DNA aptamer of targeted phospholipid binding protein MlaC and application
By designing and screening nucleic acid aptamers targeting MlaC proteins, the problem of difficulty in effectively targeting MlaC proteins in the prior art is solved, and a high affinity and strong specificity is achieved, providing a new antibacterial drug development pathway.
Patent Information
- Application Number
- CN202510304279.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-15
- Publication Date
- 2025-06-27
AI Technical Summary
The prior art is difficult to effectively target MlaC protein in Gram-negative bacteria, limiting the potential for developing antibacterial drugs.
Nucleic acid aptamers targeting MlaC protein were designed and screened out. Through the optimization and structural analysis of nucleotide sequences, DNA aptamers that can bind to MlaC protein with high affinity were obtained, and their stability and function were improved through nucleotide ablation, mutation, tandem, and cyclization.
The high affinity and strong specificity of MlaC protein binding is achieved, providing a potential novel antibacterial drug, and improving the therapeutic effect on Gram-negative bacteria.
Smart Images

Figure CN120210214A_ABST
Abstract
Description
[0001] This divisional application is a divisional application of the patent application No. 202410945173.4, with the filing date of July 15, 2024, and the invention title "A Nucleic Acid Aptamer Targeting MlaC Protein and Its Application". Technical Field
[0002] The present invention belongs to the technical field of molecular biology, and specifically relates to a DNA aptamer targeting the phospholipid-binding protein MlaC and its application. Background Art
[0003] The asymmetric cell membrane is a key protective barrier of Gram-negative bacteria, which can limit the entry of small molecules such as antibiotics into the cell. To maintain this lipid asymmetry, the ABC (ATP-binding cassette) transport system in bacteria transports phospholipid molecules between the inner and outer membranes to prevent their accumulation in the inner or outer membrane. Specifically, the MlaA protein is involved in the extraction of phospholipids on the outer membrane, the MlaC protein transfers phospholipids bidirectionally between the inner and outer membranes, and MlaBDEF receives the phospholipids transported to the inner membrane. Disrupting any key component in the Mla pathway will increase the permeability of the outer membrane, damage bacterial functions, and thus increase the sensitivity of bacteria to antibiotics. Therefore, the MlaC protein that plays an important role in this pathway can be used as a key target for developing antibacterial drugs.
[0004] Nucleic acid aptamers are single-stranded DNA or RNA molecules screened in vitro, which can bind to corresponding targets with high affinity and specificity. Compared with protein antibodies, nucleic acid aptamers have a smaller relative molecular mass, good tissue penetration ability, lower immunogenicity, and are not likely to cause immune responses in the body; nucleic acid aptamers can be synthesized in large quantities at low cost by chemical methods, and there are no differences between batches; in addition, nucleic acid aptamers are easy to modify and can be linked with different groups to achieve binding with various carriers. Due to their excellent physical and chemical properties, nucleic acid aptamers are expected to become substitutes for traditional anti-infective drugs and have great application prospects in disease treatment.
[0005] It is of great significance to screen nucleic acid aptamers that specifically target the MlaC protein in Gram-negative pathogenic bacteria and make them potential new antibacterial drugs. Summary of the Invention
[0006] In view of this, the purpose of the present invention is to provide a DNA aptamer targeting the phospholipid-binding protein MlaC and its application.
[0007] For the above purposes, in the first aspect of the present invention, a nucleic acid aptamer targeting the MlaC protein is provided, and its nucleotide sequence is shown as any one of SEQ ID NO.1-12. In addition, through the secondary structure analysis of the nucleic acid aptamer, we deleted some nucleotides and obtained shorter aptamer sequences that can bind to the MlaC protein. These truncated nucleic acid aptamer sequences are shown as any one of SEQ ID NO.13-24. Through the structural analysis of the complexes of some nucleic acid aptamers and the MlaC protein, we determined two types of key motifs that interact with the MlaC protein, and their sequences are shown as SEQ ID NO.25-26.
