Wheat scab-resistant site and molecular breeding method

By identifying and using molecular markers of 5 resistant gibberellosis-resistant related sites in wheat for screening, a molecular design breeding system was established, which solved the problem of poor breeding efficiency and disease-resistant variety selection effect in the existing technology, and achieved the effect of efficient screening of excellent new wheat materials.

CN120193110AActive Publication Date: 2025-06-24JIANGSU ACAD OF AGRI SCI

Patent Information

Application Number
CN202510139623.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-08
Publication Date
2025-06-24
Estimated Expiration
2045-02-08

AI Technical Summary

Technical Problem

The prior art is difficult to efficiently screen out new wheat materials carrying multiple gibberellosis-resistant sites and excellent agronomic traits, resulting in poor breeding efficiency and selection of disease-resistant varieties.

Method used

Five stable gibberellosis-resistant association sites were identified on chromosomes 2A, 2D, 3A, 5A and 6D through genome-wide association analysis (GWAS), KASP molecular markers were designed for genotype detection and screening, and a molecular design breeding system was established.

Benefits of technology

It has achieved efficient screening of new wheat materials carrying multiple disease-resistant sites and excellent agronomic traits, significantly improving breeding efficiency and breeding speed of disease-resistant varieties, improving the ability of wheat to resist gibberellosis, and providing new ideas for disease prevention and control.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120193110A_ABST
    Figure CN120193110A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of wheat breeding, and particularly relates to a wheat gibberellic disease resistant site and a molecular breeding method, and five stable gibberellic disease resistant associated sites Qfhb.jaas-2D, Qfhb.jaas-3A, Qfhb.jaas-3B. 1, Qfhb.jaas-5A. 2 and Qfhb.jaas-6D are identified on chromosomes 2A, 2D, 3A, 5A and 6D. Aiming at the identified disease-resistant sites, KASP molecular markers are designed, and the markers have high specificity and sensitivity, can accurately and quickly detect disease-resistant genotypes in wheat materials, and provide a powerful tool for molecular marker-assisted selection (MAS). The effectiveness of the screened disease-resistant sites is verified, and the result shows that the five sites are remarkably related to the gibberellic disease resistance, and a reliable basis is provided for breeding of disease-resistant varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of wheat breeding, and particularly relates to a wheat scab resistance locus and a molecular breeding method. Background Art

[0002] Wheat scab (Fusarium head blight, FHB) is a worldwide wheat ear disease caused by Fusarium spp. It not only causes yield losses, but the mycotoxins it produces also seriously endanger the health of humans and livestock. With global climate change, changes in farming systems and cultivation methods, the frequency of wheat scab epidemics has been increasing. It is difficult to solve the infection and spread of scab by changing farming systems and cultivation techniques. Although relying on chemical control has achieved certain results in controlling the large-scale occurrence and epidemic of scab, it inevitably increases costs and pollutes the environment. Therefore, breeding disease-resistant varieties has become the main way to reduce the harm of scab.

[0003] A large number of studies on the inheritance of resistance to Fusarium head blight (FHB) have been conducted at home and abroad, and multiple FHB resistance QTLs have been identified. Nine FHB resistance genes have been named, and two loci, Fhb1 and Fhb7, have been successfully cloned. Fhb1 is currently recognized as the locus with the most stable resistance and the largest effect, and it has been the most widely and successfully applied in wheat resistance breeding (Zhang X, Rouse MN, Nava IC, Yue J, Anderson JA. 2016. Development and Verification of Wheat Germplasm Containing Both Sr2 and Fhb1. Molecular Breeding, 36, 85; Zhang Hongjun, Su Zhenqi, Bai Guihua, Zhang Xu, Ma Hongxiang, Li Teng, Deng Yun, Mai Chunyan, Yu Liqiang, Liu Hongwei, Yang Li, Li Hongjie, Zhou Yang. 2018. Using Functional Markers of the fhb1 Gene to Select and Improve the Resistance of Wheat Varieties to Fusarium Head Blight in the Yellow and Huai River Winter Wheat Region. Acta Agronomica Sinica, 44, 505-511). Substitution line materials of wheat-Thinopyrum ponticum Fhb7 have been used in many breeding units at home and abroad. By using molecular marker selection to introgress Fhb7 into different wheat varieties, the FHB resistance of the progeny lines has been significantly improved (Li X, Li D, Xuan Y, He Z, Zhao L, Hao Y, Ge W, Xu S, Hou B, Wang B, Guo J, Liu W, Li M, Har Y, Bo C, Bao Y, Qi Z, Xu SS, Bai G, Wang H, Kong L. 2023. Elimination of the Yellow Pigment Gene Psy-E2 Tightly Linked to the Fusarium Head Blight Resistance Gene Fhb7 from Thinopyrum Ponticum. The Crop Journal, 11, 957-962; Li Zhengling, Zhang Yu, Han Liupeng, Wang Yongxia, Fang Yuhui, Hu Lin, Xu Weigang. 2022. Optimization of the Wheat Breeding Technology System for Resistance to Fusarium Head Blight in the Southern Yellow and Huai River Wheat Region. Journal of Henan Agricultural Sciences, 51, 28-36). FHB resistance is a quantitative trait regulated by multiple genes. Although some progress has been made in selection based on single markers, the application of a single gene is not conducive to coping with complex diseases and the impact of climate change. Aggregating different FHB resistance genes through molecular marker-assisted selection is an effective way to breed varieties with durable and stable resistance.

