Gene combination related to wheat powdery mildew resistance, molecular marker and application

Abstract

The invention relates to a gene combination related to wheat powdery mildew resistance, a molecular marker and application, and belongs to the field of gene engineering. The gene combination capable of resisting the wheat powdery mildew comprises a TRI1796-NLR1 gene (the accession number of GenBank is PQ655406) and a TRI1796-NLR2 gene (the accession number of GenBank is PQ655412), and the TRI1796-NLR1 gene and the TRI1796-NLR2 gene are used for resisting the wheat powdery mildew. The molecular marker disclosed by the invention is named as XPm68, and amplification primers of the molecular marker are as shown in SEQ ID No: 1 and SEQ ID No: 2; according to the application disclosed by the invention, firstly, two nucleotide-combined leucine repeat receptor (NLR)-rich genes cloned to a Pm68 site are cloned, and experiments prove that wheat powdery mildew resistance can be endowed by combined use of the two genes; the invention further develops a corresponding diagnostic molecular marker XPm68, and provides an important gene resource and a practical molecular marker for cultivating a new variety of powdery mildew resistant wheat.

Description

Technical Field

[0001] The present invention relates to a gene combination, molecular marker and application related to wheat powdery mildew resistance, and belongs to the field of genetic engineering. Background Art

[0002] Wheat (Triticum aestivum L., 2n = 6x = 42, AABBDD) is the most widely distributed and highest-yielding cultivated cereal crop in the world, feeding 35 - 40% of the world's population. Powdery mildew caused by Blumeria graminis f. sp. tritici is one of the devastating leaf diseases in wheat production, generally reducing production by 10 - 15%, and in severe cases, it can reduce production by 50%. At present, cultivating and planting new wheat varieties resistant to powdery mildew is recognized as the most economical, effective and environmentally friendly method for controlling wheat powdery mildew. Common wheat and its related plants are important sources of these disease-resistant genes. For example, Pm12 from Aegilops speltoides, Pm21 from Dasypyrum villosum, Pm41 from wild emmer wheat, etc. However, while exogenous chromosome arms carry excellent genes, they often carry some unfavorable genes, known as linkage drag, which makes these disease-resistant genes unable to be directly used in research and breeding. At the same time, the variability of Blumeria graminis f. sp. tritici is strong, and new physiological races will continuously emerge. These new physiological races are very likely to render the original disease-resistant genes ineffective, resulting in the loss of resistance or degradation of resistance in the corresponding disease-resistant varieties. Currently, genes such as Pm1, Pm2, Pm3, Pm4a, Pm4b, Pm5, Pm6, Pm7, Pm8, etc. have basically lost their resistance. Therefore, the use of other effective powdery mildew-resistant genes is of great significance for effectively controlling the damage of powdery mildew. Summary of the Invention

[0003] The purpose of the present invention is to overcome some problems existing in the prior art. In particular, aiming at the problem of the lack of existing resistance genes, the present invention provides a gene combination, molecular marker and application related to wheat powdery mildew resistance. Specifically, the present invention constructs a mapping population by using the powdery mildew-resistant durum wheat germplasm TRI 1796 and the powdery mildew-susceptible durum wheat germplasm PI 584832, and clones and confirms the functions of two genes, TRI1796-NLR1 (GenBank accession number: PQ655406) and TRI1796-NLR2 (GenBank accession number: PQ655412), in the powdery mildew-resistant locus Pm68 through methods such as fine genetic mapping, third-generation genome sequencing, and transgenic verification, and develops the corresponding diagnostic molecular marker XPm68, providing important gene resources and practical molecular markers for cultivating new wheat varieties resistant to powdery mildew.

[0004] To achieve the above technical objectives, the technical solutions adopted by the present invention are as follows:

[0005] The present invention first provides a gene combination related to wheat powdery mildew resistance, the gene combination includes TRI1796-NLR1 gene and TRI1796-NLR2 gene, the GenBank accession number of the TRI1796-NLR1 gene is PQ655406; the GenBank accession number of the TRI1796-NLR2 gene is PQ655412.

[0006] The present invention also provides a molecular marker related to wheat powdery mildew resistance, the molecular marker is XPm68, the molecular marker is used for specifically detecting the gene combination, and the primers for specifically amplifying this molecular marker include the upstream primer shown in SEQ ID No: 1 and the downstream primer shown in SEQ ID No: 2.