[0008] SEQ ID NO.1(m520-6): TTATGGGTGTGGGTGTTTGTTGGGCTAGTCGTCACCCGCC;
[0009] SEQ ID NO.2(m520-3): GGATATGCGCCCCCGGTGGAGGTGCGTGGTGGCGCTGTT;
[0010] SEQ ID NO.3(m520-8): TGGCCGCGCCGCGGTGGAGGTGCGTCGTGCTCGGCTTCTG;
[0011] SEQ ID NO.4(m620-8): TCTAGCCGCGGTGGAGGTGCGTCGTGCTGGAGCCTTAGAA;
[0012] SEQ ID NO.5(m626-8): GCCCCGGTGGAGGTGCGTGGTGACTTCTGACAGTTCACTG;
[0013] SEQ ID NO.6(m526-4): GGTCCCCGGTGGAGGTGCGTGGTGACTTCATATCATTAAC;
[0014] SEQ ID NO.7(m620-7): TGTCCCCGGTGGAGGTGCGTGGTGTGCCTATATGCCCTTG;
[0015] SEQ ID NO.8(m626-7): TAAAGCCGCGGTGGAGGTGCGTCGTGTCTATACGCTCTTG;
[0016] SEQ ID NO.9 (m520-1): CCGTCGGTGGAGGTGCGGCTGGCATCACTCTGCTCCGGCC;
[0017] SEQ ID NO.10 (m626-10): GGTCCCCCTCGGCGGTGGTAGGTCTTATGGTCCCGGGTGC;
[0018] SEQ ID NO.11 (m520-9): GGTCCCCCTCGGCGGTGGTACGTGTCATGGTCCAATCGTC;
[0019] SEQ ID NO.12 (m620-9): GGCGGGTTGTGGGTCCCATCGGCGGCGGCGAGCCCTCGTG;
[0020] SEQ ID NO.13 (S5208-1): GCCGCGCCGCGGTGGAGGTGCGTCGTGCTCGGC;
[0021] SEQ ID NO.14 (S520-3): GCGCCCCCGGTGGAGGTGCGTGGTGGCGC;
[0022] SEQ ID NO.15 (S520-6): GTGGGTGTTTGTTGGGCTAGTCGTCACCCGC;
[0023] SEQ ID NO.16 (S620-8): TCTAGCCGCGGTGGAGGTGCGTCGTGCTGGA;
[0024] SEQ ID NO.17 (S626-8): GCCCCGGTGGAGGTGCGTGGTGAC;
[0025] SEQ ID NO.18 (S520-9): GGTCCCCCTCGGCGGTGGTACGTGTCATGG;
[0026] SEQ ID NO.19 (S626-10): CCCCTCGGCGGTGGTAGGTCTTATGGTCC;
[0027] SEQ ID NO.20 (S526-4): GTCCCCGGTGGAGGTGCGTGGTGAC;
[0028] SEQ ID NO.21(SS526-4): CCCCGGTGGAGGTGCGTGGTGA;
[0029] SEQ ID NO.22(S5206-1): GGGGT TTGTTGGGCTAGTCGTCCCC;
[0030] SEQ ID NO.23(S5206-4): GGGTGTTTGTTGGGCTAGTCGTCACCC;
[0031] SEQ ID NO.24(S6267): CCGCGGTGGAGGTGCGTCGTGT;
[0032] SEQ ID NO.25(motif1): TTTGTTGGGCTAGTCG;
[0033] SEQ ID NO.26(motif2): CGGTGGAGGTGCG;
[0034] The above sequences can be directly obtained by chemical solid-phase synthesis, or by PCR amplification of the DNA template with spacer-18 modified primers, followed by separation of the long and short chains by urea-denatured polyacrylamide gel electrophoresis. In addition, we also circularized two nucleic acid aptamers in series to obtain circular DNA aptamers that can resist nuclease degradation. The sequences are shown in SEQ ID NO.27-33, and their stability is further improved. The circular DNA aptamers (SEQ ID NO.27-33) can be obtained by treating single-stranded molecules with T4 polynucleotide kinase and T4 DNA ligase successively to covalently connect the 5'-phosphate and 3'-hydroxyl groups to form phosphodiester bonds.
