Recombinant AAV capsid protein of targeted hepatocyte and application of recombinant AAV capsid protein
By performing specific mutations and hybridization of the AAV5 capsid protein, a recombinant AAV capsid protein with higher targeting and immune escape capabilities is solved, and the existing AAV gene therapy vectors are insufficiently targeted and immune responses when targeting the human liver, achieving more efficient transduction and lower safety risks.
Patent Information
- Application Number
- CN202311824709.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-27
- Publication Date
- 2025-06-27
AI Technical Summary
Existing AAV gene therapy vectors have problems with insufficient targeting and immune response when targeting human liver, resulting in low transduction efficiency and safety risks.
By performing specific mutations in the VP1, VP2, and VP3 regions of the AAV5 capsid protein, a recombinant AAV capsid protein is formed, combining with other AAV serotype capsids, enhancing its targeting ability to hepatocytes and immune escape ability.
The transduction efficiency and immune escape ability to hepatocytes are improved, with higher transduction rates and lower immune response risks compared with the prior art.
Smart Images

Figure CN120209091A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedicine, and specifically relates to a recombinant AAV capsid protein targeting hepatocytes, and also relates to the application of this recombinant AAV capsid protein. Background Art
[0002] Adeno-associated viruses (AAV) are the main vectors for current gene therapy, and have the advantages of long and stable expression time, low immunogenicity and low toxicity. Among the AAV serotypes isolated so far, AAV2, AAV5, AAV6 and AAV8 have been used to target the liver of patients with severe hemophilia B. Historically, however, human liver tissue has been a challenging tissue to transduce at a high level sufficient to provide continuous therapeutic levels of transgenic product expression.
[0003] The presence of human neutralizing antibodies means that drugs produced based on wild-type AAV cannot cover all populations; and the lack of its targeting ability makes it impossible for virus particles to be effectively delivered to the targeted tissue or organ by the common intravenous injection method that relies on the diffusion of the human circulation. Without reaching the lowest limit of the virus amount required by clinical requirements, only the drug dose can be increased. However, after local high-dose administration, it will indeed have a certain impact on the safety of patients, and in severe cases, it may even endanger life.
[0004] Moanaro Biswas et al. mentioned a variant of AAV3B-DE5 in Engineering and In Vitro Selection of a Novel AAV3B Variant with High Hepatocyte Tropism and Reduced Seroreactivity (Mol Ther Methods Clin Dev. 2020 Dec 11; 19:347–
[0005] 361.), but there is still room for improvement in liver targeting and immune escape.
[0006] Patent CN109415704A discloses novel recombinant adeno-associated virus capsids resistant to pre-existing human neutralizing antibodies. These virus capsids are from multiple wild-type AAV serotypes, but the test results did not obtain better transduction efficiency. Summary of the Invention
[0007] To achieve the above invention objectives, the present invention discloses a recombinant AAV capsid protein targeting hepatocytes and the use of such a protein. The recombinant AAV capsid protein of the present invention improves the targeting ability to hepatocytes, has higher transduction efficiency and immune escape ability, and also shows stronger tropism.
[0008] The first objective of the present invention discloses a recombinant AAV capsid protein targeting hepatocytes, which recombinant AAV capsid protein comprises VP1, VP2, and VP3 regions, and is obtained by mutating the common regions of VP1, VP2, and VP3 of the natural AAV5 capsid protein; or is obtained by mutating the common regions of VP1, VP2, and VP3 after hybridizing the natural AAV5 capsid protein with the capsids of other AAV serotypes, wherein the mutated sites correspond to at least one mutation at positions 310 to 736 of the AAV5 capsid protein of SEQ ID NO: 1;
[0009] It has at least one of the following mutations corresponding to SEQ ID NO: 1: S319, T376, E377, N378, N442, N443, S518, A581, T648, S649, S656, N694, S705, T706.
