Primer group for amplifying variable region genes of monkey-derived antibody, kit and monkey-derived antibody preparation method
By providing a specific primer set for PCR amplification, the problem of gene amplification of the variable region of monkey-derived antibodies is solved, and rapid and effective antibody preparation is achieved, which improves efficiency and reduces costs.
Patent Information
- Application Number
- CN202311748687.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-19
- Publication Date
- 2025-06-27
AI Technical Summary
The prior art is difficult to rapidly and efficiently amplify the variable region genes of monkey-derived antibodies, resulting in complex, long and high cost of antibody preparation.
A primer set that amplifies the variable region gene of monkey-derived antibody, including specific upstream and downstream primers, is provided, which can rapidly amplify naturally paired heavy and light chain variable region genes by one PCR.
It achieves efficient and highly specific antibody variable region gene amplification, shortens the antibody preparation cycle, improves the antibody screening efficiency, and reduces costs.
Smart Images

Figure CN120210221A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of genetic engineering antibody preparation, and particularly relates to a primer set for amplifying variable region genes of monkey-derived antibodies, a kit and a method for preparing monkey-derived antibodies. Background Art
[0002] Rhesus monkeys (Macaca mnlatta) belong to the macaque genus of the primate monkey family and are close to humans in terms of genetic relationship. Therefore, they have become an ideal animal model for studying human health and diseases and are widely used in research fields such as infectious diseases, genetic diseases, cardiovascular diseases, pharmacology, and toxicology. In addition, due to the genetic similarity in species evolution, monkey-derived antibodies have higher homology with human-derived antibodies. Therefore, monkey-derived antibodies used as specific immunotherapeutic agents can greatly reduce the rejection reaction of the body and are excellent candidates for preparing monoclonal antibody drugs clinically. However, due to problems such as the high cost of constructing rhesus monkey model animals, precious samples, complex antibody preparation and production processes, and long time and cycle, there are few studies and reports on monkey-derived monoclonal antibodies at present.
[0003] The most crucial technology in monoclonal antibody development lies in the acquisition of variable region gene sequences. Currently, the mainstream route for antibody development is recombinant antibody technology, which mainly includes three approaches: 1) Hybridoma technology: The hybridoma technology route is mature. By sequencing hybridoma cells, the antibody gene sequence can be obtained. However, the chromosomes of hybridoma cells are prone to loss, resulting in the degeneration of hybridoma cells. Reconstruction is time-consuming and laborious, and the hybridoma technology cannot be applied to rhesus monkeys to obtain the target antibody gene; 2) Phage display technology: By displaying scFv single-chain antibodies or Fab fragments on the surface of phages to construct an antibody library, and then combining the antibody library with solid-phase technology and high-throughput screening methods, antibodies with relatively high affinity can be obtained conveniently and quickly. Then, the phages are sequenced to obtain the antibody sequence. However, when this technology is applied to amplify rhesus monkey antibody sequences, it faces problems such as the difficulty in obtaining B cell samples and the loss of antibody sample volume during library construction and screening; 3) Single B cell cloning technology: Single B cell cloning technology is another breakthrough in antibody production technology following hybridoma and phage display. It can efficiently and rapidly isolate antibodies from single B cells. Based on the characteristics that each B cell contains only one functional heavy chain variable region and one light chain variable region sequence, and each B cell produces only one specific antibody, antigen-specific B cells are isolated from the peripheral blood of immunized animals. Then, the antibody variable region genes are amplified from single antibody-secreting B cells through RT-PCR and nested PCR techniques, and the sequence information is determined by sequencing. Then, through genetic engineering techniques, vector construction, antibody expression, and verification are carried out to obtain monoclonal antibodies with biological activity. Phage display technology relies on in vitro recombination of heavy and light chains to generate and screen antibodies not found in vivo, while direct B cell cloning retains the natural pairing of the original heavy and light chain variable regions, with advantages such as good gene diversity, high efficiency, and full natural origin, and has become a popular tool for antibody development.
[0004] When using B cells to clone antibody variable region genes, fully differentiated B cells are required. Fully differentiated B cells are plasma cells produced by antigen stimulation, accounting for only 0.1-1.0% of B cells. In addition, it is difficult to culture highly differentiated B cells, which makes it difficult to enrich various B cells containing antibody genes at the cellular level. It is difficult to amplify antibody genes using the nested PCR method of traditional RT-PCR combined with degenerate primers for sequence amplification, and it is difficult to obtain the target antibody sequence. The RACE (rapid amplification cDNA end) technology that has emerged in recent years has the characteristics of time saving, sensitivity and high efficiency. 5'RACE is based on PCR technology. After reverse transcription of mRNA using Oligo (dT) primers, the 5' end of cDNA is homopolymer tailed with deoxyribonucleotide terminal transferase (TdT), thereby adding a linker to the 5' end of the unknown cDNA, and then amplifying the 5' end of the unknown mRNA using gene-specific primers and linker primers. The 5'RACE method can be used to obtain the true sequence of the variable region and signal peptide of the antibody, and then ensure the function of the natural antibody obtained through genetic engineering expression. However, there are still many technical difficulties in the successful application of this method; first, the specificity and amplification efficiency of the amplification primers are very high. Although there are amplification primers for some human and mouse species, the primer sequence is usually more than 10 pairs. The more primers there are, the greater the possibility of producing non-specific bands, which will result in the appearance of some non-specific products or non-full-length products, thus requiring multiple PCR amplifications to enrich the target sequence; secondly, the amplification procedure is cumbersome. Due to the low specificity of the primers, the variable region sequence is currently obtained by nested PCR after 2 amplifications, resulting in a long experimental cycle, high cost, and a not very ideal success rate. In addition, the primer sets provided above are all non-monkey species and are not suitable for amplifying the variable region sequences of monkey antibodies.
[0005] Based on the above problems, it is necessary to develop a primer set and method for rapid in vitro amplification of monkey antibody variable region genes to achieve rapid and high-throughput acquisition of rich variable region sequences, which is of great significance for the expression or production of monkey antibodies. Summary of the invention
[0006] In view of the problem that the prior art lacks specific amplification primers for monkey antibody variable regions, the present invention provides a primer set for amplifying monkey antibody variable region genes and a kit containing the aforementioned primer set, as well as a method for preparing monkey antibodies by amplifying antibody variable regions based on the aforementioned primer set or kit. The primer set provided by the present invention can achieve rapid amplification of naturally paired heavy and light chain variable region genes through a single PCR, and has the advantages of good variable region sequence diversity, strong specificity, high amplification efficiency and accuracy, etc.