[0035] SEQ ID NO.27(3a):
[0036] GCGCCCCCGGTGGAGGTGCGTGGTGGCGCGCGCCCCCGGTGGAGGTGCGTGGTGGCGC;
[0037] SEQ ID NO.28(3b):
[0038] GGCGCCCCCGGTGGAGGTGCGTGGTGGCGCCGCGCCCCCGGTGGAGGTGCGTGGTGGCGC;
[0039] SEQ ID NO.29(3c):
[0040] GGCGCCCCCGGTGGAGGTGCGTGGTGGCGCCGGCGCCCCCGGTGGAGGTGCGTGGTGGCGCC;
[0041] SEQ ID NO.30(6b):
[0042] GGTGGGTGTTTGTTGGGCTAGTCGTCACCCGCCGTGGGTGTTTGTTGGGCTAGTCGTCACCCGC;
[0043] SEQ ID NO.31(6c):
[0044] GGTGGGTGTTTGTTGGGCTAGTCGTCACCCGCCGGTGGGTGTTTGTTGGGCTAGTCGTCACCCGCC;
[0045] SEQ ID NO.32(3f):
[0046] GCCCCCGGTGGAGGTGCGTGGTGGCGCCCCCGGTGGAGGTGCGTGGTGGC;
[0047] SEQ ID NO.33(6f):
[0048] GGGTGTTTGTTGGGCTAGTCGTCACCCGGGTGTTTGTTGGGCTAGTCGTCACCC;
[0049] Furthermore, nucleotide sequences obtained by truncating, extending, mutating, concatenating or cyclizing the sequences shown in any of SEQ ID NO.1 - 33 and still containing the key nucleic acid motifs, as well as nucleic acid aptamer nucleotide sequences that retain the ability to bind to the MlaC protein, are also within the scope of protection of the present invention.
[0050] Preferably, the nucleotide sequence of the nucleic acid aptamer contains a label or the bases are chemically modified.
[0051] The labels include, but are not limited to, isotope labels, fluorescent labels, biotin labels, enzyme labels, and chemiluminescent labels.
[0052] The chemical modifications include, but are not limited to, methylation modification, amination modification, mercaptan modification, phosphorylation modification, thiolation modification, carboxylation modification, and isotopic modification.
[0053] On the other hand, the present invention also provides the application of the above-mentioned nucleic acid aptamer in the preparation of products for detecting or purifying the MlaC protein.
[0054] Preferably, the product includes but is not limited to kits, biosensors, and detection chips.
[0055] On the other hand, the present invention also provides the application of the above nucleic acid aptamer in the preparation of a drug targeting the MlaC protein.
[0056] Preferably, the drug targeting the MlaC protein is an antibacterial drug, and more preferably, it is a drug against Gram-negative bacteria.
[0057] On the other hand, the present invention also provides a product for detecting or purifying the MlaC protein, which product contains the above nucleic acid aptamer.
[0058] On the other hand, the present invention also provides a drug targeting the MlaC protein, which drug contains the above nucleic acid aptamer.
[0059] The present invention has the following beneficial effects:
[0060] (1) The MlaC nucleic acid aptamer of the present invention is obtained by in vitro screening technology. This aptamer can fold into a specific three-dimensional structure to interact with the MlaC protein with high affinity, and it also has the advantages of strong specificity, easy preparation, and easy modification.
[0061] (2) Based on the MlaC nucleic acid aptamer, nucleotide deletion, mutation, tandem, and cyclization are carried out to obtain a circular MlaC nucleic acid aptamer with the same function as the MlaC nucleic acid aptamer, which can become a potential nucleic acid drug for treating Gram-negative pathogenic bacteria infections. Description of the Drawings
[0062] Figure 1 For MlaC protein purification - gel filtration chromatography.
[0063] Figure 2 For urea denaturing gel electrophoresis to separate single-stranded DNA molecules.