[0010] Furthermore, it has at least one of the following mutations corresponding to SEQ ID NO: 1: S319G, T376G, E377K, N378D, N442T, N443S, S518R, A581T, T648L, S649V, S656E, N694D, S705G, T706N.
[0011] Furthermore, it has the following mutations corresponding to SEQ ID NO: 1: S319G, T376G, E377K, N378D, N442T, N443S, S518R, A581T, T648L, S649V, S656E, N694D, S705G, T706N.
[0012] Furthermore, the capsids of the other AAV serotypes include any one of AAV1, AAV2, AAV3B, AAV4, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, bovine AAV, AAV2.5T, and AAV-LK03.
[0013] The second objective of the present invention discloses a nucleic acid sequence capable of encoding the recombinant AAV capsid protein targeting hepatocytes mentioned in the present invention.
[0014] The third objective of the present invention discloses a vector, which vector comprises a nucleic acid capable of encoding the recombinant AAV capsid protein targeting hepatocytes mentioned in the present invention.
[0015] The fourth object of the present invention is to disclose a pharmaceutical composition, comprising the carrier mentioned in the present invention.
[0016] The fifth object of the present invention is to disclose the application of the pharmaceutical composition mentioned in the present invention, which can be used for treating liver cancer.
[0017] Compared with the prior art, the present invention has the following beneficial effects: The recombinant AAV capsid protein of the present invention has stronger tropism in human hepatocytes, and has higher transduction efficiency and lower immune escape compared with the existing capsid proteins or recombinant capsid proteins. Description of the Drawings
[0018] Figure 1 Shows the transduction ability of AAV3B, AAV3B-DE5, LK03 and the recombinant AAV capsid protein of the present invention in 3D culture of human liver cancer cells.
[0019] Figure 2 Shows the immune escape ability of AAV3B, AAV3B-DE5, LK03 and the recombinant AAV capsid protein of the present invention in human liver cancer cells. Specific Embodiments
[0020] To facilitate the understanding of the present application, the present application will be described more comprehensively below with reference to the relevant drawings. Preferred embodiments of the present application are shown in the drawings. However, the present application can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, these embodiments are provided to make the understanding of the disclosure of the present application more thorough and comprehensive.
[0021] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the technical field to which this application belongs. The terms used in the description of the present application herein are only for the purpose of describing specific embodiments and are not intended to limit the present application. The term "and / or" used herein includes any and all combinations of one or more of the related listed items.
[0022] The AAV capsid protein includes VP1, VP2, and VP3 regions. Among them, VP1, VP2, and VP3 have a common region, and the mutation of the present invention occurs in the common region of VP1, VP2, and VP3, with at least one mutation relative to residues 318 to 724 of the natural AAV5 capsid protein SEQ ID NO: 1.
[0023] AAV5 is hybridized with other serotype capsids. After hybridization, the common regions of VP1, VP2, and VP3 that are the same as those of the native AAV5 capsid protein are retained. The mutations of the present invention occur in the common regions of VP1, VP2, and VP3 after hybridization. The common regions are located at amino acids 318 to 724 relative to the native AAV5 capsid protein SEQ ID NO: 1. In some embodiments, after AAV5 is hybridized with other serotype capsids, there is at least one mutation at amino acids 318 to 724 relative to the native AAV5 capsid protein SEQ ID NO: 1.