[0007] The present invention also provides a primer pair for amplifying the molecular marker, the primer pair includes the upstream primer shown in SEQ ID No: 1 and the downstream primer shown in SEQ ID No: 2.

[0008] The present invention also provides a product for detecting wheat powdery mildew resistance, the product includes the primers described above.

[0009] The present invention also provides the application of the gene combination, or the molecular marker, or the primer, or the product in screening or identifying crop powdery mildew resistance, and / or powdery mildew-resistant wheat breeding or assistant breeding, or wheat powdery mildew resistance detection

[0010] Among them, the application includes:

[0011] Using the primer pair to perform PCR amplification on the material to be tested, detecting the amplification product, if a specific target product is obtained, the material to be tested carries the gene related to wheat powdery mildew resistance, and the material to be tested is resistant to powdery mildew.

[0012] The present invention also provides a method for detecting or assisting in detecting wheat powdery mildew resistance, the method includes: using the primer to perform PCR amplification on the material to be tested, detecting the amplification product, if a specific target product is obtained, the material to be tested carries the gene related to wheat powdery mildew resistance, and the material to be tested is resistant to powdery mildew.

[0013] Further, the PCR reaction system used in the PCR amplification program includes: in a 25 μL reaction system, it includes: 50 ng template DNA, 1×PCR buffer, 1.5 mM MgCl2, 200 mM dNTP, the final concentration of each of the two primers is 0.2 μM, 1 U Taq DNA polymerase, and the reaction system is supplemented to 25 μL with sterile distilled water.

[0014] The reaction procedure of the PCR amplification includes: pre-denaturation at 94°C for 3 minutes; denaturation at 94°C for 20 seconds, annealing at 55°C - 60°C for 30 seconds, extension at 72°C for 60 seconds, for 35 cycles; extension at 72°C for 5 minutes; preservation at 4°C.

[0015] The size of the specific target product is 251 bp.

[0016] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0017] (1) The combined powdery mildew resistance function of the two NLR genes (TRI1796-NLR1 and TRI1796-NLR2) in the powdery mildew resistance locus Pm68 derived from durum wheat provided by the present invention is reported for the first time at home and abroad; it has been experimentally verified in the present invention that a transgenic line carrying only one of TRI1796-NLR1 and TRI1796-NLR2 does not have the ability to resist powdery mildew, and only when the transgenic line includes both TRI1796-NLR1 and TRI1796-NLR2 genes at the same time can it have the ability to resist powdery mildew.

[0018] (2) The present invention constructs a mapping population using powdery mildew-resistant and -susceptible durum wheat, and clones two NLR genes in the powdery mildew resistance locus Pm68 from the powdery mildew-resistant durum wheat TRI1796 line by combining strategies of fine genetic mapping, association analysis of the durum wheat natural population, and comparative genomics analysis. Transgenic function analysis confirms that the Pm68 resistance is controlled by these two NLR genes, namely TRI1796-NLR1 (GenBank accession number PQ655406) and TRI1796-NLR2 (GenBank accession number PQ655412). Transgenic wheat carrying only TRI1796-NLR1 or TRI1796-NLR2 is susceptible to powdery mildew, while wheat carrying both genes has good powdery mildew resistance.

[0019] (3) According to the DNA sequence of the Pm68 locus, the present invention also develops a molecular marker XPm68, which has no background interference in different wheats and can be applied to molecular marker-assisted breeding of the Pm68 locus. The molecular marker has application value in screening or identifying the powdery mildew resistance of crops, or in the breeding or assisted breeding of powdery mildew-resistant wheat. Description of the Drawings

[0020] Figure 1 It is a schematic diagram of the Pm68 locus map; wherein, Figure 1 a is the genetic map of the Pm68 locus in durum wheat TRI 1796; Figure 1b shows the results of the association analysis of genotypes and phenotypes of durum wheat resistant and susceptible to powdery mildew using molecular markers, where n is the number of durum wheat germplasms of the same type of genotype (in the figure, n = 6, 1, 8, 10, 1, 8, 1, 5, 1, or 41); Figure 1 c shows the results of the comparative analysis of the genomic structures of durum wheat TRI 1796 containing Pm68, durum wheat Svevo, and wild emmer wheat Zavitan; Figure 1 d shows the results of the genes transcribed at the Pm68 locus determined by the transcriptome of durum wheat TRI 1796.