[0064] Figure 3 For EMSA experiment to verify the interaction between the nucleic acid aptamer and the MlaC protein.
[0065] Figure 4 For ITC experiment to verify the interaction between the nucleic acid aptamer and the MlaC protein.
[0066] Figure 5 For S5206 - 4 - MlaC complex crystal.
[0067] Figure 6 For the secondary structure schematic diagram and three-dimensional structure model of the nucleic acid aptamer - MlaC protein complex.
[0068] Figure 7Schematic diagram of the secondary structure of the circular DNA aptamer.
[0069] Figure 8 Identification of the circular nucleic acid aptamer after treatment with T4 DNA ligase. Among them, Linear-3a refers to the state of the 3a sequence when it is linear, Circular-3a refers to 3a after cyclization, and so on for others.
[0070] Figure 9 Verification of the interaction between the circular aptamer and MlaC protein by EMSA experiment. Among them, 3a-control is the control group, that is, only 3a is added to the system, 3a-MlaC is the experimental group, that is, 3a and MlaC protein are added to the system at the same time, and so on for others. Detailed implementation mode
[0071] The following examples are further descriptions of the present invention, rather than limitations on the present invention.
[0072] Example 1 Screening of nucleic acid aptamers targeting MlaC protein
[0073] (1) Expression and purification of MlaC protein
[0074] According to the signal peptide prediction results, the potential signal peptide sequence of MlaC protein was deleted, and its gene sequence was constructed into the pRSFDuet-1 protein expression vector (Novagen, 71341-3). A fusion protein with His-sumo tag was obtained using the Escherichia coli prokaryotic expression system; high-purity MlaC protein was obtained by methods such as affinity chromatography, ion exchange chromatography, and gel filtration chromatography.
[0075] MlaC protein purification - gel filtration chromatography is as Figure 1 shown.
[0076] (2) Design of DNA nucleic acid library
[0077] Since there has been no report on DNA aptamers targeting MlaC protein before, a DNA library with a length of 40 nt and a completely random sequence was used, and primer binding sequences of 20 nt were each carried at both ends for subsequent PCR amplification. In order to obtain a single-stranded DNA library, Spacer18 and 20 consecutive adenylates were introduced at the 5' end of the reverse primer, and then the PCR amplification product was obtained by urea denaturing gel electrophoresis to obtain a high-purity single-stranded DNA library (Table 1 and Figure 2 ).
[0078] Table 1. DNA library and primer sequences used in the experiment
[0079]
[0080] (3) Carboxyl magnetic bead screening
[0081] Couple the MlaC protein to the activated carboxyl magnetic beads, and at the same time anneal the single-stranded DNA library obtained by purification; then, add the annealed single-stranded DNA library to the MlaC protein-carboxyl magnetic beads for incubation, wash away the non-specifically bound DNA on the magnetic beads with the screening buffer, and then elute the DNA molecules specifically binding to the target protein with the elution buffer. Enrich the remaining DNA by PCR as the library for the next round of screening.
[0082] Table 2. Summary table of the screening process and retention rate
[0083] Number of rounds Amount of ssDNA (μg) Amount of protein-magnetic beads Number and time of washes Elution amount of ssDNA (μg) Retention rate 1 30 1 3 times, 10 s each time 0.414 1.38% 2 5 1 4 times, 10 s each time 0.540 10.49% 3 5 1 4 times, 5 min each time 0.088 1.72% 4 5 1 5 times, 10 min each time 0.206 4.03% 5 5 1 / 2 5 times, 10 min each time 0.420 8.40% 6 5 1 / 4 5 times, 10 min each time 0.736 14.72%
[0084] During the screening process, we increased the screening pressure by adjusting the amount of ssDNA added in each round and the amount of protein-magnetic column, and monitored the enrichment situation by calculating the DNA retention rate. As can be seen from Table 2, the retention rate basically increased round by round, indicating DNA enrichment. After six rounds of screening, we sequenced the DNA library and obtained multiple DNA sequences.