[0024] SEQ ID NO: 1
[0025] MSFVDHPPDWLEEVGEGLREFLGLEAGPPKPKPNQQHQDQARGLVLPGYKYLGPVNGLDRGEPVNRADEVAREHDISYNEQLEAGDNPYLKYNHADAEFQEKLADDTSFGGNLGKAVFQAKKRVLEPLGLVEEGAKTAPTGKRIDDHFPKRKKARTEEDSKPSTSSDAEAGPSGSQQLQIPAQPASSLGADTMSAGGGGPLGDNNQGADGVGNASGDWHCDSTWMGDRVVTKSTRTWVLPSYNNHQYREIKSGSVDGSNANAYFGYSTPWGYFDFNRFHSHWSPRDWQRLINNYWGFRPRSLRVKIFNIQVKEVTVQDSTTTIANNLTSTVQVFTDDDYQLPYVVGNGTEGCLPAFPPQVFTLPQYGYATLNRDNTENPTERSSFFCLEYFPSKMLRTGNNFEFTYNFEEVPFHSSFAPSQNLFKLANPLVDQYLYRFVSTNNTGGVQFNKNLAGRYANTYKNWFPGPMGRTQGWNLGSGVNRASVSAFATTNRMELEGASYQVPPQPNGMTNNLQGSNTYALENTMIFNSQPANPGTTATYLEGNMLITSESETQPVNRVAYNVGGQMATNNQSSTTAPATGTYNLQEIVPGSVWMERDVYLQGPIWAKIPETGAHFHPSPAMGGFGLKHPPPMMLIKNTPVPGNITSFSDVPVSSFITQYSTGQVTVEMEWELKKENSKRWNPEIQYTNNYNDPQFVDFAPDSTGEYRTTRPIGTRYLTRPL
[0026] In some embodiments, there is at least one mutation relative to the native AAV5 capsid protein SEQ ID NO: 1: S319, T376, E377, N378, N442, N443, S518, A581, T648, S649, S656, N694, S705, T706.
[0027] In some embodiments, AAV5 is hybridized with other serotype capsids, and after hybridization, the common regions of VP1, VP2, and VP3 that are the same as those of the native AAV5 capsid protein are retained. The mutations of the present invention occur in the common regions of VP1, VP2, and VP3 after hybridization. After AAV5 is hybridized with other serotype capsids, there is at least one mutation relative to the native AAV5 capsid protein SEQ ID NO: 1: S319, T376, E377, N378, N442, N443, S518, A581, T648, S649, S656, N694, S705, T706.
[0028] In some embodiments, there is at least one mutation relative to the native AAV5 capsid protein SEQ ID NO: 1: S319G, T376G, E377K, N378D, N442T, N443S, S518R, A581T, T648L, S649V, S656E, N694D, S705G, T706N.
[0029] In some embodiments, AAV5 is hybridized with other serotype capsids, and after hybridization, the common regions of VP1, VP2, and VP3 that are the same as those of the native AAV5 capsid protein are retained. The mutations of the present invention occur in the common regions of VP1, VP2, and VP3 after hybridization. There is at least one mutation relative to the native AAV5 capsid protein SEQ ID NO: 1: S319G, T376G, E377K, N378D, N442T, N443S, S518R, A581T, T648L, S649V, S656E, N694D, S705G, T706N.
[0030] In some embodiments, there are the following mutations relative to the native AAV5 capsid protein SEQ ID NO: 1: S319G, T376G, E377K, N378D, N442T, N443S, S518R, A581T, T648L, S649V, S656E, N694D, S705G, T706N. As SEQ ID NO: 2.
[0031] In some embodiments, AAV5 is hybridized with other serotype capsids. After hybridization, the common regions of VP1, VP2, and VP3 that are the same as those of the native AAV5 capsid protein are retained. The mutations of the present invention occur in the common regions of VP1, VP2, and VP3 after hybridization. After AAV5 is hybridized with other serotype capsids, the following mutations are present relative to the native AAV5 capsid protein SEQ ID NO: 1: S319G, T376G, E377K, N378D, N442T, N443S, S518R, A581T, T648L, S649V, S656E, N694D, S705G, T706N.
[0032] In the present invention, the other serotype capsids are any one of AAV1, AAV2, AAV3B, AAV4, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, bovine AAV, AAV2.5T, and AAV-LK03.
