / μL-200 ng / μL for multiplex PCR reaction system.

[0036] According to some specific embodiments of the present invention, in the method of the present invention, the added volume of the resin purification solution in each reaction during mass spectrometry detection is 16 μL; the steps of the mass spectrometry detection are as follows: 0.5 μL of matrix is ​​dropped into the middle of the target plate well, and after waiting for at least 5 min to dry completely, 0.7 μL of supernatant is added, and after waiting for 20 min to dry completely and crystallize, the sample is analyzed by the instrument.

[0037] The technical solution of the present invention has the following beneficial technical effects:

[0038] Easy to operate, high PCR weight and transformation success rate: good results can be obtained for the detection of 10-50 pathogens, and up to 60 pathogens.

[0039] High cost-effectiveness: Simultaneously measures 10-50 SNP loci without fluorescent labeling, minimizing consumable costs and sample volume. High accuracy: Through bidirectional primer and extension probe design, it can effectively detect pathogen-specific genes with 100% accuracy.

[0040] High sample throughput: It can process more than 3,000 samples per day, with a throughput higher than qPCR.

[0041] High-quality data: Fully automated data analysis to generate pathogen detection reports and provide mass spectrometry-based analysis of sample status and result reliability. Attached Figure Description

[0042] Figure 1 This is a simplified diagram of the experimental operation of the present invention.

[0043] Figure 2 This is the mass spectrum of the positive control Staphylococcus aureus nucleic acid from this invention.

[0044] Figure 3 This is the mass spectrum of Salmonella nucleic acid, which is the positive control of this invention.

[0045] Figure 4 This is a mass spectrum of nucleic acid from *Pseudomonas aeruginosa*, the positive control strain of this invention.

[0046] Figure 5 This is the mass spectrum of Clostridium tetani nucleic acid, which is the positive control of this invention.

[0047] Figure 6 This is the nucleic acid mass spectrum of Citrobacter freundii, the positive control of this invention.

[0048] Figure 7 This is the nucleic acid mass spectrum of Stenotrophomonas maltophilia, a positive pair of strains of the present invention.

[0049] Figure 8 This is the nucleic acid mass spectrum of Burkholderia cepacia, the positive control of this invention.

[0050] Figure 9This is the mass spectrum of Klebsiella pneumoniae nucleic acid, which is the positive control of this invention.

[0051] Figure 10 This is the nucleic acid mass spectrum of the positive control Candida albicans of this invention.

[0052] Figure 11 This is the nucleic acid mass spectrum of the positive control *E. coli* of this invention.

[0053] Figure 12 Mass spectra of nucleic acid detected by mixing DNA templates from ten microorganisms.

[0054] Figure 13 The nucleic acid mass spectrum was detected after amplification by mixing B.cep-0F / B.cep-0R with nine other pairs of microbial primers.

[0055] Figure 14 The nucleic acid mass spectrum was detected after the extension primer Salm-0Probe was mixed with other microbial extension primers for extension. Detailed Implementation

[0056] In order to provide a clearer understanding of the technical features, objectives and beneficial effects of the present invention, the technical solution of the present invention will now be described in detail below, but it should not be construed as limiting the scope of implementation of the present invention.

[0057] Example 1

[0058] This embodiment provides primers for multiplex PCR reactions and probes (extension primers) for single-base extension reactions to detect various microorganisms in cosmetics, as detailed below, with a simplified experimental procedure diagram shown. Figure 1 As shown:

[0059] Nucleic acid mass spectrometry is a detection technology based on time-of-flight mass spectrometry. It can identify and distinguish different nucleic acid sequences by measuring the molecular weight of nucleic acid molecules. It has the advantages of high throughput, detection of more genes and SNP sites, and more comprehensive detection.

[0060] This invention utilizes nucleic acid mass spectrometry technology to specifically detect various microorganisms that may potentially contaminate cosmetics. In this embodiment, specific primers were designed for Staphylococcus aureus, Salmonella, Pseudomonas aeruginosa, Clostridium tetani, Citrobacter freundii, Stenotrophomonas maltophilia, Burkholderia cepacia, Klebsiella pneumoniae, Candida albicans, and Escherichia coli. These specific primers include forward and reverse primers for multiplex PCR reactions, as well as extension primers for single-base extension reactions.

[0061] The primer set information for multiplex PCR is shown in Table 1.

[0062] Table 1

[0063]

[0064] Information on the single-base extension primer set is shown in Table 2.