[0007] To achieve the above object, the present invention is specifically realized through the following technical solutions:
[0008] In the first aspect of the present invention, a primer set for amplifying the variable region gene of a monkey-derived antibody is provided, including one or more of the following (1)-(3):
[0009] (1) A primer pair for amplifying the variable region of the γ heavy chain, the DNA sequence of its upstream primer is "ATGGACTKGACCTGGA" and / or "ATGGAGTTKGKGCTGAGCTG", and the DNA sequence of its downstream primer is "GATGGGCCCTTGGTGCTAGCTGAGGA";
[0010] (2) A primer pair for amplifying the variable region of the κ light chain, the DNA sequence of its upstream primer is "ATGGCCATGAGGGCTTCAGCTCA" and / or "ATGGAARCCCCAGCACAGCTT", and the DNA sequence of its downstream primer is "CCACCTTCCACTTTACGCTAGCCTCTCTGGGATA";
[0011] (3) A primer pair for amplifying the variable region of the λ light chain, the DNA sequence of its upstream primer is "ATGGCCTGGTCTCTCCTTCTCACTCT" and / or "ATGGCCKGGACCTCTCTCC", and the DNA sequence of its downstream primer is "CTCCTCATCTAGAGGTGGGAACAGAGTG";
[0012] Wherein, K = G or T, R = A or G.
[0013] Furthermore, the 5' end of the upstream primers for amplifying the variable region of the γ heavy chain, for amplifying the variable region of the λ light chain, and for amplifying the variable region of the κ light chain further includes a linker sequence, which is composed of a vector homologous arm and PolyG, and the DNA sequence of the linker sequence is "ATTCACCATGGG".
[0014] Furthermore, the DNA sequence of the primer set including the linker sequence is as shown in SEQ ID NO.1-9.
[0015] In the second aspect of the present invention, a kit for amplifying the variable region gene of a monkey-derived antibody is provided, and the kit includes the primer set for amplifying the variable region gene of a monkey-derived antibody as described above.
[0016] Further, the kit further comprises an adapter primer and a reverse transcription primer. The DNA sequence of the adapter primer is "TCTATCGATTGAATTCACCATGGG", and the DNA sequence of the reverse transcription primer is "TCTATCGATTGAATTCACCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN", where V = A, G or C, and N = A, T, G or C.
[0017] Further, the kit further comprises one or more of reverse transcriptase, dNTP, ribonuclease inhibitor, dithiothreitol, DNA polymerase, and amplification buffer.
[0018] The third aspect of the present invention provides the use of the primer set for amplifying the variable region gene of a monkey-derived antibody or the kit for amplifying the variable region gene of a monkey-derived antibody as described above in the preparation of a monkey-derived antibody variable region or a monkey-derived antibody.
[0019] The fourth aspect of the present invention provides a method for preparing a monkey-derived antibody, comprising the following steps:
[0020] S1. Obtain a single B cell and reverse transcribe to obtain cDNA;
[0021] S2. Using the cDNA as a template, perform one-round PCR amplification with the primer set as described above to obtain an antibody variable region sequence;
[0022] S3. Construct a recombinant expression vector containing the antibody variable region sequence. The recombinant expression vector carries an antibody constant region sequence. Co-transform the recombinant expression vectors of the light chain and the heavy chain into a host cell and perform expression, and purify to obtain a monkey-derived antibody.
[0023] Further, in step S1, the operation of reverse transcribing to obtain cDNA includes: lysing a single B cell, adding a reverse transcription primer, dNTP, DTT, and RNase Inhibitor and incubating, and then adding an adapter primer and reverse transcriptase to perform a reverse transcription reaction to obtain double-stranded cDNA; wherein the DNA sequence of the reverse transcription primer is as shown in SEQ ID NO.25, and the DNA sequence of the adapter primer is as shown in SEQ ID NO.26.
[0024] Further, in step S2, the PCR amplification system is 25 μL in volume and includes: 4 μL of template, 1 μL of upstream primer, 1 μL of downstream primer, 1 μL of dNTPs, 12.5 μL of 2×Gloria HiFi, and 5.5 μL of pure water; wherein, the concentrations of the upstream primer and the downstream primer are 10 μM; the PCR amplification program includes: pre-denaturation at 98°C for 30 s, followed by 30 cycles under the conditions of denaturation at 98°C for 10 s, annealing at 61°C for 30 s, and extension at 72°C for 30 s, and finally holding at 72°C for 5 min.
[0025] Further, in step S3, the operation of constructing a recombinant expression vector containing the antibody variable region sequence includes: linearizing the pBR322 vector containing the antibody constant region with a restriction endonuclease. Specifically, the pBR322 vector containing the heavy chain constant region of the antibody is linearized with NheI restriction endonuclease, and the pBR322 vector containing the light chain constant region of the antibody is linearized with XbaI restriction endonuclease. Then, the antibody variable region sequence is inserted upstream of the antibody constant region of the pBR322 vector through homologous recombination technology to obtain the recombinant expression vector.
[0026] The advantages and positive effects of the present invention are as follows:
[0027] The primer set provided by the present invention can achieve high-efficiency and specific amplification of the naturally paired heavy and light chain variable region genes of antibodies through one PCR. The amplified variable region sequences have advantages such as good gene diversity and high accuracy, and the amplification products can be directly used in subsequent antibody expression procedures. The obtained antibodies have advantages such as high positive clone rate and titer, greatly improving the antibody screening efficiency and significantly shortening the preparation cycle of monkey-derived monoclonal antibodies, providing a more efficient, simple, rapid, and low-cost approach for obtaining monkey-derived monoclonal antibody gene sequences and developing monkey-derived monoclonal antibodies. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] To more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for the description of the embodiments. Obviously, the following drawings are only some embodiments of the present invention, and those of ordinary skill in the art can obtain other drawings without creative efforts based on these drawings.