[0033] The genomic sequences of various serotypes of AAV, as well as the native inverted terminal repeats (ITRs), Rep proteins, and capsid subunit sequences, are known in the art. Such sequences can be found in the literature or in public databases such as GenBank. See, for example, GenBank accession numbers NC_002077.1 (AAV1), AF063497.1 (AAV1), NC_001401.2 (AAV2), AF043303.1 (AAV2), J01901.1 (AAV2), U48704.1 (AAV3A), NC_001729.1 (AAV3A), AF028705.1 (AAV3B), NC_001829.1 (AAV4), U89790.1 (AAV4), NC_006152.1 (AAV5), AF028704.1 (AAV6), NC_006260.1 (AAV7), AF513851.1 (AAV7), AF513852.1 (AAV8), NC_006261.1 (AAV-8), AY530579.1 (AAV9), AAT46337 (AAV10), and AAO88208 (AAVrh10). See also, for example, Srivistava et al. (1983) J. Virology 45:555; Chiorini et al. (1998) J. Virology 71:6823; Chiorini et al. (1999) J. Virology 73:1309; Bantel-Schaal et al. (1999) J. Virology 73:939; Xiao et al. (1999) J. Virology 73:3994; Muramatsu et al. (1996) Virology 221:208; Shade et al., (1986) J. Virol. 58:921; Gao et al. (2002)
[0034] Proc. Nat. Acad. Sci. USA 99:11854; Moris et al. (2004) Virology 33:375-383; International Patent Publications WO0028061, WO9961601, WO9811244; U.S. Patent No. 6156303.
[0035] In some embodiments, it relates to nucleic acid sequences, specifically the nucleic acid sequences of the recombinant AAV capsid proteins mentioned in the present invention. In some embodiments, the nucleic acid sequence can encode the nucleic acid of SEQ ID NO: 2.
[0036] SEQ ID NO: 2
[0037] MSFVDHPPDWLEEVGEGLREFLGLEAGPPKPKPNQQHQDQARGLVLPGYKYLGPVNGLDRGEPVNRADEVAREHDISYNEQLEAGDNPYLKYNHADAEFQEKLADDTSFGGNLGKAVFQAKKRVLEPLGLVEEGAKTAPTGKRIDDHFPKRKKARTEEDSKPSTSSDAEAGPSGSQQLQIPAQPASSLGADTMSAGGGGPLGDNNQGADGVGNASGDWHCDSTWMGDRVVTKSTRTWVLPSYNNHQYREIKSGSVDGSNANAYFGYSTPWGYFDFNRFHSHWSPRDWQRLINNYWGFRPRSLRVKIFNIQVKEVTVQDGTTTIANNLTSTVQVFTDDDYQLPYVVGNGTEGCLPAFPPQVFTLPQYGYATLNRDNTENPTERSSFFCLEYFPSKMLRTGNNFEFTYNFEEVPFHSSFAPSQNLFKLANPLVDQYLYRFVSTNNTGGVQFNKNLAGRYANTYKNWFPGPMGRTQGWNLGSGVNRASVSAFATTNRMELEGASYQVPPQPNGMTNNLQGSNTYALENTMIFNSQPANPGTTATYLEGNMLITSESETQPVNRVAYNVGGQMATNNQSSTTAPATGTYNLQEIVPGSVWMERDVYLQGPIWAKIPETGAHFHPSPAMGGFGLKHPPPMMLIKNTPVPGNITSFSDVPVSSFITQYSTGQVTVEMEWELKKENSKRWNPEIQYTNNYNDPQFVDFAPDSTGEYRTTRPIGTRYLTRPL
[0038] In some embodiments, a vector is involved, including a plasmid that carries a nucleic acid sequence capable of encoding the recombinant AAV capsid protein mentioned in the present invention.
[0039] In some embodiments, a pharmaceutical composition is involved, including a vector that can be used to encode the recombinant AAV capsid protein of the present invention.
[0040] In some embodiments, the recombinant AAV capsid protein of the present invention can be used to target liver cell diseases such as liver cancer.