[0021] Figure 2 are the detection results of each gene in the Pm68 locus; among them, Figure 2 a shows the results of detecting the susceptible parent PI 584832 (sample 1) and the resistant parent TRI 1796 (sample 2) using five molecular markers developed based on the genes of durum wheat Svevo; Figure 2 b shows the results of detecting the susceptible parent PI 584832 (sample 1) and the resistant parent TRI 1796 (sample 2) using three molecular markers developed based on the genes of wild emmer wheat Zavitan; Figure 2 c shows the results of dot plot analysis using the genomic data of durum wheat TRI 1796, durum wheat Svevo, and wild emmer wheat Zavitan, indicating that the Pm68 interval of TRI 1796 is highly similar to that of wild emmer wheat Zavitan, but different from that of durum wheat Svevo.

[0022] Figure 3 are the results of the transgenic function analysis of TRI1796-NLR1 at the Pm68 locus; this figure shows that the transgenic wheat with only TRI1796-NLR1 is highly susceptible to powdery mildew at the seedling and adult stages; in the figure, "+" and "-" indicate whether it contains transgenic components, "+" indicates containing transgenic components, and "-" indicates not containing transgenic components.

[0023] Figure 4 are the results of the transgenic function analysis of TRI1796-NLR2 at the Pm68 locus; this figure shows that the transgenic wheat with only TRI1796-NLR2 is highly susceptible to powdery mildew at the seedling and adult stages; in the figure, "+" and "-" indicate whether it contains transgenic components, "+" indicates containing transgenic components, and "-" indicates not containing transgenic components.

[0024] Figure 5Results of transgenic function analysis of TRI1796-NLR1 and TRI1796-NLR2 at the Pm68 locus; this figure shows that transgenic wheat carrying both TRI1796-NLR1 and TRI1796-NLR2 is resistant to powdery mildew at the seedling and adult stages; in the figure, "+" and "-" indicate whether there is a transgenic component, "+" indicates the presence of a transgenic component, and "-" indicates the absence of a transgenic component.

[0025] Figure 6 Results of detecting different wheat varieties with the molecular marker XPm68; "M" in the figure is the DNA molecular weight marker DL2000; the wheat varieties in lanes 1-20 are: Jimai 19, Yumai 34, Lumai 14, Yangmai 158, Yumai 18, Shixin 828, Tainong 18, Shannong 17, Shannong 21, Wennong 14, Shi 4185, Shimai 15, Shimai 18, Xuzhou 438, Gao 8901, Ji 5265, Henong 827, Kenong 9204, Han 7086, Jishi 02-1; lane 21 is the TRI 1796 positive control containing Pm68, and the specific product is indicated by the arrow. Detailed implementation mode

[0026] In order to enable those skilled in the art to better understand the technical solution of the present invention, the preferred embodiments of the present invention are described in detail below, but the following embodiments do not limit the protection scope of the present invention.

[0027] In the embodiments of the present invention, those not described in detail are all completed by conventional experimental methods. The processes involved in the embodiments are understandable and easy to implement by those skilled in the art according to the product specifications or basic knowledge in the art. The reagents, materials, etc. involved are not specially described and are all obtained through commercial channels.

[0028] Example 1: Fine mapping of the powdery mildew resistance locus Pm68 from Triticum durum

[0029] The present invention constructed an F2 mapping population containing 1382 individual plants using the powdery mildew-resistant Triticum durum TRI 1796 (a well-known and publicly available material, sourced from the German germplasm resource library: https: / / gbis.ipk-gatersleben.de / gbis2i) and the powdery mildew-susceptible Triticum durum PI 584832 (a well-known and publicly available material, sourced from the US germplasm resource library: https: / / npgsweb.ars-grin.gov / gringlobal / search).