[0085] Example 2 Detection of the interaction between the aptamer and the MlaC protein by electrophoretic mobility shift assay (EMSA)
[0086] Synthesize and purify the screened DNA molecules (SEQ ID NO.1-12) and the truncated DNA molecules (SEQ ID NO.13-24) respectively, and then anneal the DNA molecules in the screening buffer; then, incubate the MlaC protein with different concentrations of DNA molecules for 1 h; further detect the states of the MlaC protein and the DNA molecules by 10% polyacrylamide gel electrophoresis without urea; after electrophoresis, transfer the gel to ddH2O containing Dured dye, stain for 10 min, and then record the experimental results with a gel imager.
[0087] As Figure 3 shown, the Control group means that only the aptamer exists in the system; the MlaC-his group means that the MlaC-his fusion protein is added to the aptamer, and this fusion protein is the protein used in the screening process. Specifically, the C-terminus of the MlaC protein carries a his tag; the MlaC group means that the MlaC protein is added to the aptamer. The results show that after adding the MlaC protein to the system, the aptamer will show an upshifted band on the gel, indicating that these screened aptamers bind to the MlaC protein rather than the his tag of the MlaC-his fusion protein.
[0088] Example 3 Detection of the Interaction between Aptamer and MlaC Protein by Isothermal Titration Calorimetry (ITC)
[0089] Dialyze the MlaC protein and DNA aptamer separately in the screening buffer overnight. After taking out the samples, dilute the samples to the working concentration and anneal the DNA. In the isothermal titration calorimetry experiment, the titration concentration ratio of MlaC to DNA is 1:14. After the titration, use the supporting software for data processing and analysis. As Figure 4 shown, both S520-3 and S520-6 can bind to the MlaC protein with nanomolar affinity. At the same time, the truncated forms S5206-1 and S5206-4 of S520-6 still retain the ability to bind to the MlaC protein, but the affinity is weakened.
[0090] Example 4 Structural Analysis of the Complex of Aptamer and MlaC Protein
[0091] (1) Screening and Optimization of Crystallization Conditions
[0092] Dilute the purified DNA sample to an appropriate concentration and anneal it, and then incubate it with the MlaC protein for 1 h. Use the LCP protein crystallization automated instrument to mix the sample and the crystal growth screening buffer of different components evenly on the sitting-drop plate, and then place the sealed crystallization plate in a constant temperature incubator and observe and record the crystal growth situation regularly. After the initial screening of crystal growth, repeat and optimize the crystallization conditions to obtain high-resolution complex crystals ( Figure 5 ).
[0093] (2) X-ray Data Collection and Processing
[0094] Place the crystal in the cryoprotectant solution and quickly transfer it to liquid nitrogen for cryopreservation. Collect X-ray diffraction data using the Shanghai Synchrotron Radiation Source. Use HKL3000 equipped at the Shanghai Synchrotron Radiation Source beamline to process the data.
[0095] Table 3. Summary Table of Crystal Data of S5206-4-MlaC Complex
[0096]
[0097]
[0098] (3) Structure Determination
[0099] Using the structure of the individual MlaC protein (PDB ID: 5UWA) as a model, solve the phase angle problem of the crystal structure of the MlaC-DNA complex by the molecular replacement method. Then use software such as Phenix and Coot to analyze and correct the crystal structure of the complex, and finally obtain the complex structures of the MlaC protein with S5206-4 and S6267 respectively.
[0100] (4) Structural analysis
[0101] Perform structural analysis using the pymol software. Determine the overall structure of the MlaC protein and the DNA aptamer, analyze the key sites involved in the interaction, and determine the positions of important metal ions in the structure. Figure 6 A shows the three-dimensional structure of the complex of the MlaC protein and S5206-4, Figure 6 B shows the three-dimensional structure of the complex of the MlaC protein and S6267. As can be seen from the structure, multiple nucleotides on the key motifs (light cyan; motif1 corresponds to S5206-4; motif2 corresponds to S6267) in the two types of nucleic acid aptamers respectively form extensive hydrogen bond interactions (indicated by dotted lines) with some amino acids at the bottom of the MlaC protein (the protein is marked in pink, and the binding sites are marked in purple), enabling the aptamer to bind to the concave region at the bottom of the MlaC protein with high affinity and high specificity. These structural information indicate that the two types of motifs play a key role in the binding of the nucleic acid aptamer-MlaC protein.