[0041] Examples
[0042] In this embodiment, a recombinant adeno-associated virus vector was constructed. The specific construction method is as follows:
[0043] The first step: Preparation of recombinant plasmid
[0044] Through the 3D culture of spheroid cells cyclic infection experiment, combined with the analysis of parameters such as enrichment fraction, recombinant AAV capsid protein was obtained. Base mutations were introduced into different regions of the capsid protein gene, and the base mutations were based on the amino acid changes.
[0045] 1. Gene mutations were introduced by oligonucleotide synthesis. Using the plasmid of parental AAV5 as a template, the amino acid sequence of its capsid protein is SEQ ID NO:1. Each region mutation was amplified separately by PCR with a high-fidelity enzyme to the full length of the capsid protein Cap gene, about 2.4 kb. The PCR products were purified and recovered by a DNA purification and recovery kit.
[0046] 2. Using the plasmid pR2NoC containing the AAV2-Rep gene, ori and resistance elements as the vector plasmid, the vector plasmid was digested with NheI enzyme. The sequences on both sides of the digestion site were homologous to the 5' and 3' end sequences of the PCR products. The purified PCR products were added to the NheI-digested products, and recombinant plasmids were constructed by homologous recombination. The recombinant plasmids were purified using a DNA purification kit and eluted with pure water to remove ions.
[0047] 3. The purified recombinant plasmids were transformed into competent cells stable. After heat shock at 42°C, the transformed competent cells were cultured in LB medium at 37°C for 30 min. An appropriate amount of the transformed competent cells was taken and added to a solid agar medium containing the corresponding antibiotic. The cells were evenly spread with a sterile spreading rod. The number of colonies on the plate was observed the next day, and several colonies were selected for culture. An appropriate amount of colony culture was sent to a sequencing company for Sanger sequencing. The Sanger sequencing results were subjected to sequence alignment to confirm that the plasmid construction was correct. The remaining culture of the colonies with correct sequencing was added to LB medium at a ratio of 1:500 for large-scale culture.
[0048] 4. Using the plasmid large-scale extraction kit TIANGEN (model: DP120), the cultures in LB medium were extracted to obtain recombinant plasmids, and finally the concentration was measured by an ultraviolet spectrophotometer.
[0049] The second step: Packaging of recombinant adeno-associated virus vector
[0050] 1. Culturing 293 cells: 293 cells were cultured in a complete medium of DMEM containing 10% fetal bovine serum and 2% double antibiotics. When the confluence of the adherent cells reached about 80%, cell passage was carried out. First, the supernatant was removed, and the cells were rinsed with 1x PBS. Then, trypsin was added to digest the cells. When the cells flowed down like sand, complete medium was added to terminate the digestion. After centrifugation at 300g for 5 min, the supernatant was removed, and the cells were resuspended with a little medium for passage.
[0051] 2. Constructing a virus packaging system: When the confluence of a large number of cells reached 80%, a virus packaging system was prepared according to the molar ratio of the recombinant plasmid: GOI plasmid and EGFP reporter protein, and ori and resistance elements: pHelper plasmid
[0052] = 1:1:1, and the ratio of plasmid DNA: PEI-MAX = 1:3. Plasmid DNA included the recombinant plasmid, GOI plasmid and pHelper plasmid. According to the ratio of plasmid DNA to host 293 cells, a total of 30 μg of plasmid DNA was ensured to be put into each 15 cm cell culture dish.
[0053] The plasmid DNA was mixed with DMEM medium to obtain mixture 1, and the transfection reagent PEI-MAX was mixed with another portion of DMEM medium to obtain mixture 2. After standing at room temperature for 5 min, mixture 1 was poured into mixture 2, gently mixed and then stood for 20 min to obtain mixture 3. Mixture 3 was poured into DMEM transfection medium, and then gently added to the 293 cells from which the culture solution had been removed from the side. The 293 cells after the operation were placed in an incubator at 37°C and 5% CO2 for culture. Both DMEM medium and DMEM transfection medium contained 2% fetal bovine serum and 2% double antibiotics.