[0004] The middle and lower reaches of the Yangtze River wheat region is the earliest area to carry out Fusarium head blight (FHB) resistance breeding. Representative varieties in this region, such as Ningmai, Yangmai, and Zhenmai, all have good FHB resistance and carry multiple FHB resistance loci, such as Fhb1, QFhb.yas-2DL, QFhb-5A, etc. Further exploring the disease resistance loci in the varieties of this region and evaluating their effects to establish a molecular breeding system for FHB resistance that combines multiple loci is of great significance for wheat FHB resistance breeding. Summary of the Invention

[0005] The object of the present invention is to provide a wheat FHB resistance locus and a molecular breeding method, which can efficiently screen new wheat materials carrying multiple disease resistance loci and having excellent agronomic traits, significantly improve the breeding efficiency and the selection effect of disease-resistant varieties, and provide new ideas and approaches for the prevention and control of wheat diseases.

[0006] The object of the present invention is achieved through the following technical solutions:

[0007] The present invention provides a wheat FHB resistance locus, and there are 5 wheat FHB resistance loci in total, as shown in the following table:

[0008]

[0009] The present invention also provides primers and probes for the wheat FHB resistance locus. The primers F1 and F2 of Qfhb.jaas-2D are shown in SEQ ID NO.1-2, and the probe R is shown in SEQ ID NO.3;

[0010] The primers F1 and F2 of Qfhb.jaas-3A are shown in SEQ ID NO.4-5, and the probe R is shown in SEQ ID NO.6;

[0011] The primers F1 and F2 of Qfhb.jaas-3B.1 are shown in SEQ ID NO.7-8, and the probe R is shown in SEQ ID NO.9;

[0012] The primers F1 and F2 of Qfhb.jaas-5A.2 are shown in SEQ ID NO.10-11, and the probe R is shown in SEQ ID NO.12;

[0013] The primers F1 and F2 of Qfhb.jaas-6D are shown in SEQ ID NO.13-14, and the probe R is shown in SEQ ID NO.15.

[0014] Furthermore, a specific sequence GAAGGTGACCAAGTTCATGCT that can bind to FAM fluorescence is added to the tail of primer F1, and a specific sequence GAAGGTCGGAGTCAACGGATT that can bind to HEX fluorescence is added to the tail of primer F2.

[0015] The present invention also provides a molecular breeding method, which includes the step of screening using the wheat scab resistance locus or the primers and probes described above.

[0016] Furthermore, it specifically includes the following steps:

[0017] (1) Hybridize a wheat material carrying the wheat scab resistance locus with a material to be improved as parents.

[0018] (2) Mix-harvest the F1 generation seeds after the hybridization in step (1), plant the F2 generation by dibbling, with a population size of more than 300. Extract the DNA of the seedlings, and use the molecular markers of the wheat scab resistance locus to detect the genotypes. Select the single plants with homozygous disease-resistant genotypes at the wheat scab resistance locus and excellent agronomic traits for harvesting; Plant the F3 generation in 3-row plant line plots, and select the single plants with excellent agronomic traits for harvesting; Continue to plant the F4 generation in 3-row plant line plots, and select the plant lines with relatively excellent agronomic traits for plot harvesting;

[0019] (3) In the F5 generation, use the single-flower drip method to identify the scab resistance, and the superior offspring enter the yield identification nursery.

[0020] Furthermore, in step (1), if the material to be improved is a wheat material from other ecological regions outside the middle and lower reaches of the Yangtze River wheat region, it can be backcrossed with the material to be improved once again.