[0029] Figure 1 It is a schematic diagram of the amplification of the antibody variable region sequence in the embodiment of the present invention;
[0030] Figure 2 It is an electrophoresis diagram of the amplification of the antibody γ heavy chain variable region gene using the first group and the second group of primers in the embodiment of the present invention;
[0031] Figure 3 Electrophoretogram of amplifying the variable region gene of antibody kappa light chain using the first group and the second group of primers in the embodiment of the present invention;
[0032] Figure 4 Electrophoretogram of amplifying the variable region gene of antibody lambda light chain using the first group and the second group of primers in the embodiment of the present invention;
[0033] Figure 5 Map of mammalian vector pBR322 used in the embodiment of the present invention. Figures a - b are pRB322 vectors pre - carrying the constant region of light chain and the constant region of heavy chain respectively;
[0034] Figure 6 SDS - PAGE electrophoretogram of the rhesus monoclonal antibody purified by affinity chromatography in the embodiment of the present invention;
[0035] Figure 7 ELISA test result graph of the rhesus monoclonal antibody purified in the embodiment of the present invention. Detailed implementation manners
[0036] In order to make the objectives, technical solutions and advantages of the present invention clearer and more understandable, the following further elaborates on the present invention in combination with embodiments. The embodiments described herein are only used to explain the present invention and are not used to limit the present invention.
[0037] Based on the information included in the present invention, those skilled in the art can easily make various changes to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the defined processes, properties or components, because these embodiments and other descriptions are only for schematically illustrating specific aspects of the present invention. In fact, all the various changes that those skilled in the art or related fields can obviously make to the embodiments of the present invention are covered within the scope of the appended claims.
[0038] In order to better understand the present invention rather than limit its scope, all the numbers representing dosages, percentages, and other numerical values used in the present invention should be understood as being modified by the word "about" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the appended claims are approximate values, which may be changed according to different desired properties. Each numerical parameter should at least be regarded as obtained based on the reported significant figures and by the conventional rounding method. In addition, the meanings of the terms "include", "comprise", "contain", "have" and other similar words are non - restrictive, that is, other steps and other components can be added without affecting the results.
[0039] To make the above objects, features, and advantages of the present invention more obvious and understandable, the following will describe the specific embodiments of the present invention in detail with reference to the accompanying drawings.
[0040] An embodiment of the present invention provides a primer set for amplifying the variable region gene of a monkey-derived antibody, including one or more of the following (1)-(3):
[0041] (1) A primer pair for amplifying the variable region of the γ heavy chain, the DNA sequence of its upstream primer is "ATGGACTKGACCTGGA" and / or "ATGGAGTTKGKGCTGAGCTG", and the DNA sequence of its downstream primer is "GATGGGCCCTTGGTGCTAGCTGAGGA";
[0042] (2) A primer pair for amplifying the variable region of the κ light chain, the DNA sequence of its upstream primer is "ATGGCCATGAGGGCTTCAGCTCA" and / or "ATGGAARCCCCAGCACAGCTT", and the DNA sequence of its downstream primer is "CCACCTTCCACTTTACGCTAGCCTCTCTGGGATA";
[0043] (3) A primer pair for amplifying the variable region of the λ light chain, the DNA sequence of its upstream primer is "ATGGCCTGGTCTCTCCTTCTCACTCT" and / or "ATGGCCKGGACCTCTCTCC", and the DNA sequence of its downstream primer is "CTCCTCATCTAGAGGTGGGAACAGAGTG";
[0044] Wherein, K = G or T, R = A or G.
[0045] Based on the gene sequences of the γ heavy chain, λ light chain, and κ light chain of rhesus monkey antibodies in the international immunogenetics database IMGT, the present invention uses bioinformatics sequence analysis methods to sort the gene sequences and degenerate the bases. Then, the signal peptides of the γ, λ, and κ type antibody genes are selected as the targeting sites of the upstream primers, with lengths ranging from 15 to 30 bp starting from ATG, degenerate the similar or closely related sequences, and optimize through experiments to obtain 2 upstream primers for the variable region of the γ heavy chain, 2 upstream primers for the variable region of the λ light chain, and 2 upstream primers for the variable region of the κ light chain. At the same time, the constant regions of the heavy and light chains are used as the targeting sites of the downstream primers to design the downstream primers, forming the above primer set. This primer set is a completely specific amplification primer for rhesus monkeys, which can specifically amplify the variable region gene fragments of the naturally paired antibody heavy and light chains from a single rhesus monkey B cell by a single PCR method (see Figure 1), which has the following advantages: (1) Good gene diversity, basically covering all reported rhesus monkey antibody genes; (2) Strong specificity. In the present invention, a degenerate signal peptide sequence is used to screen the upstream primer, ensuring the specificity of variable region sequence amplification. Moreover, the optimized number of primers is small, greatly reducing non-specific binding during amplification, which is conducive to screening monoclonal antibodies with high specificity and high affinity; (3) High amplification efficiency. It can specifically amplify antibody variable region genes with a low concentration of cDNA from a single B cell as a template and has a high amplification success rate. In particular, the amplification success rate of the γ heavy chain variable region is increased from 33.3% before optimization to 83.3%, the amplification success rate of the κ light chain variable region is increased from 29.1% before optimization to 75%, the amplification success rate of the λ light chain variable region is increased from 33.3% before optimization to 83.3%, and the pairing success rate of natural antibody heavy and light chains is increased from 8.3% to 83.3%; (4) High accuracy. Based on the high specificity of the primers, the accuracy and reliability of the variable region sequence obtained by PCR amplification are greatly improved. Sequencing the amplified light chain variable region and heavy chain variable region obtained in the present invention shows that the amplified antibody sequences are all rhesus monkey antibody genes and the gene sequences are rich and diverse; (5) Simplified antibody preparation process. Using cDNA from a single B cell as a template, high-concentration and high-purity antibody variable region genes can be obtained through a single PCR amplification. The amplification process is optimized, and the amplification product can be used for subsequent expression vector construction without purification, greatly shortening the antibody preparation time and significantly improving the efficiency of target antibody screening, which is applicable to the preparation and screening of high-throughput antibody libraries.