[0054] Step 3 Purification of the recombinant adeno-associated virus vector
[0055] 1. Four days after transfection, the recombinant adeno-associated virus vector was harvested. The 293 cells were blown and sucked to change their adherent state to a suspended state, and then centrifuged. The cell pellet after centrifugation was placed in a 50 ml centrifuge tube A, and cell lysate was added to lyse the cells, which was stored in a -80°C refrigerator. The supernatant after centrifugation was placed in centrifuge tube B, and 5M NaCl and PEG8000 were added to bind the recombinant adeno-associated virus vector. During this period, tube B was shaken repeatedly to make the solution clear. After clarification, it was centrifuged, the supernatant was removed, the precipitate was lysed with cell lysate, and then mixed with the solution in centrifuge tube A stored at -80°C to obtain mixed solution A.
[0056] 2. Freeze the mixed solution A at -80°C, thaw it at 37°C, and repeat the freeze-thaw cycle 3 times. Add 1 / 10,000 of universal nuclease and incubate at 37°C for 30 min to remove free DNA. Then add Triton X-100 to make the final volume concentration in the mixed sample tube of recombinant adeno-associated virus vector reach 0.25%, incubate at 37°C for 30 min, centrifuge at 3,000 g for 30 min, and take the supernatant after centrifugation for ultracentrifugation. (Triton X-100 is a surfactant that can be used to disrupt cell membranes to lyse cells and release intracellular substances.)
[0057] 3. Prepare density gradient iodixanol solutions: By mixing different volumes of Opti-prep, 10x Buffer, PBS-MK, 5M NaCl, and H2O, prepare iodixanol solutions with concentrations of 15%, 25%, 40%, and 60% respectively. Transfer the supernatant containing the recombinant adeno-associated virus vector after centrifugation in step 2 to an ultracentrifugation tube, and distribute and transfer the above-mentioned iodixanol solutions with different concentrations into the tube through a peristaltic pump. Set the centrifugation conditions: temperature 4°C, time 1 h 10 min for centrifugation.
[0058] 4. After centrifugation, aspirate the recombinant adeno-associated virus vector from the 40% and 60% layers through a syringe, dilute it with 1x PBS solution containing 1 / 10,000 of poloxamer, and then use a 100KD ultrafiltration tube for buffer replacement and purification. Remove the filtered liquid after centrifugation at 5,000 g. As the centrifugation progresses, the filtered liquid becomes less. Continue to dilute, and finally aspirate the recombinant adeno-associated virus vector and perform sterile filtration through a 0.22μm filter.
[0059] Step 4: Determination of the titer of recombinant adeno-associated virus vector
[0060] 1. Take 2 μL of the purified recombinant adeno-associated virus vector and treat it with a DNA enzyme treatment kit. React at 37°C for 10 min. After the reaction is completed, add 1 μL of 0.1M EDTA and heat inactivate the DNA enzyme at 75°C for 10 min. Then add 20 μL of AAV Lysis Buffer and react at 70°C for 10 min to obtain mixed solution B. Take 2 μL of mixed solution B and add 98 μL of water to dilute it 50 times for qPCR reaction.
[0061] 2. The qPCR reaction is carried out using the probe method. The primers and probes are both designed on the ITR element, and the sequences of the primers and probes are as follows:
[0062] ITR-F: GGAACCCCTAGTGATGGAGTT (SEQ ID NO:3);
[0063] ITR-R: CGGCCTCAGTGAGCGA (SEQ ID NO:4);
[0064] ITR - Probe: CACTCCCTCTCTGCGCGCTCG (SEQ ID NO:5).