[0065] Table 2

[0066]

[0067] Comparative Example 1

[0068] This comparative example provides primers for multiplex PCR reactions and probes for single-base extension reactions (extension primers) for detecting various microorganisms in cosmetics. Specifically, the forward primer for the multiplex PCR reaction of *Burkholderia cepacia* was replaced with *B. cep-0F*, with the sequence: ACGTTGGATGCCATGAACGTCGAYTAYCTYTT (SEQ ID No. 31), and the reverse primer was replaced with *B. cep-0R*, with the sequence: ACGTTGGATGGAAAGTATAGCAATCTTTGAAG (SEQ ID No. 32). The primer and probe sequences for the remaining nine microorganisms are the same as in Example 1.

[0069] Comparative Example 2

[0070] This comparative example provides primers for multiplex PCR reactions and probes for single-base extension reactions (extension primers) for detecting seven microorganisms in cosmetics: Staphylococcus aureus, Salmonella, Pseudomonas aeruginosa, Citrobacter flexneri, Klebsiella pneumoniae, Candida albicans, and Escherichia coli. The Salmonella extension primer was replaced with Salm-OProbe, with the sequence CTTCTCATCGACAACCTAACTTC (SEQ ID No. 33). Its molecular weight before extension was 6878.5 Da, the extension base was G, and the molecular weight after extension was 7162.8 Da. The primer and probe sequences for the other six microorganisms are the same as those listed in Example 1.

[0071] Test case

[0072] This test example provides a method for simultaneously detecting multiple cosmetic microorganisms. The ability of the primer and probe combinations provided in Example 1, Comparative Example 1, and Comparative Example 2 to detect multiple cosmetic microorganisms was determined. A simplified diagram of the experimental procedure is shown below. Figure 1 As shown, the specific steps include the following:

[0073] I. Nucleic Acid Purification

[0074] (1) Sample type: contaminated cosmetics;

[0075] (2) Pre-enrichment: Aseptically weigh 10 g of sample, dilute with physiological saline at a ratio of 1:10, and take 10 ml of each of the 1:10 diluted sample homogenate. Inoculate one portion into 90 ml of SCDLP enrichment broth and incubate at 36 ℃±1 ℃ for 24 hours. Inoculate the other portion into 90 ml of meat culture medium and incubate anaerobically at 36 ℃±1 ℃ for 48 hours. At the same time, weigh 10 g of sample and add it to 90 ml of SCDLP, and incubate at 30 ℃±1 ℃ for 48 h to obtain 3 cultured samples.

[0076] (3) DNA extraction and purification: Mix the three cultured samples together and extract DNA using a lysis-type bacterial genomic DNA extraction kit (Yisheng Biotechnology Co., Ltd., 18806ES50) according to its instructions. Use a micro-volume UV spectrophotometer (Thermo Fisher Scientific, A30221) to detect the DNA concentration, which can be within the range of 1 ng / μL to 200 ng / μL.

[0077] II. Multiplex PCR Amplification

[0078] Remove the multiplex PCR reaction reagent from the universal nucleic acid mass spectrometry reagent kit (Beijing Xinhui Pury Biotechnology Co., Ltd., XH002) from -20℃ and thaw it at room temperature. Prepare the PCR reaction system according to Table 3 based on the actual number of samples, and perform thermal cycling as shown in Table 4. The multiplex PCR amplification system is shown in Table 3.

[0079] Table 3

[0080]

[0081] The conditions for multiplex PCR reactions are shown in Table 4.

[0082] Table 4

[0083]

[0084] III. Shrimp Alkaline Phosphatase (SAP) Digestion Reaction

[0085] Remove the SAP reaction reagent from the general reagent for nucleic acid mass spectrometry from -20℃ and thaw it at room temperature. After the multiplex PCR reaction is completed, prepare the SAP reaction system as shown in Table 5.

[0086] Table 5

[0087]

[0088] The SAP reaction conditions are shown in Table 6.

[0089] Table 6

[0090]

[0091] IV. Single-base extension reaction

[0092] The single-base extension reaction reagent in the general reagent for nucleic acid mass spectrometry was taken out from -20℃ and thawed at room temperature. After the SAP reaction was completed, the PCR single-base extension reaction system was obtained. The single-base extension reaction system is shown in Table 7.

[0093] Table 7

[0094]

[0095] The conditions for the single-base extension reaction are shown in Table 8.