[0030] Using the previously reported Pm68 locus information (He et al. Characterization of Pm68, a new powdery mildew resistance gene on chromosome 2BS of Greek durum wheat TRI1796. Theoretical and Applied Genetics. 2021, 134: 53 - 62), first, 41 recombinants were screened from the above 1382 individual plants using the publicly available molecular markers Xdw03 and Xdw15 flanking Pm68, and then the 41 recombinants were genotyped using another 9 publicly available co - dominant molecular markers (Table 1).

[0031] Table 1. Molecular markers used for genetic mapping of the Pm68 locus

[0032]

[0033] The PCR reaction system was 25 μL, and the reaction mixture contained 1×PCR buffer, 0.2 mM each of dNTP (including dATP, dTTP, dGTP, and dCTP), 2 mM each of each primer, 50 ng of genomic DNA from each individual plant (extracted using a conventional DNA extraction kit and obtained through regular purchase), and 1 U Taq DNA polymerase.

[0034] The PCR amplification conditions were: 94 °C for 3 minutes; 94 °C for 10 seconds, 60 °C for 30 seconds, 72 °C for 1 minute, for 35 cycles; 72 °C for 5 minutes.

[0035] The PCR amplification was carried out on a T100 thermal cycler (Bio - Rad, USA). After the PCR products were electrophoresed on an 8% non - denaturing polyacrylamide gel, they were stained with silver nitrate solution. After the DNA bands appeared, they were photographed, and the DNA band patterns in the gel were counted.

[0036] The results were as Figure 1 shown in a. After the above - mentioned PCR operation, Pm68 was mapped to a 0.21 cM genetic interval (the red - marked area in the figure), which is located between the molecular markers Xdw06 and Xdw09. Among them, the three molecular markers Xdw07, Xdw08, and Xdw08.9 co - segregated with the Pm68 resistance, that is, Xdw07, Xdw08, and Xdw08.9 are the linked markers of the Pm68 gene.

[0037] Using Figure 1The molecular markers Xdw05-Xdw10 shown in b were used to genotype 85 susceptible durum wheat germplasms and 6 resistant durum wheat germplasms (publicly available materials, sourced from the German germplasm repository: https: / / gbis.ipk-gatersleben.de / gbis2i and the US germplasm repository: https: / / npgsweb.ars-grin.gov / gringlobal / search). It was found that the Pm68-linked marker Xdw08.9 was completely correlated with the resistance phenotype, while the other markers were not fully correlated with the resistance ( Figure 1 b). Therefore, combined with Figure 1 the results of the genetic map shown in a, the Pm68 locus was narrowed down to between the molecular markers Xdw08 and Xdw09.

[0038] Example 2: Comparative genomics analysis of durum wheat and wild emmer wheat

[0039] The annotated genes corresponding to the molecular markers in Table 2 were retrieved from the reference genome of the durum wheat variety Svevo (http: / / 202.194.139.32) and the reference genome of the wild emmer wheat variety Zavitan (http: / / 202.194.139.32) and used for the comparative analysis of the Pm68 locus. The genomic structures of the two parents, TRI 1796 and PI 584832, were analyzed based on the molecular markers:

[0040] In the reference genome of the durum wheat variety Svevo, five molecular markers (Xdw08.1-Xdw08.5) were developed using Primer Premier 5 software (Table 2). The correspondence between the molecular markers and the genes is shown in Figure 1 c. The two parents, TRI 1796 and PI 584832, were detected. The PCR reaction system and amplification conditions were the same as in Example 1. The results are as shown in Figure 2 a. The results in the figure show that specific amplification occurred only in the susceptible parent PI 584832 (sample 1) for each marker, while no amplification product was observed in the resistant parent TRI 1796 (sample 2) carrying Pm68. This indicates significant differences in genes between the Pm68 donor TRI 1796 and Svevo. Subsequently, three molecular markers (Xdw08.6-Xdw08.8) were developed based on the genes of the wild emmer wheat Zavitan genome (Table 2). The correspondence between the molecular markers and the genes is shown in Figure 1 c, and they had amplification products in TRI 1796 (sample 2) but no amplification products in PI 584832 (sample 1) ( Figure 2b). These results indicate that Pm68 found in durum wheat TRI 1796 originated from its ancestral species, wild emmer wheat.