[0046] It should be noted that each pair of primers in the above primer set of the present invention can be used alone or in combination. For example, when amplifying the γ heavy chain variable region, the 5' upstream primer can be used alone "ATGGACTKGACCTGGA" or "ATGGAGTTKGKGCTGAGCTG", and form forward and reverse primers with the 3' downstream primer for amplification. However, considering obtaining natural antibody sequences to the greatest extent, it is recommended that when amplifying the γ heavy chain variable region, the 2 5' upstream primers are pre-mixed (final concentration 10 μM) and form forward and reverse primers with the 3' downstream primer for amplification. The amplification methods for the λ and κ light chain variable regions are the same as that of the γ heavy chain.
[0047] Optionally, the 5' end of the upstream primers for amplifying the γ heavy chain variable region, for amplifying the λ light chain variable region, and for amplifying the κ light chain variable region further includes a linker sequence, which consists of a vector homologous arm and PolyG. Among them, PolyG is used to complementarily pair with the template cDNA to load the vector homologous arm sequence onto the amplification product, and the vector homologous arm can be used for homologous recombination with the subsequent expression vector to conveniently and quickly insert the amplified antibody variable region gene into the target region of the vector, simplifying the construction process of the recombinant expression vector.
[0048] It should be noted that the above-mentioned expression vector is selected from conventional vectors in the art, as long as it can be used to express the target gene, and the present invention does not make special limitations on the foregoing content.
[0049] In a preferred embodiment, the expression vector is pBR322. Exemplarily, the DNA sequence of the linker sequence is "ATTCACCATGGG", and the sequence information of the above primer set containing the linker sequence is shown in SEQ ID NO.1-9. Those skilled in the art know that the vector homologous arms can be adaptively selected or modified according to the type of the selected expression vector and the insertion site. The sequences in the foregoing examples should not be regarded as a limitation on the protection scope of the present invention, and it is only a preferred embodiment of the present invention.
[0050] Another embodiment of the present invention provides a kit for amplifying the variable region gene of a monkey-derived antibody, and the kit includes the primer set for amplifying the variable region gene of a monkey-derived antibody as described above.
[0051] The advantages of the kit for amplifying the variable region gene of a monkey-derived antibody over the prior art are the same as those of the primer set for amplifying the variable region gene of a monkey-derived antibody over the prior art, and will not be elaborated herein.
[0052] Optionally, the kit further includes a linker primer and a reverse transcription primer. The DNA sequence of the linker primer is "TCTATCGATTGAATTCACCATGGG" (see SEQ ID NO.26), and the DNA sequence of the reverse transcription primer is " TCTATCG ATTGAATTCACC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN", where V = A, G or C, and N = A, T, G or C" (see SEQ ID NO.25). The reverse transcription primer and the linker primer are used to reverse transcribe the mRNA of a single B cell into a cDNA sequence as a template for variable region gene amplification (see Figure 1 ). At the same time, a partial linker primer sequence is added upstream of the reverse transcription primer, so that a linker sequence is added to the 3' end of the cDNA during the reverse transcription stage. This linker sequence can be used as an alternative universal primer for subsequent antibody PCR amplification, that is, a universal primer for library construction can be designed through this linker sequence to facilitate the means of obtaining antibody sequences.
[0053] Optionally, the kit further includes one or more of reverse transcriptase, dNTP, ribonuclease inhibitor, dithiothreitol, DNA polymerase, and amplification buffer.
[0054] Another embodiment of the present invention provides the use of the primer set for amplifying the variable region gene of a monkey-derived antibody or the kit for amplifying the variable region gene of a monkey-derived antibody as described above in the preparation of a monkey-derived antibody variable region or a monkey-derived antibody.
[0055] The advantages of the application of the primer set for amplifying the variable region gene of a monkey-derived antibody in the preparation of a monkey-derived antibody variable region or a monkey-derived antibody are the same as those of the primer set for amplifying the variable region gene of a monkey-derived antibody as described above over the prior art, and will not be elaborated here.
[0056] Another embodiment of the present invention provides a method for preparing a monkey-derived antibody, comprising the following steps:
[0057] S1. Obtain a single B cell and reverse transcribe to obtain cDNA;
[0058] S2. Using the cDNA as a template, perform one-round PCR amplification with the primer set as described above to obtain an antibody variable region sequence;
[0059] S3. Construct a recombinant expression vector containing the antibody variable region sequence, the recombinant expression vector carrying an antibody constant region sequence, co-transform the recombinant expression vectors of the light chain and the heavy chain into a host cell and perform expression, and purify to obtain a monkey-derived antibody.
[0060] In step S1, the operation of reverse transcribing to obtain cDNA includes: lysing a single B cell, adding a reverse transcription primer, dNTPs, DTT, and RNase Inhibitor and incubating, and then adding an adapter primer and reverse transcriptase to perform a reverse transcription reaction to obtain double-stranded cDNA; wherein, the DNA sequence of the reverse transcription primer is as shown in SEQ ID NO.25, and the DNA sequence of the adapter primer is as shown in SEQ ID NO.26.
[0061] In step S2, the PCR amplification system is 25 μL in total, including: 4 μL of template, 1 μL of upstream primer, 1 μL of downstream primer, 1 μL of dNTPs, 12.5 μL of 2×Gloria HiFi, and 5.5 μL of pure water; wherein, the concentrations of the upstream primer and the downstream primer are 10 μM. The PCR amplification procedure includes: pre-denaturation at 98°C for 30 s, and then performing 30 cycles according to the conditions of denaturation at 98°C for 10 s, annealing at 61°C for 30 s, and extension at 72°C for 30 s, and finally holding at 72°C for 5 min.
[0062] In step S3, the operation of constructing a recombinant expression vector containing the antibody variable region sequence includes: linearizing the pBR322 vector containing the antibody constant region with a restriction endonuclease. Specifically, the pBR322 vector containing the heavy chain constant region of the antibody is linearized with the NheI restriction endonuclease, and the pBR322 vector containing the light chain constant region of the antibody is linearized with the XbaI restriction endonuclease. Then, the antibody variable region sequence is inserted upstream of the antibody constant region of the pBR322 vector through homologous recombination technology to obtain the recombinant expression vector.