[0065] 3. Use the linearized plasmid pAAV - GFP as a standard, with a concentration of 2×10 7 , diluted in 5 gradients, which are 2×10 7 , 2×10 6 , 2×10 5 , 2×10 4 , 2×10 3 respectively. Each reaction has 3 replicates per well, and an additional negative control needs to be prepared.
[0066] 4. After preparing the system, perform the reaction on the machine to obtain the virus titer.
[0067] Step 5 Characterization of the recombinant adeno - associated virus vector
[0068] 1. HUH - 7 cell culture: HUH - 7 cells are cultured in a complete medium of DMEM containing 10% fetal bovine serum and 2% double antibiotics. When the confluence of the adherent cells reaches about 80%, cell passage is carried out. First, remove the supernatant, wash the cells with 1x PBS, then add trypsin to digest the cells. When the cells flow down like sand, add the complete medium to terminate the digestion. Centrifuge at 300g for 5 min, remove the supernatant, and resuspend with a little medium for passage.
[0069] 2. HUH - 7 3D cell culture: Spherical cultures are generated by culturing human hepatocellular carcinoma (HUH - 7) cells in 6 - well ultra - low attachment culture dishes. The cells are cultured in DMEM (supplemented with EGF, FGF, and B27). Use trypsin - EDTA solution to separate the adherently growing HUH - 7 cells. At this time, the cell confluence should be 80 - 90% and in good condition. Centrifuge the cell suspension at 300x g for 5 minutes and aspirate the supernatant. Resuspend the cells in a small amount of culture and count. Seed the cells at 5E5 cells / ml in 6 - well ultra - low attachment culture plates and observe discrete spheres within 3 - 7 days. Add half of the culture volume of fresh medium every 3 - 4 days. Do not replace all the medium at once as in traditional two - dimensional cell culture. After observing discrete spheres, separate the cells, count, and determine the viability.
[0070] 3. Cell transduction experiment: Infect HUH - 7 spherical cells with virus particles expressing the GFP reporter gene, with an MOI of 5000 vg / cell. Incubate the cells at 37°C for 72 h. Then trypsinize the cells and quantitatively analyze the expression frequency of GFP by flow cytometry.
[0071] 4. Immune escape experiment: HUH-7 adherent cells were counted and seeded into 96-well plates and incubated overnight. Recombinant adeno-associated virus particles with an MOI of 1x10 4 vg / cell expressing the GFP reporter gene were incubated with different concentrations of human intravenous immunoglobulin (0 - 1000 ug / mL) in a humidified CO2 incubator at 37°C for 1 hour. The virus-immunoglobulin mixture was overlaid on the HUH-7 monolayer cells in the 96-well plates and incubated at 37°C for 72 h. Then the cells were trypsinized and the frequency of GFP was quantitatively analyzed by flow cytometry. The flow cytometry results were analyzed to obtain the optimal variant, namely the recombinant adeno-associated virus vector of the present invention.
[0072] Comparative Example 1
[0073] AAV3B is a wild-type virus, and AAV2-LK03 is an excellent capsid variant virus vector designed by a foreign company. Currently, it is a relatively benchmark product in the AAV liver field and is currently used in clinical trials. AAV3B-DE5 is the superior variant of AAV3B-DE5 mentioned by Moanaro Biswas et al. in Engineering and In Vitro Selection of a Novel AAV3B Variant with High Hepatocyte Tropism and Reduced Seroreactivity (Mol Ther Methods Clin Dev. 2020 Dec 11; 19: 347–361.). The wild-type AAV3B, AAV-LK03, and AAV3B-DE5 were respectively packaged into viruses according to the method of Example 1 of the present invention. After purification, the corresponding sufficient amounts of viruses were obtained, and then characterization experiments were carried out, namely cell transduction experiments and immune escape experiments. The cells were collected for flow analysis to detect GFP expression. Biostatistical data analysis was performed and comparisons were made at the GFP expression level.