[0041] Table 2. Molecular markers between Xdw08 and Xdw09

[0042]

[0043] Example 3: Cloning and transgenic analysis of disease-resistant genes in the powdery mildew-resistant locus Pm68 of durum wheat

[0044] The genome of the disease-resistant durum wheat TRI 1796 containing Pm68 was sequenced using the PacBio CCS platform, obtaining 5,571,107 HiFi reads, containing approximately 98 Gb of genomic sequence data (Sequence Read Archive database accession number: SRR31057414), which is 9.4-fold coverage of the durum wheat Svevo genome (10.45 Gb) and 9.7-fold coverage of the wild emmer wheat Zavitan genome (10.1 Gb). Dot plot analysis showed that the Pm68 interval of TRI 1796 was highly similar to that of wild emmer wheat Zavitan, but different from durum wheat Svevo ( Figure 2 c). The 305 kb TRI1716 interval flanking Xdw08 and Xdw09 corresponded to a 297 kb region of the Zavitan genome, and 9 annotated genes from the Zavitan interval also corresponded to 9 alleles from TRI 1796 ( Figure 1 d).

[0045] To identify the disease-resistant genes of Pm68, in this example, RNA sequencing was performed on the leaf tissues of TRI 1796 infected with BgtYZ01 (Sequence Read Archive database accession number: SRR31534046), and the sequences were aligned to the assembled TRI1796 genome (Sequence Read Archive database accession number: SRR31057414). It was found that the read mapping depths of 4 genes were relatively high, corresponding to the genes of wild emmer wheat Zavitan: both TRIDC2BG003970 and TRIDC2BG003990 encode nucleotide-binding leucine-rich repeat immune receptors (NLRs), containing CC, NBS, and LRR domains, and may be related to disease resistance ( Figure 1 d).

[0046] Given that NLR genes are often associated with disease resistance, the TRI 1796 gene corresponding to TRIDC2BG003970 and TRIDC2BG003990 in Zavitan is the best candidate gene for Pm68, which was named TRI1796-NLR1 and TRI1796-NLR2. According to the TRI 1796 genomic data, the gene sequences of TRI1796-NLR1 (GenBank accession number: PQ655406) and TRI1796-NLR2 (GenBank accession number: PQ655412) can be obtained.

[0047] Based on the obtained gene sequences of TRI1796-NLR1 (GenBank accession number: PQ655406) and TRI1796-NLR2 (GenBank accession number: PQ655412) in the TRI 1796 genome, two pairs of specific primers, P1 and P2, P3 and P4 (Table 3), were designed. Among them, P1 and P2 amplified the full-length coding region of TRI1796-NLR1, and P3 and P4 amplified the full-length coding region of TRI1796-NLR2. High-fidelity PrimeSTAR Max Premix (TaKaRa) was used for PCR amplification, and the PCR program was the same as in Example 1 to obtain the TRI1796-NLR1 gene and the TRI1796-NLR2 gene. After gel recovery, these two genes were digested with SmaI and SpeI and ligated at 16°C for 8 h under the action of T4 DNA ligase into the vector pLGY02 (provided by Shandong Academy of Agricultural Sciences, well-known and publicly available) that had been digested with the same two enzymes, respectively obtaining the vectors pLGY02-TRI1796-NLR1 and pLGY02-TRI1796-NLR2.

[0048] The recombinant vector pLGY02-TRI1796-NLR1 was sequenced using the sequencing primers P5-P8 (Table 3) designed according to the TRI1796-NLR1 (GenBank accession number: PQ655406) gene sequence, and it was determined that the sequence was completely consistent with the sequence of the TRI1796-NLR1 gene (GenBank accession number: PQ655406). The recombinant vector pLGY02-TRI1796-NLR2 was sequenced using the sequencing primers P9-P13 (Table 3) designed according to the TRI1796-NLR2 (GenBank accession number: PQ655412) gene sequence, and it was determined that the sequence was completely consistent with the sequence of the TRI1796-NLR2 gene (GenBank accession number: PQ655412), indicating that the recombinant vectors were successfully constructed.