[0063] Optionally, the monkey-derived antibody is a rhesus monkey antibody.
[0064] The present invention will be further described below in conjunction with specific embodiments. For the experimental methods without specific conditions indicated in the following embodiments, they are generally carried out under conventional conditions, such as the conditions described in "Molecular Cloning: A Laboratory Manual (Fourth Edition)" published by Cold Spring Harbor Laboratory, or generally according to the conditions recommended by the manufacturer.
[0065] In the following examples, the reverse transcription primer Oligo(dT)Primer, the primer TSOPrimer for adding the vector homologous arm sequence, and the primer for amplifying the antibody variable region were all synthesized by Wuhan Kingcare Biotechnology Co., Ltd.
[0066] In the following examples, the reagents used in the reverse transcription and PCR amplification reactions: dNTP was from ABclonal, product number RK20101; ribonuclease inhibitor (RNase Inhibitor) was from ABclonal, product number RM21401; 2×GloriaHiFi was from ABclonal, product number RK20717; 5×ABScript II Reverse Buffer, reverse transcriptase ABScriptII Reverse Transcriptase, and DTT were all from the ABclonal product with the product number RK21400.
[0067] Example
[0068] 1. Design of primers for amplifying the antibody variable region
[0069] The molecule of immunoglobulin (Ig) is encoded by IGK, IGL, and IGH genes. The IGK and IGL genes encode light chains, and the IGH gene encodes heavy chains. First, the gene sequences of the γ heavy chain, λ light chain, and κ light chain of all reported rhesus monkey antibodies were downloaded from the international immunogenetics database IMGT (web link: https: / / www.imgt.org). Then, based on bioinformatics sequence analysis methods, the above-obtained genes were sorted into three categories: γ, λ, and κ, and similar sequences were subjected to base degeneracy. Since the genomic cDNA sequence of a single B cell was used as a template to amplify the genes of the rhesus monkey γ heavy chain and λ and κ light chains in this example, the amount of the obtained template was very scarce. Therefore, a 5'-primer set composed of multiple upstream primers was combined with a single 3'-primer to enrich the gene sequences of the target γ heavy chain and λ and κ light chains by PCR amplification.
[0070] Specifically, the signal peptide sequences of γ, λ, and κ type antibody genes were selected as the targeting sites for the 5'-primers, ranging from 15 to 30 bp starting from ATG, and similar or closely related sequences were degenerate. Two γ heavy chain primers, two λ light chain primers, and two κ light chain primers were obtained. Then, a partial DNA sequence near the 3'-end of the adapter primer was added to the front end of the 5'-primers to form a 5'-primer set; the adapter primer sequence includes a vector homologous arm sequence and a PolyG sequence, where the vector homologous arm sequence is used for homologous recombination with the expression vector to conveniently and quickly integrate the variable region sequence obtained by subsequent PCR amplification into the expression vector; the 3'-primers respectively selected the sequences of the constant regions of the heavy and light chains, and an NheI restriction site was introduced into the γ heavy chain, and XbaI restriction sites were introduced into the λ and κ light chains, which reduced the non-specific products generated by PCR amplification. Through the aforementioned primers, it can be ensured that the heavy and light chain antibody gene fragments obtained by PCR amplification can be directly used for cloning and expression. Figure 1 The amplification process of the antibody variable region of the present invention is shown.
[0071] The variable region amplification primers designed for the γ heavy chain, λ light chain, and κ light chain in this example are shown in Table 1 below. Among them, the 5'-primer is the upstream primer, and the 3'-primer is the downstream primer. The underlined part shows the DNA sequence of the adapter primer. Taking the plasmid pBR322 as an example of the antibody gene expression vector, the DNA sequence of the adapter primer is "ATTCACCATGGG" (shown as the underlined part), the sequence of the NheI restriction site is "GCTAGC" (shown as the shaded part), and the sequence of the XbaI restriction site is "TCTAGA" (shown as the shaded part).
[0072] Table 1 Antibody variable region amplification primers
[0073]
[0074]
[0075] Note: In the primer sequence, K = G or T, R = A or G, Y = C or T.
[0076] 2. Amplification of antibody variable region gene
[0077] 2.1 Preservation of rhesus monkey single B cells
[0078] The isolated monkey single B cells were placed in a 200 μL PCR tube with 10 μL of cryopreservation solution, quickly cooled in liquid nitrogen and then rapidly transferred to an ultra-low temperature freezer at -80 °C for storage. This method can maintain the integrity of single cells and RNA for at least 2 weeks. The cryopreservation solution is 9 μL of cell cryopreservation solution (from ABclonal, catalog number RM02942) and 1 μL of Ribonuclease Inhibitor (2000 U / μL, from ABclonal, catalog number RM21401).
[0079] 2.2 Reverse transcription to obtain genomic cDNA
[0080] Using the optimized Oligo(dT)Primer as the reverse transcription primer, utilizing the terminal transferase (Template-switching, TdT) activity of reverse transcriptase, when reverse transcription proceeds to the 5' end of mRNA, a PolyC tail will be added to the 3' end of the first strand of cDNA. Then, the PolyG part of the adapter primer (TSO Primer, the sequence composition is vector homologous arm sequence + PolyG) will complementarily bind to the PolyC at the 3' end of the first strand of cDNA. Through PCR amplification, the synthesis and enrichment of double-stranded full-length cDNA are completed, and thus the adapter sequence is added to the cDNA. The arrangement order of each segment of the synthesized cDNA is: 5' adapter - signal peptide targeting sequence - variable region - constant region - 3' adapter. Then, amplifying the variable region gene with the primers shown in Table 1 of the present invention can ensure the universality of the obtained target gene for homologous recombination with the expression vector.
[0081] The DNA sequence of Oligo(dT)Primer is shown as follows:
[0082] 5'- TCTATCGATTGAATTCACC TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN-3' (see SEQ ID NO.25), V represents a non-T base (V = A, G or C), N represents a random base (N = A, T, G or C), and the underlined part is the partial sequence of the adapter primer and also the partial sequence of the vector homologous arm;
[0083] The DNA sequence of the adapter primer TSO Primer is shown as follows:
[0084] 5'- TCTATCGATTGAATTCACCAT GGG-3'(see SEQ ID NO.26), and the vector homologous arm sequences are underlined.
