TXLNB-FGFR2 fusion gene and application thereof

Abstract

The invention discloses a TXLNB-FGFR2 fusion gene and application thereof, and belongs to the technical field of biology. According to the invention, PCR amplification is carried out on DNA of a sample by using primers with sequences as shown in SEQ ID NO.5 and 6 or cDNA of the sample by using sequences as shown in SEQ ID NO.3 and 4, and the disease risk is judged according to the amplification result. According to the invention, the pathogenesis of the juvenile low-grade neuroepithelial neoplasm can be further explored, and the clinical pathological classification and diagnosis and treatment strategy of the juvenile low-grade neuroepithelial neoplasm patients can be optimized.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a TXLNB-FGFR2 fusion gene and its application. Background Art

[0002] FGF receptors (FGFRs) are transmembrane proteins that act as tyrosine kinase receptors and are involved in various cellular processes such as cell development, differentiation, migration, and growth. However, it is known that FGFR gene mutations can cause abnormal FGFR signaling pathways, leading to carcinogenesis. Gene mutations in this pathway directly stimulate cancer cell proliferation, survival, migration, and invasion, as well as angiogenesis and immune escape, increasing resistance to anticancer drugs.

[0003] FGFR gene rearrangements produce fusion genes, a mixture of two previously independent genes, which are the result of deletions, translocations, inversions, or duplications. The protein encoded by the FGFR2 gene is one of the members of the fibroblast growth factor receptor (FGFR) family. Currently, four FGFRs have been identified, namely FGFR1, FGFR2, FGFR3, and FGFR4. As the receptor for FGF, the main function of FGFR is to transduce FGF signals into the RAS-ERK and PI3K-AKT signal cascades. Multiple FGFR fusion genes, especially FGFR2, are involved in the occurrence and development of cancer. These mutations have been found in multiple cancer types. DNANGS shows that the incidence of FGFR2 fusion in patients with intrahepatic cholangiocarcinoma is 10%-16%. FGFR2 mutations have also been found in other cancer types such as gallbladder cancer, breast cancer, thyroid cancer, and prostate cancer, but the incidence is relatively low.

[0004] Polymorphous low-grade neuroepithelial tumor of the young (PLNTY) is a newly recognized tumor type in the "2021 WHO CNS5". It is an indolent neuroepithelial tumor that occurs in adolescents and is closely related to epilepsy. It shows a diffuse growth pattern, mainly with the morphological characteristics of oligodendroglioma, accompanied by calcification, CD34 expression, and molecular abnormalities in the MAPK pathway, and is WHO grade 1. Molecular genetic studies have shown that abnormal activation of the MAPK pathway, including BRAF gene mutations, FGFR2 or FGFR3 gene fusion alterations, is an essential element for the diagnosis of PLNTY. The specific mechanism by which these gene alterations lead to the development of PLNTYs is not yet clear, so further research is needed. Summary of the Invention

[0005] One of the objectives of the present invention is to provide a TXLNB-FGFR2 fusion gene, the DNA sequence of which is shown in SEQ ID NO.1, and the RNA sequence is shown in SEQ ID NO.2.

[0006] Another objective of the present invention is to provide PCR primers for detecting the above TXLNB-FGFR2 fusion gene. The primers for detecting the DNA sequence of the fusion gene are composed of SEQ ID NO.5 and SEQ ID NO.6.

[0007] Another objective of the present invention is to provide PCR primers for detecting the above TXLNB-FGFR2 fusion gene. The primers for detecting the RNA sequence are composed of SEQ ID NO.3 and SEQ ID NO.4.

[0008] Another objective of the present invention is to provide a product for diagnosing juvenile pleomorphic low-grade neuroepithelial tumors, which contains the above PCR primers SEQ ID NO.5 and SEQ ID NO.6.

[0009] Another objective of the present invention is to provide a product for diagnosing juvenile pleomorphic low-grade neuroepithelial tumors, which contains the above PCR primers SEQ ID NO.3 and SEQ ID NO.4.

[0010] Preferably, the product is a chip or a kit.

[0011] Another objective of the present invention is to provide the application of the above PCR primers in the preparation of products for diagnosing juvenile pleomorphic low-grade neuroepithelial tumors.

[0012] Another objective of the present invention is to provide the application of the above TXLNB-FGFR2 fusion gene in the preparation of products for diagnosing juvenile pleomorphic low-grade neuroepithelial tumors.

[0013] Preferably, the product is a kit.