[0049] Table 3. Gene cloning and sequencing primers

[0050] Name Primer sequences (F is the forward primer, R is the reverse primer) P1 TTTCCCGGGAACTAATGGCGGAAATTGTGATTC (SEQ ID No:41) P2 GGGACTAGTAGTGGAGGTAGCAGCAAACGGT (SEQ ID No:42) P3 TTTCCCGGGATGAAGTCCATGGAGGAAGCA (SEQ ID No:43) P4 GGGACTAGTCACTGAATCAACACACTAGGGTT (SEQ ID No:44) P5 GAACACTGGCGTTATCCCTGGA (SEQ ID No:45) P6 GCTTGGAATGGGAGGGCTTG (SEQ ID No:46) P7 GCAGAGGGGTTCATCGAGGA (SEQ ID No:47) P8 GGAAGCACAGGATGGGTCTG (SEQ ID No:48) P9 GCATCACTGAACACCATCTGAG (SEQ ID No:49) P10 GGATGCCTGATTCAAGCAGG (SEQ ID No:50) P11 CCTGTACACCTCAAGCGATGC (SEQ ID No:51) P12 TTGAGAAGAGGGAAGGGCAT (SEQ ID No:52) P13 GCATGTAGAGACTGTTGTAGC (SEQ ID No:53) P14 CGCAAGACCGGCAACAGGATTCA (SEQ ID No:54)

[0051] Using the Agrobacterium-mediated transformation method, pLGY02-TRI1796-NLR1 and pLGY02-TRI1796-NLR2 were respectively transformed into the powdery mildew-susceptible wheat variety Fielder (well-known and publicly available, provided by the Shandong Academy of Agricultural Sciences), and transgenic lines carrying TRI1796-NLR1 and TRI1796-NLR2 alone were obtained. The transgenic lines were susceptible to BgtYZ01 at the seeding and adult plant stages ( Figure 3 and Figure 4 ).

[0052] The transgenic lines carrying TRI1796-NLR1 and the transgenic lines carrying TRI1796-NLR2 were hybridized and self-crossed to obtain transgenic plants carrying both TRI1796-NLR1 and TRI1796-NLR2 genes. TRI1796-NLR1 and TRI1796-NLR2 in the transgenic plants were respectively detected by PCR using the corresponding primer pairs P1 and P2, P3 and P4 (Table 3), and the amplification conditions were the same as above; transgenic plants carrying both TRI1796-NLR1 and TRI1796-NLR2 genes were screened out.

[0053] Figure 5 The + sign on the middle leaves indicates the presence of the transgenic components TRI1796-NLR1 and TRI1796-NLR2. Two lines (Line 1 and Line2) of transgenic plants carrying both TRI1796-NLR1 and TRI1796-NLR2 genes were inoculated with the powdery mildew strain BgtYZ01. The results showed that the transgenic plants carrying both TRI1796-NLR1 and TRI1796-NLR2 genes were resistant to BgtYZ01 at the seeding and adult plant stages ( Figure 5 ). It was thus concluded that the Pm68 resistance is jointly controlled by the two genes TRI1796-NLR1 and TRI1796-NLR2.

[0054] Example 4: Development of the diagnostic molecular marker XPm68 for the powdery mildew resistance locus Pm68 in durum wheat

[0055] Since TRI1796-NLR1 and TRI1796-NLR2 are physically tightly linked and do not segregate in a population with a limited single-plant scale, and the difference between TRI1796-NLR1 and wheat homologous genes is small, which is not conducive to the development of molecular markers. Therefore, the present invention develops a diagnostic molecular marker XPm68 for the downstream specific sequence (with a large difference in DNA homologous to wheat) of the TRI1796-NLR2 gene at the Pm68 locus. The upstream and downstream primer sequences are SEQ ID No:1 and SEQ ID No:2 respectively. Different wheat varieties (including: Jimai 19, Yumai 34, Lumai 14, Yangmai 158, Yumai 18, Shixin 828, Tainong 18, Shannong 17, Shannong 21, Wennong 14, Shi 4185, Shimai 15, Shimai 18, Xuzhou 438, Gao 8901, Ji 5265, Henong 827, Kenong 9204, Han 7086, Jishi 02-1, all of which are publicly known and commonly used, corresponding to numbers 1-20 respectively) were detected by PCR amplification using the molecular marker XPm68. The results showed that except for TRI1796 (corresponding to number 21) having a specific band (size: 251bp) at the Pm68 locus, this specific band was not present in different wheat varieties( Figure 6 ), indicating that the molecular marker XPm68 has no interfering bands in these wheats and has application value in molecular marker-assisted selection breeding for the Pm68 locus where TRI1796-NLR2 is located.