[0096] Table 8

[0097]

[0098] V. Mass Spectrometry Detection

[0099] (1) Resin purification

[0100] 1. Add resin purification solution: Shake the resin purification solution in the general reagent for nucleic acid mass spectrometry to mix well, add 18 μL for each reaction; the resin settles easily, so shake to mix again every 5 seconds;

[0101] 2. Purification: Place the sample in a vortex mixer and mix at 20 rpm for 30 min;

[0102] 3. Centrifugation: After the centrifugation is complete, centrifuge at 2000 rpm for 1 min, and the supernatant is ready for testing.

[0103] (2) Spotting

[0104] Take out the matrix from the universal reagent for nucleic acid mass spectrometry, add 0.5 μL of matrix to the center of the target plate well, wait at least 20 min for complete drying, add 0.7 μL of supernatant, wait at least 20 min for complete drying and crystallization, and then perform the analysis.

[0105] Test results:

[0106] The primer and probe composition described in Example 1 was used to detect DNA from cultures of various bacterial strains and mixed DNA samples. The results were compared with sequencing results, considered the "gold standard." Positive controls for various bacterial strains (the positive controls were the detection results of DNA samples of the tested bacteria) were provided. Figures 2-11 As shown, Figure 2 This is the nucleic acid mass spectrum of Staphylococcus aureus, the positive control of this invention; Figure 3 This is the mass spectrum of Salmonella nucleic acid, a positive control strain of this invention. Figure 4 This is the nucleic acid mass spectrum of Pseudomonas aeruginosa, the positive control strain of this invention; Figure 5This is the mass spectrum of Clostridium tetani nucleic acid, a positive control of this invention. Figure 6 This is the nucleic acid mass spectrum of the positive control Citrobacter freundii of the present invention; Figure 7 This is the nucleic acid mass spectrum of Stenotrophomonas maltophilia, a positive control of the present invention. Figure 8 This is the nucleic acid mass spectrum of Burkholderia cepacia, the positive control of this invention; Figure 9 This is the nucleic acid mass spectrum of Klebsiella pneumoniae, the positive control strain of this invention; Figure 10 This is the nucleic acid mass spectrum of the positive control Candida albicans of this invention; Figure 11 The image shows the nucleic acid mass spectrum of *E. coli*, the positive control strain of this invention. The results show that the extension efficiency of the corresponding strain's nucleic acid mass spectrometry extension primers is greater than 90% (greater than 20% is considered positive). The nucleic acid mass spectrometry detection results are completely consistent with the sequencing results, proving the reliability and accuracy of the results of this invention. The nucleic acid mass spectrum of ten microbial DNA templates co-amplified using the primer and probe composition of Example 1 is shown below. Figure 12 As shown, the results indicate that multiple microbial probes can be extended. This overcomes the development challenge of simultaneously and effectively amplifying ten target DNAs using ten primers with compatible properties.

[0107] The modified B.cep-0F / B.cep-0R primers in Comparative Example 1 were ineffective in multiplex PCR amplification extension. When B.cep-0F / B.cep-0R was mixed with nine other microbial primer pairs for amplification, the Burkholderia cepacia probe failed to extend. The nucleic acid mass spectra after mixing B.cep-0F / B.cep-0R with the other nine microbial primer pairs are shown below. Figure 13 As shown, it is speculated that this primer pair may not be compatible with the other nine primer pairs.

[0108] The single-base extension primer replaced in Comparative Example 2 showed low extension efficiency in multiplex PCR amplification. When the extension primer Salm-0Probe was mixed with other microbial extension primers, the peak intensity of this extension primer was significantly lower than that of the other extension primers. The nucleic acid mass spectrum after extension with the mixed extension primer Salm-0Probe and other microbial extension primers is shown in the figure below. Figure 14 As shown in the figure, since there were seven strains of microorganisms in the early stages of kit development, this figure represents the extended detection results for seven microorganisms: Staphylococcus aureus, Salmonella, Pseudomonas aeruginosa, Citrobacter flexneri, Klebsiella pneumoniae, Candida albicans, and Escherichia coli. In Example 1, after changing the probe to Salm-Probe, the peak intensity was similar to that after extension with other primers. Some extension primers had insufficient peak intensity, less than 50% of that of other extension primers, requiring continuous adjustments. This is one of the challenges in developing a nucleic acid mass spectrometry multiplex microbial detection kit.