[0021] Beneficial effects:

[0022] Through genome-wide association study (GWAS), using the GAPIT software package and the BLINK method, five stable Fusarium head blight (FHB) resistance-associated loci were identified on chromosomes 2A, 2D, 3A, 5A, and 6D. The discovery of these loci provides important gene resources for wheat FHB resistance breeding. For the identified disease-resistant loci, the present invention designed KASP molecular markers, which have high specificity and sensitivity and can accurately and rapidly detect the disease-resistant genotypes in wheat materials, providing a powerful tool for marker-assisted selection (MAS). By performing genotype analysis and disease resistance identification in a large number of breeding materials, the present invention verified the effectiveness of the screened disease-resistant loci. The results showed that five loci, namely Qfhb.jaas-2D, Qfhb.jaas-3A, Qfhb.jaas-3B.1, Qfhb.jaas-5A.2, and Qfhbjaas-6D, were significantly associated with FHB resistance, providing a reliable basis for the breeding of disease-resistant varieties.

[0023] The present invention first applied the identified disease-resistant loci to molecular design breeding for wheat FHB resistance and established a complete molecular design breeding system. Through this system, new wheat materials carrying multiple disease-resistant loci and having excellent agronomic traits can be efficiently screened, significantly improving the breeding efficiency and the breeding speed of disease-resistant varieties. The materials screened by the molecular design breeding method provided by the present invention have significantly better FHB resistance than those screened by conventional breeding methods. This indicates that the present invention not only improves the FHB resistance of wheat but also provides new ideas and approaches for the prevention and control of wheat diseases. Brief Description of the Drawings

[0024] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention, and those of ordinary skill in the art can also obtain other drawings without creative efforts based on these drawings.

[0025] Figure 1 It is the association analysis diagram of relevant loci in Example 1 of the present invention;

[0026] Figure 2 It is the correlation diagram between relevant loci and FHB resistance in Example 2 of the present invention;

[0027] Figure 3 It is the flow chart of molecular design breeding for wheat FHB resistance in Example 3 of the present invention;

[0028] Figure 4 It is the comparison diagram of the selection effects between the molecular design breeding method and the conventional breeding method for wheat FHB resistance in Example 3 of the present invention. Detailed Description of the Invention

[0029] The various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be construed as a limitation on the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0030] It should be understood that the terms used in the present invention are only for describing particular embodiments and are not intended to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Intermediate values within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, are also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0031] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0032] Without departing from the scope or spirit of the present invention, various modifications and variations can be made to the specific embodiments of the present invention specification, which are obvious to those skilled in the art. Other embodiments obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are merely exemplary.

[0033] Regarding the use of "comprising", "including", "having", "containing", etc. in this article, they are all open-ended terms, meaning including but not limited to.

[0034] The chemical reagents, biochemical reagents, and materials used in the present invention can be obtained from commercial sources unless otherwise specified.

[0035] Example 1 Mining of disease-resistant loci

[0036] Using 103 wheat varieties approved during the period of 1972 - 2016 in the middle and lower reaches of the Yangtze River wheat region as materials. The materials were planted in two environments, the experimental base in the Jiangsu Academy of Agricultural Sciences and the Liuhe base, for two consecutive growing seasons from 2017 - 2018 and 2018 - 2019. The experimental base in the Jiangsu Academy of Agricultural Sciences in 2017 - 2018, the Liuhe base in 2017 - 2018, the experimental base in the Jiangsu Academy of Agricultural Sciences in 2018 - 2019, and the Liuhe base in 2018 - 2019 were respectively denoted as four environments E1, E2, E3, and E4. They were planted in single - row plots, with 60 seeds per row, row length of 1.6 m, row spacing of 0.25 m, and 2 replicates, with conventional cultivation management. The resistance identification of Fusarium head blight was carried out by the single - flower drip method. At the initial flowering stage, 10 spikes of each strain were inoculated, and 10 μL of Fusarium graminearum spore solution was inoculated into each spike, and the spore concentration was 1×10 6 mL -1 . After bagging and moisturizing for 72 h, they continued to grow under the condition of mist moisturizing. At 21 d after inoculation, the number of diseased spikelets and the total number of spikelets were investigated, and the diseased spikelet rate was calculated as an evaluation index for Fusarium head blight resistance.

[0037] The genomic DNA was extracted by the CTAB method (Porebski S, Bailey L, Baum B (1997) Modification of CTAB DNA extraction protocol for plants containing high polysaccharide and polyphenol components. Plant Molecular Biology Reporter 15: 8 - 15). Genotypes were obtained using an Affymetrix 50K gene chip (Beijing CapitalBio Corporation, Beijing). The TASSEL V5.2.13 software was used to perform quality control on the genotype data, and marker loci with a minimum allele frequency ≤ 5% and a missing rate exceeding 10% were deleted.