[0056] The sequence information of SEQ ID No:1 is as follows: CGGAGAGAGTAGGTGATGGATC

[0057] The sequence information of SEQ ID No:2 is as follows: CAGTTCAGCAAGATGTTCCAGC

[0058] The PCR reaction system is as follows: In a 25 μL reaction system, it contains approximately 50 ng of template DNA, 1×PCR buffer, 1.5 mM MgCl2, 200 mM dNTP, the final concentration of each of the two primers is 0.2 μM, and 1 U of Taq DNA polymerase. The reaction system is supplemented to 25 μL with sterile distilled water.

[0059] The PCR reaction program is as follows: Pre-denaturation at 94 °C for 3 minutes; denaturation at 94 °C for 20 seconds, annealing at 55 °C - 60 °C for 30 seconds, extension at 72 °C for 60 seconds, for 35 cycles; extension at 72 °C for 5 minutes; preservation at 4 °C. The PCR amplification products were separated by electrophoresis on a 1.2% agarose gel and stained with a nucleic acid dye.

[0060] The described embodiments are the preferred embodiments of the present invention, but the present invention is not limited to the above embodiments. Without departing from the essence of the present invention, any obvious improvements, substitutions or modifications that those skilled in the art can make all fall within the protection scope of the present invention.

Claims

1. A gene combination related to wheat powdery mildew resistance, characterized in that: The gene combination is derived from the powdery mildew resistance site Pm68, and the gene combination includes the TRI1796-NLR1 gene and the TRI1796-NLR 2 gene. The GenBank accession number of the TRI1796-NLR1 gene is PQ655406; the GenBank accession number of the TRI1796-NLR2 gene is PQ655412.

2. A molecular marker associated with wheat powdery mildew resistance, characterized in that: The molecular marker is used to specifically detect the gene combination according to claim 1.

3. The molecular marker according to claim 2, characterized in that The primers used for specifically amplifying the molecular marker include an upstream primer as shown in SEQ ID No: 1 and a downstream primer as shown in SEQ ID No:

2.

4. A primer pair for amplifying a molecular marker according to any one of claims 2 or 3, characterized in that: The primer pair includes an upstream primer as shown in SEQ ID No: 1 and a downstream primer as shown in SEQ ID No:

2.

5. A product for detecting wheat powdery mildew resistance, characterized in that: The product comprises the primer according to claim 4.

6. Use of the gene combination according to claim 1, or the molecular marker according to claim 2, or the primer according to claim 4, or the product according to claim 5 in screening or identifying wheat resistance to powdery mildew, and / or breeding or assisted breeding of powdery mildew-resistant wheat, or detection of wheat powdery mildew resistance.

7. The use according to claim 6, characterized in that: The applications include: The primer pair described in claim 4 is used to perform PCR amplification on the test material, and the amplification product is detected. If a specific target product is obtained, the test material carries a gene related to wheat powdery mildew resistance, and the test material is resistant to powdery mildew.

8. A method for detecting or assisting in detecting wheat powdery mildew resistance, characterized in that: include: The primers described in claim 4 are used to perform PCR amplification on the test material, and the amplification product is detected. If a specific target product is obtained, the test material carries a gene related to wheat powdery mildew resistance, and the test material is resistant to powdery mildew.

9. The method according to claim 8, characterized in that The PCR reaction system used in the PCR amplification procedure includes: 50 ng template DNA, 1×PCR buffer, 1.5 mM MgCl2, 200 mM dNTP, upstream primer and downstream primer with a final concentration of 0.2 μM each, 1 U Taq DNA polymerase, and the reaction system is supplemented to 25 μL with sterile distilled water.

10. The method according to claim 8, characterized in that The reaction procedure of the PCR amplification includes: Pre-denaturation at 94°C for 3 minutes; denaturation at 94°C for 20 seconds, annealing at 55°C-60°C for 30 seconds, extension at 72°C for 60 seconds, 35 cycles; extension at 72°C for 5 minutes; storage at 4°C.

Images