[0074] Data analysis results
[0075] The GFP expression of the recombinant adeno-associated virus vector of the present invention, AAV3B, AAV-LK03, and AAV3B-DE5 virions is compared as Figure 1 and Figure 2 shown.
[0076] Figure 1 They are respectively the transduction efficiency graphs of AAV3B, AAV-LK03, AAV3B-DE5 virions and the recombinant adeno-associated virus vector (CL5-LI5) of the present invention transducing HUH-7 spheroids, representing the GFP expression level, Figure 1The ordinate in it is %GFP (percentage of GFP cells), and the abscissa is MOI = 5000 vg / cell. Here, vg is the abbreviation of vector genome, and vg / cell indicates how many viral particles are allocated to each cell.
[0077] Figure 2 They are respectively the transduction efficiency diagrams of AAV3B, AAV-LK03, AAV3B-DE5 virions and the recombinant adeno-associated virus vector (CL5-LI5) of the present invention after incubation with human intravenous immunoglobulin for transducing adherent HUH-7 cells. Figure 2 The ordinate in it is %GFP (percentage of GFP cells), and the abscissa is different concentrations of human intravenous immunoglobulin (IVIG, 0 - 1000 ug / mL).
[0078] Figure 1 and Figure 2 From the results of it can be seen that in terms of GFP expression level, the recombinant adeno-associated virus vector of the present invention shows stronger transduction efficiency and immune escape ability than AAV3B, LK03 or AAV3B-DE5.
Claims
1. A recombinant AAV capsid protein targeting hepatocytes, characterized in that, The recombinant AAV capsid protein includes VP1, VP2, and VP3 regions, which are obtained by mutating the common regions of VP1, VP2, and VP3 of the natural AAV5 capsid protein; or obtained by mutating the common regions of VP1, VP2, and VP3 after hybridizing the natural AAV5 capsid protein with the capsids of other AAV serotypes, wherein the mutated sites correspond to at least one mutation at positions 310 to 736 of the AAV5 capsid protein in SEQ ID NO: 1; Corresponding to SEQ ID NO: 1, it has at least one of the following mutations: S319, T376, E377, N378, N442, N443, S518, A581, T648, S649, S656, N694, S705, T706.
2. The recombinant AAV capsid protein targeting hepatocytes according to claim 2, wherein, Corresponding to SEQ ID NO: 1, it has at least one of the following mutations: S319G, T376G, E377K, N378D, N442T, N443S, S518R, A581T, T648L, S649V, S656E, N694D, S705G, T706N.
3. A recombinant AAV capsid protein targeting hepatocytes according to claim 3, characterized in that, Corresponding to SEQ ID NO: 1, it has the following mutations: S319G, T376G, E377K, N378D, N442T, N443S, S518R, A581T, T648L, S649V, S656E, N694D, S705G, T706N.
4. A recombinant AAV capsid protein targeting hepatocytes according to claim 4, characterized in that, The capsids of the other AAV serotypes include any one of AAV1, AAV2, AAV3B, AAV4, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, bovine AAV, AAV2.5T, and AAV-LK03.
5. A nucleic acid sequence capable of encoding the recombinant AAV capsid protein targeting hepatocytes according to any one of claims 1-4.
6. A vector comprising the nucleic acid sequence according to claim 5.
7. A pharmaceutical composition comprising the vector according to claim 6.
8. Use of the pharmaceutical composition according to claim 7, which can be used for the treatment of liver cancer.
Citation Information
Patent Citations
Novel recombinant adeno-associated virus capsids resistant to pre-existing human neutralizing antibodies
CN109415704A
Adeno-associated virus (AAV) isolates and AAV vectors derived therefrom
US6156303A
AAV4 vector and uses thereof
WO1998011244A2
AAV5 vector and uses thereof
WO1999061601A2
Adeno-associated virus serotype 1 nucleic acid sequences, vectors and host cells containing same
WO2000028061A2