[0038] Conduct association analysis using the GAPIT software package in R language (Lipka A, Tian F, Wang Q, Peiffer J, Li M, Bradbury p, Gore M, Buckler E, Zhang Z (2012) GAPIT: Genome Association and Prediction Integrated Tool. Bioinformatics 28: 2397 - 2399). Select the BLINK (Bayesian-information and linkage-disequilibrium iteratively nested keyway) method (Huang M, Liu X, Yao Z, Summers R, Zhang Z (2018) BLINK: A package for the next level of genome-wide association studies with both individuals and markers in the millions. GigaScience 8), and use the principal components as covariates to reduce the false positive rate. The screening threshold is set to 1×10 -3 , and 5 stable association loci are identified on chromosomes 2A, 2D, 3A, 5A and 6D ( Figure 1 and Table 1).

[0039] Table 1 Results of association analysis of related loci

[0040]

[0041] Example 2

[0042] Collect the disease-resistant loci Qfhb-2A, Qfhb-2D, Qfhb-3B.1, QFhb-3B.2, Qfhb-5A and Qfhb-6D from the important parents Ningmai 9 and Yangmai 158 in the middle and lower reaches of the Yangtze River wheat region. Among them, the positions of Qfhb-2D and Qfhb-6D coincide with the loci on chromosomes 2D and 6D in Example 1, and the disease-resistant locus Qfhb-3B.1 coincides with the major locus Fhb1. Sort and rename according to the chromosome positions, and a total of 9 candidate loci are obtained, as shown in Table 2.

[0043] Table 2 Specific information of related loci

[0044]

[0045]

[0046] Design PCR amplification primers according to SNP loci and flanking sequences to develop KASP molecular markers. For each marker, two SNP-specific primers (F1 / F2) and one common primer (R) were designed. A specific sequence GAAGGTGACCAAGTTCATGCT that can bind to FAM fluorescence was added to the tail of F1, and a specific sequence GAAGGTCGGAGTCAACGGATT that can bind to HEX fluorescence was added to the tail of F2 (Table 3). KASP primer design was performed using Polymarker (http: / / www.polymarker.info / ), and the primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The primer sequences of Qfhb.jaas-3B.1 and Qfhb.jaas-5A.2 were derived from previously reported literature (Su Z, Jin S, Zhang D, Bai G. Development and validation of diagnostic markers for Fhb1 region, a major QTL for Fusarium head blight resistance in wheat. Theoretical and Applied Genetics, 2018, 131: 2371-2380; Jiang P, Zhang X, Wu L, He Y, Zhuang W, Cheng X, Ge W, Ma H, Kong L. A novel QTL on chromosome 5AL of Yangmai 158 increases resistance to Fusarium head blight in wheat. Plant Pathology, 2020, 69: 249-258).

[0047] Table 3 KASP primers corresponding to relevant loci

[0048]

[0049]

[0050] The total volume of the KASP reaction was 5 μL, including 2.5 μL of 2×KASP Master Mix, 0.07 μL of KASP Assay Mix (primer mixed working solution), and a concentration of 20 ng μL -12.43 μL of template DNA. The KASP reaction program is as follows: the first step: 94°C, 15 min; the second step: 94°C, 20 s, 61 - 55°C, 1 min, with a decrease of 0.6°C for each cycle, and a total of 10 cycles are carried out; the third step: 94°C, 20 s, 55°C, 1 min, and a total of 26 cycles are carried out. The PCR is performed in a water bath PCR instrument purchased from LGC with the model Hydrocycler 16 and the PCR results are scanned and analyzed by a KASP fluorescence analyzer (model PHERAstar plus from LGC).

[0051] Genotype analysis was performed on 611 F6 generation breeding materials using KASP primers at 9 loci. At the same time, disease resistance identification was carried out on them according to the Fusarium head blight identification method in Example 1 during the 2021 - 2022 growing season. The correlation between these 9 loci and Fusarium head blight resistance was analyzed using the single - marker model of IciMapping V4.1 software. Five loci, such as Qfhb.jaas - 2D, Qfhb.jaas - 3A, Qfhb.jaas - 3B.1, Qfhb.jaas - 5A.2, and Qfhb.jaas - 6D, were significantly correlated with Fusarium head blight resistance( Figure 2 ).

[0052] Example 3

[0053] Molecular design breeding for wheat resistance to Fusarium head blight was carried out using the 5 disease - resistant loci screened in Example 2. The steps are as Figure 3 follows:

[0054] 1. Cross a wheat material carrying 5 disease - resistant loci with the material to be improved. If the material to be improved is a wheat material from other ecological regions outside the middle and lower reaches of the Yangtze River wheat region, a backcross can be carried out with the material to be improved once again.