[0085] The reverse transcription operation includes: thawing a 10 μL cryotube containing single B cells on ice, then adding the components to the above reaction tube according to Table 2 below, reacting at 72 °C for 5 min, and then adding the components in Table 3 to the reaction product (the first strand of cDNA). Gently mix the reaction system, briefly centrifuge, and then place it in a PCR instrument for reverse transcription reaction under the following conditions: 42 °C for 1 h, 70 °C for 10 min, and hold at 4 °C to obtain double-stranded cDNA.
[0086] Table 2 Reaction system for the first strand of single B cell cDNA
[0087] Cryopreservation solution containing single B cells 10 μL Oligo(dT) Primer 2 μL dNTP (10 mM) 1 μL Dithiothreitol (DTT, 0.1 M) 1 μL RNase Inhibitor 1 μL
[0088] Table 3 Reaction system for the second strand of single B cell cDNA
[0089] First strand cDNA 15 μL TSO Primer 1 μL 5×ABScript II Reverse Buffer 5 μL ABScript II Reverse Transcriptase (200 U / μL) 1 μL Nuclease free Water 3 μL Total Volume 25 μL
[0090] 2.3, Amplification of antibody variable region genes and primer optimization
[0091] Using the above cDNA product as a template, the variable region gene fragments of the γ heavy chain, κ and λ light chains were amplified in three reaction systems respectively by one-time PCR using the first group and the second group of primers in Table 1. The reaction system includes: 4 μL of cDNA product (template), 1 μL of a 5'-primer set with a final concentration of 10 μM after mixing, 1 μL of dNTPs (10 mM), 1 μL of a 3'-primer with a final concentration of 10 μM, 12.5 μL of 2×Gloria HiFi, and 5.5 μL of pure water (Nuclease free Water); The PCR amplification program includes: pre-denaturation at 98 °C for 30 s, and then 30 cycles were carried out under the conditions of denaturation at 98 °C for 10 s, annealing at 61 °C for 30 s, and extension at 72 °C for 30 s. Finally, hold at 72 °C for 5 min, and the obtained reaction solution was stored at 4 °C.
[0092] The products amplified by the first group and the second group of primers were detected by 1% agarose electrophoresis. Figures 2 - 4The electrophoresis diagrams of the variable regions of the γ heavy chain, λ light chain, and κ light chain of single B cells of the first set of primers and the second set of primers are shown respectively. Among them, the middle lane is the Marker, and the lanes A1 - A24 represent different B cell clones. Igγ, Igλ, and Igκ represent the variable region genes of the γ heavy chain, λ light chain, and κ light chain in sequence. It can be seen from the figure that when using the primer set of the second group for amplification, the target bands were only amplified in single B cells A4, A12, A15, A17 - A19, A22, and A23 in the variable region of the γ heavy chain, and the amplification success rate was low. Moreover, there were faint target bands and many non-specific bands in multiple single B cells. Similar results were presented in the variable regions of the λ light chain and κ light chain. It is considered that the reason may be that the number of primers in the primer set is large, and there is non-specific binding during the amplification process, resulting in some single B cell clones being unable to obtain the correct target bands. Considering this situation, the usage frequency of antibody sequences was analyzed in the IMGT database, and the number of primers and length of this primer set were optimized and further degenerate, and then the amplification sequences of each antibody variable region were determined. Specifically, for the 5' primer set of IGH, the usage frequency of the antibody sequence encoded by primer SEQ ID NO.12 was lower than that of SEQ ID NO.10 and SEQ ID NO.11, and the sequences SEQ ID NO.10 and / or SEQ ID NO.11 specifically amplified by SEQ ID NO.12 could also be amplified; in addition, too many types of specific primers mixed during amplification may also interfere with the specific binding of primers and target sequences, thereby resulting in the appearance of amplification efficiency and non-specific bands. Considering comprehensively that the 5' primer length and annealing temperature of IGH need to be the same or similar to those of the 3' primer, the 5' primer length of IGH was adjusted (finally, the bases at the 3' end of the sequence were deleted), and the 5' primer set of IGH composed of SEQ ID NO.1 and SEQ ID NO.2 was obtained; the optimization principle of the 5' primer sets of IGK and IGL was the same as that of IGH, and finally, the optimized first set of primers was formed.
[0093] After counting the number of single B cells in the successfully amplified variable regions of γ heavy chain, κ and λ light chains, using the second set of primers, the amplification success rate of the γ heavy chain variable region was 33.3% (8 / 24), and the amplification success rate of the κ light chain variable region was 29.1% (7 / 24). While using the optimized first set of primers, the amplification success rate of the γ heavy chain variable region was 83.3% (20 / 24), and the amplification success rate of the κ light chain variable region was 75% (18 / 24). Since the κ type of rabbit light chain antibody accounts for the vast majority (more than 95%), the clones (A5, A8, A9, A13, A15, A21) that did not amplify the κ subtype after optimization can be regarded as λ light chain subtypes. Before optimization, the amplification success rate of the λ light chain variable region was 33.3% (2 / 6), and after optimization, the amplification success rate of the λ light chain variable region was 83.3% (5 / 6). Generally, the pairing ratio of heavy and light chains of the second set of primers (A4, A12) was 8.3% (2 / 24), while the pairing ratio of heavy and light chains of the first set of primers could be increased to 83.3% (20 / 24). It can be seen that using the optimized first set of primer sequences for amplification greatly improves the amplification success rate of variable region genes, with basically no non-specific amplification, that is, the amplification efficiency is significantly improved. In addition, the natural pairing success rate of heavy and light chain genes of antibodies is high, which is conducive to greatly improving the preparation efficiency of monoclonal antibodies. Moreover, high-concentration variable region genes can be obtained through only one PCR. After gel recovery and elution with 25 μL ddH2O, the measured average concentration can reach 30 ng / μL, which is conducive to improving the success rate of subsequent homologous recombination and expression, and also conducive to greatly simplifying the process of obtaining variable region genes and shortening the experimental time.