Claims

1. A multiplex PCR nucleic acid mass spectrometry kit for detecting microorganisms, comprising a primer composition and a probe composition, characterized in that, The primer composition includes targets against Staphylococcus aureus (Staphylococcus aureus). Staphylococcus aureus ),salmonella( Salmonella ), Pseudomonas aeruginosa ( Pseudomonas aeruginosa Clostridium tetani ( Clostridium tetani ), Citrobacter freundii ( Citrobacter freundii Stenotrophomonas maltophilia ( Stenotrophomonas maltophilia Burkholderia cepacia (), Burkholderia cepacia ), Klebsiella pneumoniae ( Klebsiella pneumoniae Candida albicans ( Candida albicans ), Escherichia coli ( Escherichia coli The probe composition comprises 10 pairs of primers, the probe composition comprising 10 probes targeting the same 10 microorganisms as the primer composition targets, the nucleotide sequences of the primers of the primer composition are shown in SEQ ID No. 1-20, and the nucleotide sequences of the probes of the probe composition are shown in SEQ ID No. 21-30, respectively; The kit also includes at least one of Multiplex PCR Mix, SAP Buffer, SAP enzyme, and Extend Reaction Mix.

2. A method for non-diagnostic multiplex PCR nucleic acid mass spectrometry detection of microorganisms, characterized in that, This method includes performing multiplex PCR amplification and nucleic acid mass spectrometry detection using the multiplex PCR nucleic acid mass spectrometry kit for detecting microorganisms as described in claim 1, to detect whether Staphylococcus aureus, Salmonella, Pseudomonas aeruginosa, Clostridium tetani, Citrobacter freundii, Stenotrophomonas maltophilia, Burkholderia cepacia, Klebsiella pneumoniae, Candida albicans and / or Escherichia coli are present in the sample to be tested; The sample to be tested is a cosmetic product, and the method includes the following steps: Multiplex PCR amplification: Prepare a multiplex PCR reaction system containing 10 pairs of primers with the primer composition in the kit of claim 1 and the sample to be tested, perform a multiplex PCR amplification reaction, and obtain PCR amplification reaction products. The annealing temperature of the multiplex PCR amplification reaction is 60°C. SAP enzyme digestion reaction: The PCR amplification reaction product is mixed with SAP Buffer and SAP enzyme and then subjected to SAP enzyme digestion reaction to obtain SAP enzyme digestion reaction product; Single-base extension reaction: The SAP enzyme digestion reaction product is mixed with 10 probes of the probe composition in the kit of claim 1 to prepare a single-base extension reaction system, and a single-base extension reaction is carried out to obtain a single-base extension reaction product. The annealing temperature of the single-base extension reaction is 52°C. Mass spectrometry detection: The single-base extension reaction product is purified and centrifuged, and the supernatant obtained by centrifugation is subjected to mass spectrometry detection to obtain the detection results.

3. The method according to claim 2, characterized in that, In the multiplex PCR reaction system, the concentration of the sample to be tested is 1 ng / μL-200 ng / μL, and the concentration of each primer is 0.1 μM-0.4 μM; The reaction conditions for multiplex PCR amplification were as follows: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 30 seconds, 60℃ annealing for 30 seconds, 72℃ extension for 30 seconds, for 40 cycles; and 72℃ final extension for 5 minutes.

4. The method according to claim 2, characterized in that, The reaction conditions for SAP enzyme digestion are: incubation at 37°C for 30 minutes, followed by enzyme inactivation at 85°C for 5 minutes.

5. The method according to claim 2, characterized in that, In the single-base extension reaction system, the concentration of each probe is 0.5μM-1μM. The reaction conditions for the single-base extension reaction are: 95℃ pre-denaturation for 30 seconds; 95℃ denaturation for 5 seconds, 5 cycles of 52℃ annealing for 5 seconds and 80℃ extension for 5 seconds, the total reaction of denaturation, annealing and extension is 40 cycles; final extension at 72℃ for 3 minutes.

6. The method according to claim 2, characterized in that, The cosmetic is a toner, lotion, or cream. The method further includes a pretreatment process to obtain a cosmetic microbial enrichment solution, which includes the following steps: Aseptically weigh the cosmetic sample, dilute it with physiological saline, and inoculate it into SCDLP medium or meat culture medium. Extract DNA from the culture product, and control the DNA concentration of the extracted product to be 1 ng / μL-200 ng / μL for multiplex PCR reaction system.

Citation Information

Patent Citations

  • Gene chip and kit for detecting common pathogenic bacteria in cosmetics

    CN103937897A

  • Primer group and kit for rapidly identifying respiratory tract microorganisms based on nanopore sequencing and application of primer group

    CN112501268A