[0055] 2. The seeds of the F1 generation are harvested mixed. The F2 generation is planted by dibbling, with a population size of more than 300. The DNA of the seedlings is extracted, and genotype detection is carried out using molecular markers at 5 Fusarium head blight - resistant loci. Select single plants with homozygous disease - resistant genotypes at all 5 loci and relatively good agronomic traits for harvesting; in the F3 generation, plant in 3 - row plant line plots and select single plants with relatively good agronomic traits for harvesting; in the F4 generation, continue to plant in 3 - row plant line plots and select plant lines with relatively good agronomic traits for plot harvesting.

[0056] 3. In the F5 generation, the Fusarium head blight resistance is identified using the single - flower drip - infusion method, and the superior offspring enter the yield identification nursery.

[0057] The Fusarium head blight resistance of the materials screened by this molecular design breeding method is significantly better than that of the materials screened by the conventional breeding method (specifically as Figure 4 shown).

[0058] The embodiments described above merely represent several implementation manners of the present invention. The description is relatively specific and detailed, but it should not be construed as a limitation on the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all fall within the protection scope of the present invention. Therefore, the protection scope of the present invention patent shall be subject to the appended claims.

Claims

1. A wheat scab resistance locus, characterized in that: The wheat scab resistance loci include 5, as shown in the following table:

2. A primer and probe for wheat scab resistance locus as claimed in claim 1, characterized in that: The primers F1 and F2 of Qfhb.jaas-2D are shown in SEQ ID NO.1-2, and the probe R is shown in SEQ ID NO.3; The primers F1 and F2 of Qfhb.jaas-3A are shown in SEQ ID NO.4-5, and the probe R is shown in SEQ ID NO.6; The primers F1 and F2 of Qfhb.jaas-3B.1 are shown in SEQ ID NO.7-8, and the probe R is shown in SEQ ID NO.9; Primer F1 and primer F2 of Qfhb.jaas-5A.2 are shown in SEQ ID NO.10-11, and probe R is shown in SEQ ID NO.12; The primers F1 and F2 of Ofhb.jaas-6D are shown in SEQ ID NO.13-14, and the probe R is shown in SEQ ID NO.

15.

3. The primer and probe according to claim 2, characterized in that: A specific sequence GAAGGTGACCAAGTTCATGCT capable of binding to FAM fluorescence is added to the tail of the primer F1, and a specific sequence GAAGGTCGGAGTCAACGGATT capable of binding to HEX fluorescence is added to the tail of the primer F2.

4. A molecular breeding method, characterized in that: The molecular breeding method comprises the step of screening using the wheat scab resistance locus described in claim 1 or the primers and probes described in any one of claims 2-3.

5. The molecular breeding method according to claim 4, characterized in that The specific steps include: (1) using a wheat material carrying the wheat scab resistance locus according to claim 1 as a parent and hybridizing it with the material to be improved; (2) after the hybridization in step (1), the F1 generation seeds are mixed and harvested, and the F2 generation seeds are sown and planted, with a population size of more than 300, and the seedling DNA is extracted, and the genotype is detected using the molecular marker of the wheat scab resistance locus, and the single plants with homozygous disease resistance genotype and excellent agronomic traits at the wheat scab resistance locus are selected for harvesting; the F3 generation is planted in three rows of plant lines in plots, and the single plants with excellent agronomic traits are selected for harvesting; the F4 generation is continued to be planted in three rows of plant lines in plots, and the plant lines with relatively excellent agronomic traits are selected for harvesting in plots; (3) The F5 generation was identified for resistance to Fusarium fusarium using the single flower drip method, and the superior offspring entered the yield identification nursery.

6. The molecular breeding method according to claim 5, characterized in that In step (1), if the material to be improved is wheat material from ecological zones other than the wheat-growing zone in the middle and lower reaches of the Yangtze River, backcrossing can be performed again with the material to be improved.

Citation Information

Patent Citations

  • Molecular marker for detecting anti-scab QTL (quantitative trait loci) Qfhb.hbaas-5AS and application method of molecular marker

    CN109797241A

  • Rapid and efficient wheat gibberellic disease-resistant molecular design breeding method

    CN114277175A

  • KASP primer group for wheat scab resistance detection and application of KASP primer group

    CN118064633A

Cited By

  • Multiplex PCR (Polymerase Chain Reaction) Panel for detecting favorable allelic variation of wheat scab-resistant site and application of multiplex PCR Panel

    CN121450835A