[0094] 3. Antibody variable region gene expression
[0095] 3.1 Construction of recombinant expression vector
[0096] First, the sequences of the rhesus macaque heavy chain constant region and light chain constant region in the IMGT database were synthesized by gene synthesis and then inserted into the expression vector pBR322. Then, the heavy chain and light chain variable region genes of the rhesus macaque monoclonal antibody obtained by amplification were respectively loaded on the expression vector pBR322 carrying the corresponding constant region sequences. The map of the mammalian expression vector pBR322 pre-carried with the light chain constant region (CL) and heavy chain constant region (CH) encoding genes used is shown in Figure 5, In the figure, pBR322 origin and f1 origin are replication promoters in Escherichia coli (E.Coli), Ampcillin is a plasmid resistance gene, CMV immearly promotor is a promoter in eukaryotes, SV40 PA terminator is a polyadenylation signal, Light chain constant is the nucleic acid sequence of the light chain constant region (Figure a), and Heavy chain constant is the nucleic acid sequence of the heavy chain constant region (Figure b).
[0097] The gene sequences of the γ heavy chain constant region, κ light chain constant region, and λ light chain constant region used in this example for illustration are shown in Table 4.
[0098] Table 4 Antibody light chain constant region sequences
[0099]
[0100] The vector construction specifically includes: The mammalian expression plasmids containing the rhesus monkey CH and CL sequences are respectively linearized by conventional treatment with NheI and XbaI restriction endonucleases, and the amplified variable region PCR products are respectively ligated to the corresponding expression vectors by homologous recombination and verified by sequencing (the sequencing work is completed by Wuhan Kingcare Biotechnology Co., Ltd.).
[0101] 3.2, Recombinant expression vector construction
[0102] The successfully constructed expression vectors containing the antibody heavy chain and light chain genes are co-transfected into 293F cells; after transfection, the cells are cultured for 72 - 96 h, and the supernatant containing the monoclonal antibody is obtained. The monoclonal antibody is purified from the culture supernatant using protein A affinity gel resin. The specific steps of the affinity chromatography operation are as follows: (1) Transfer the culture supernatant to a sterile 50 mL centrifuge tube, centrifuge at 1000 g and 4 °C (or room temperature) for 10 min, and collect the supernatant; (2) Add the pretreated Protein A Agarose suspension to the centrifuged cell supernatant, and incubate with shaking for 3 - 4 h (room temperature) or overnight at 4 °C; (3) After incubation, centrifuge at 1000 g for 10 min, transfer the Protein A Agarose suspension to an adsorption column, and centrifuge at room temperature for 1 min using a hand-held centrifuge to separate the solid and liquid phases, and collect the flow-through; (4) Add a washing buffer with a volume 10 times that of Protein A Agarose and resuspend the particles, centrifuge the centrifuge, collect the washing solution, and repeat the washing twice; (5) Add the elution buffer to the adsorption column, centrifuge with a centrifuge to obtain the antibody supernatant, place the antibody supernatant in a dialysis bag, dialyze overnight, and obtain the purified rhesus monkey monoclonal antibody. Use 12% SDS-PAGE gel electrophoresis to verify the antibody purity, and the electrophoresis gel pattern is shown in Figure 6, where Marker represents a molecular marker, BSA represents bovine serum albumin, and A1 - A8 represent IgG antibody strains, which are obtained by pairing the 6 κ light chain and 2 λ light chain variable region genes cloned from single B cells A1 - A8 with the γ heavy chain variable region respectively. Figures 2 - 4 The 6 κ light chain and 2 λ light chain variable region genes cloned from single B cells A1 - A8 are paired with the γ heavy chain variable region respectively.
[0103] Clear rhesus monoclonal antibody bands can be seen from the figure. The antibody purity > 90%, and the measured concentration is about 1 mg / mL. After aliquoting, it is stored at -20 °C for future use.
[0104] 4. Enzyme - linked immunosorbent assay (ELISA) detection of rhesus IgG antibody
[0105] The purified rhesus monoclonal antibody is subjected to IgG detection. The specific experimental steps are as follows:
[0106] (1) Coating: The purified rhesus monoclonal antibody in step 5 is serially diluted with 1×PBS buffer (0.05 M, pH 9.6) to different concentrations of 0.5 μg / mL, 0.16 μg / mL, 0.05 μg / mL, and 0.018 μg / mL. Then, 100 μL / well of the above - mentioned different - concentration antibodies are added to a 96 - well ELISA plate in sequence. Cover the plate with a cover - plate membrane, incubate at 37 °C for 2 h, or incubate in a 4 °C refrigerator for 16 - 20 h. After that, discard the solution in the wells, and wash 3 times with washing buffer (1×PBST, the same below), 3 min each time;
[0107] (2) Blocking: Add 200 μL of blocking solution (0.05 M phosphate - buffered saline containing 5% bovine serum albumin and 0.05% Tween - 20, pH 7.2). After blocking is completed, discard the blocking solution and pat the ELISA plate dry, then dry it in a 37 °C oven for 0.5 - 2 h, and take it out for standby;
[0108] (3) Primary antibody incubation: Add 100 μL of Goat Anti - Human IgG (purchased from Jackson, catalog number 109 - 005 - 098) to the above - mentioned 96 - well ELISA plate, and incubate at 37 °C for 1 - 2 h;
[0109] (4) Plate washing: Discard the liquid in the wells of the above - mentioned microplate, wash the plate three times with 1×PBST, add 300 μL of washing solution each time, let it stand for 40 s, then discard the liquid in the wells, and pat the liquid in the wells dry on a flat paper;
[0110] (5) Secondary antibody incubation: Dilute Goat Anti - Human IgG HRP (purchased from Jackson, catalog number 109 - 035 - 088) 100 - fold and then add 100 μL / well to the ELISA plate in sequence. Cover the plate with a cover - plate membrane and incubate at 37 °C for 0.5 h;
[0111] (6) Plate washing: After incubation, discard the liquid in the wells, wash the plate three times with 1×PBST, add 300 μL of sample, let it stand for 40 s, then discard the liquid in the wells, and pat dry the liquid in the wells on filter paper;
[0112] (7) Color development: Add TMB color development solution to the enzyme-linked immunosorbent assay (ELISA) plate at 100 μL / well in sequence, cover with a cover film, and incubate at 37 °C for 15 min;
[0113] (8) Termination: After incubation, take out the ELISA plate, add 50 μL of termination solution to each well, immediately read the absorbance at 450 nm using an ELISA reader, and use the OD 450nm minus OD 630nm value corrected by the background absorbance at this wavelength to detect the absorbance values of the rhesus monkey monoclonal antibody at different concentrations, as shown in Figure 7 .