[0102] Example 5 Preparation of Circular DNA Aptamer and Detection of Its Interaction with MlaC Protein
[0103] (1) Preparation of circular DNA nucleic acid aptamer
[0104] Based on the complex structure, rationally truncate and mutate the DNA aptamer. Then, tandem two MlaC nucleic acid aptamers into a long single-stranded molecule, phosphorylate the 5'-hydroxyl group of the single-stranded molecule using T4 Polynucleotide Kinase, and then use T4 DNA ligase to covalently link the 5'-phosphate and 3'-hydroxyl group of the single-stranded molecule to form a phosphodiester bond. Finally, separate the cyclized products by urea-polyacrylamide gel electrophoresis to synthesize circular DNA nucleic acid aptamers with sequences such as SEQ ID NO. 27-33.
[0105] The secondary structure of the circular DNA nucleic acid aptamer is shown in Figure 7 . The identification result of the circular nucleic acid aptamer after treatment with T4 DNA ligase is shown in Figure 8 .
[0106] (2) Detection of the interaction between the circular DNA aptamer and the MlaC protein
[0107] Refer to the EMSA method in Example 2 to detect the interaction between the circular DNA aptamer and the MlaC protein. The results are shown in Figure 9 .
[0108] As shown in Figure 9As shown, the designed tandem aptamer can show an upward-shifted band on the gel after adding MlaC protein in both linear and circular states, indicating that the circularized nucleic acid aptamer has the ability to bind to MlaC protein.
[0109] The above are only the preferred embodiments of the present invention. It should be noted that the above preferred embodiments should not be regarded as limitations on the present invention. The protection scope of the present invention should be subject to the scope defined by the claims. For those of ordinary skill in the art, without departing from the spirit and scope of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as within the protection scope of the present invention.
Claims
1. A DNA aptamer targeting phospholipid binding protein MlaC, characterized in that: The nucleic acid aptamer includes a nucleotide sequence as shown in any one of SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.24, SEQ ID NO.26, SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.29, and SEQ ID NO.
32.
2. The nucleic acid aptamer according to claim 1, characterized in that The nucleic acid aptamer also includes a nucleic acid aptamer molecule derived from the sequence of SEQ ID NO.26, which has one or more nucleotides replaced, deleted and / or added to the sequence shown in SEQ ID NO.26 and has aptamer function. The sequence of the nucleic acid aptamer molecule is shown in any one of SEQ ID NO.10, SEQ ID NO.11, SEQ ID NO.18 and SEQ ID NO.
19.
3. The nucleic acid aptamer according to claim 1, characterized in that The nucleotide sequence of the nucleic acid aptamer contains a label or the base is chemically modified.
4. The nucleic acid aptamer according to claim 3, characterized in that The marker includes one or more of an isotope marker, a fluorescent marker, a biotin marker, an enzyme marker and a chemiluminescent marker; the chemical modification includes one or more of a methylation modification, an amination modification, a sulfhydryl modification, a phosphorylation modification, a thiolation modification, a carboxylation modification and an isotope modification.
5. Use of the nucleic acid aptamer according to any one of claims 1 to 4 in preparing a product for detecting or purifying MlaC protein.
6. The use according to claim 5, characterized in that: The products include test kits, biosensors, and detection chips.
7. Use of the nucleic acid aptamer according to any one of claims 1 to 4 in the preparation of a drug targeting MlaC protein.
8. The use according to claim 7, characterized in that: The drug targeting the MlaC protein is an antibacterial drug.
9. A product for detecting or purifying MlaC protein, characterized in that: The method comprises the nucleic acid aptamer according to any one of claims 1 to 4.
10. A drug targeting MlaC protein, characterized in that: The method comprises the nucleic acid aptamer according to any one of claims 1 to 4.