[0114] As can be seen from the figure, after the expression of the antibody variable region amplified by PCR in the present invention, it can be seen that the secondary antibody against goat anti-human IgG (the rhesus monkey and human antibody sequences are highly homologous and can be recognized together) can recognize the antibody to be detected, indicating that the amplified antibody sequence is a rhesus monkey antibody, the amplification efficiency of the antibody variable region sequence is high, and the titer of the recombinant rhesus monkey antibody is high.
[0115] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent replacements, and improvements made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.
Claims
1. A primer set for amplifying the variable region gene of a monkey-derived antibody, characterized in that, Comprising one or more of the following (1)-(3): (1) A primer pair for amplifying the variable region of the gamma heavy chain, wherein the DNA sequences of the upstream primers are respectively "ATGGACTKGACCTGGA" and / or "ATGGAGTTKGKGCTGAGCTG", and the DNA sequence of the downstream primer is "GATGGGCCCTTGGTGCTAGCTGAGGA"; (2) A primer pair for amplifying the variable region of the kappa light chain, wherein the DNA sequences of the upstream primers are respectively "ATGGCCATGAGGGCTTCAGCTCA" and / or "ATGGAARCCCCAGCACAGCTT", and the DNA sequence of the downstream primer is "CCACCTTCCACTTTACGCTAGCCTCTCTGGGATA"; (3) A primer pair for amplifying the variable region of the lambda light chain, wherein the DNA sequences of the upstream primers are respectively "ATGGCCTGGTCTCTCCTTCTCACTCT" and / or "ATGGCCKGGACCTCTCTCC", and the DNA sequence of the downstream primer is "CTCCTCATCTAGAGGTGGGAACAGAGTG"; wherein, K is selected from one of G or T, and R is selected from one of A or G.
2. The primer set for amplifying the variable region gene of the monkey-derived antibody according to claim 1, characterized in that, The 5' end of the upstream primers for amplifying the variable region of the gamma heavy chain, for amplifying the variable region of the lambda light chain, and for amplifying the variable region of the kappa light chain further comprises a linker sequence, which consists of a vector homologous arm and PolyG, and the DNA sequence of the linker sequence is "ATTCACCATGGG".
3. The primer set for amplifying the variable region gene of a monkey-derived antibody according to claim 2, wherein The DNA sequences of the primer sets comprising the linker sequence are as shown in SEQ ID NO.1-9.
4. A kit for amplifying the variable region gene of a monkey-derived antibody, characterized in that, The kit comprises a primer set for amplifying the variable region gene of the monkey-derived antibody as described in any one of claims 1-3.
5. The kit for amplifying the variable region gene of a monkey-derived antibody according to claim 4, characterized in that, The kit further comprises a linker primer and a reverse transcription primer, the DNA sequence of the linker primer is "TCTATCGATTGAATTCACCATGGG", and the DNA sequence of the reverse transcription primer is "TCTATCGATTGAATTCACCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN", wherein, V is selected from one of A, G or C, and N is selected from one of A, T, G or C.
6. The kit for amplifying the variable region gene of the monkey-derived antibody according to claim 4, characterized in that, The kit further comprises one or more of reverse transcriptase, dNTP, ribonuclease inhibitor, dithiothreitol, DNA polymerase and amplification buffer.
7. A method for preparing a monkey-derived antibody, characterized in that, Comprising the following steps: S1. Obtain a single B cell and reverse transcribe to obtain cDNA; S2. Using the cDNA as a template, perform one-time PCR amplification with the primer set for amplifying the variable region gene of the monkey-derived antibody as described in any one of claims 1-3 to obtain the antibody variable region sequence; S3. Construct a recombinant expression vector comprising the antibody variable region sequence, the recombinant expression vector carries the antibody constant region sequence, co-transform the recombinant expression vectors of the light chain and the heavy chain into a host cell and perform expression, and purify to obtain the monkey-derived antibody.
8. The preparation method of the monkey-derived antibody according to claim 7, wherein In step S1, the operation of reverse transcribing to obtain cDNA comprises: Lyse a single B cell, incubate it with a reverse transcription primer, dNTPs, dithiothreitol, and ribonuclease inhibitor, and then add an adapter primer and reverse transcriptase to perform a reverse transcription reaction to obtain double-stranded cDNA; wherein, the DNA sequence of the adapter primer is "TCTATCGATTGAATTCACCATGGG", and the DNA sequence of the reverse transcription primer is "TCTATCGATTGAATTCACCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN", where V is selected from one of A, G, or C, and N is selected from one of A, T, G, or C.
9. The preparation method of the monkey-derived antibody according to claim 7, wherein In step S2, taking the PCR amplification system as 25 μL, it includes: 4 μL of template, 1 μL of upstream primer, 1 μL of downstream primer, 1 μL of dNTPs, 12.5 μL of 2×Gloria HiFi, and 5.5 μL of pure water; wherein, the concentrations of the upstream primer and the downstream primer are 10 μM; The PCR amplification program includes: pre-denaturation at 98°C for 30 s, and then perform 30 cycles according to the conditions of denaturation at 98°C for 10 s, annealing at 61°C for 30 s, and extension at 72°C for 30 s, and finally hold at 72°C for 5 min.
10. According to the method for preparing a monkey-derived antibody according to claim 7, in step S3, the operation of constructing a recombinant expression vector containing the antibody variable region sequence includes: Linearize the pBR322 vector containing the antibody constant region with a restriction endonuclease. Among them, linearize the pBR322 vector containing the heavy chain constant region of the antibody with the NheI restriction endonuclease, and linearize the pBR322 vector containing the light chain constant region of the antibody with the XbaI restriction endonuclease. Then, insert the antibody variable region sequence upstream of the antibody constant region of the pBR322 vector through homologous recombination technology to obtain the recombinant expression vector.