[0014] More preferably, the usage method of the kit is as follows:

[0015] (1) Extract RNA from tissue blocks;

[0016] (2) Reverse transcribe to obtain cDNA;

[0017] (3) Perform PCR using primers SEQ ID NO.3 and 4;

[0018] (4) Make a judgment according to the amplification result;

[0019] Or

[0020] (1) Extract DNA from tissue blocks;

[0021] (2) Perform PCR using primers SEQ ID NO.5 and 6;

[0022] (3) Make a judgment based on the amplification results.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] The FGFR2 gene fusion is one of the characteristic genetic alterations of PLNTY. The present invention provides a new FGFR2 fusion, namely TXLNB-FGFR2, which has not been reported in domestic and foreign literatures at this locus, and the original FGFR2 fusion gene amplification primers cannot detect this fusion gene either, thus leading to missed diagnosis. The present invention helps to further explore the pathogenesis of juvenile pleomorphic low-grade neuroepithelial tumors and optimize the clinicopathological classification and diagnosis and treatment strategies for patients with juvenile pleomorphic low-grade neuroepithelial tumors. Brief Description of the Drawings

[0025] Figure 1 It is the RNA integrity quality control chart in Example 1.

[0026] Figure 2 It is the visualization analysis result of the RNA-seq data bam file in Example 1.

[0027] Figure 3 It is the visualization analysis result of the DNA-seq data bam file in Example 2.

[0028] Figure 4 It is the gel electrophoresis diagram in Example 3.

[0029] Figure 5 It is the RNA analysis test result in Example 3.

[0030] Figure 6 It is the schematic diagram of the RNA fusion mode in Example 3.

[0031] Figure 7 It is the gel electrophoresis diagram in Example 4.

[0032] Figure 8 It is the DNA analysis test result in Example 4.

[0033] Figure 9 It is the schematic diagram of the DNA fusion mode in Example 4.

[0034] Figure 10 It is the detection result in Example 5.

[0035] Figure 11The PSORT II prediction results in Example 6.

[0036] Figure 12 The coiled-coil domain predicted by COILS in Example 6.

[0037] Figure 13 The coiled-coil domain predicted by Paircoil2 in Example 6.

[0038] Figures 14 - 16 The swiss-model homology modeling results in Example 6. Detailed implementation manners

[0039] Example 1 Obtaining and screening of TXLNB-FGFR2 fusion gene at the RNA level

[0040] The TXLNB gene is located at 6q24.1; gene fusion at the DNA level occurs between intron 7 of TXLNB and intron 17 of the FGFR2 gene, and its nucleotide sequence is as shown in SEQ ID NO.1; at the RNA level, the TXLNB-FGFR2 fusion gene is composed of exons 1-17 of the FGFR2 gene and exons 1-8 of the TXLNB gene, and its nucleotide sequence is as shown in SEQ ID NO:2.

[0041] SEQ ID NO.1:

[0042]

[0043] SEQ ID NO.2:

[0044]

[0045] CTCACTCTCTACTCAGGAAGGTTTGAAGAATTCCAGAGCACACTAACTAAAAGCAACGAGGTGTTTGCCACGTTCAAACAGGAAATGGACAAAACAACTAAGAAAATGAAGAAGCTGGAAAAGGACACAGCCACATGGAAAGCCCGATTTGAGAACTGTAACAAAGCTCTGTTGGACATGATTGAAGAGAAAGCACTGAGAGCTAAAGAATATGAGTGCTTTGTGATGAAAATCGGGAGGCTAGAGAACCTCTGCCGTGCTTTACAAGAAGAGAGAAACGAACTCCACAAAAAAATCAGAGACGCAGAAATATCTGAAAAGGATGACCAAAGTCAGCACAACTCCGATGAAGAGCCAGAGTCAAACGTCTCTGTGGATCAAGAGATTGACGCAGAGGAGGTTAATAGTGTCCAAACCGCCGTGAAAAATCTGGCCACAGCCTTCATGATAATTCATCATCCAGAGTCAACCCCGCACCAGTCCAAAGAAACCCAACCCGAAATAGGCAGTTCTCAGGAGAGTGCTGACGCCGCTCTCAAGGAGCCAGAGCAACCCCCTCTGATCCCTTCACGGGATTCAGAGAGTCCCCTGCCTCCCCTAACTCCTCAGGCTGAAGCCGAAGGAGGCAGTGATGCTGAACCTCCCTCCAAGGCCAGTAATTCTCCTGCCGGGTTGGGAGCAGAAACCCAATGCGAGGGTCTCCCTGTTGGAGCACAGGCTGATCAGGCGTCCTGGAAGCCAGAGGCAGAAGCTTCCGGTCAGGCCCCACAGGCTCCCACCGAGGCCTCCCTACAGAAGATGGAGGCAGATGTGCCTGCTCCAGCATGCGCAGCAGAAGAGCACGTTGCAGCCATGGTGCCTGCATGCGAGCCCAGTAGGCAGCCCCCACGAGCAGCAGCAGAGGAGCTGCCAGTAGGGGCCTCAGCTGGGCCCCAGCCGCGCAACGTGGCTGACACCAATCTGGAAGGCGTCGACTAA。

[0046] Among them, (-) represents the DNA or RNA fusion breakpoint, and the nucleotide sequences of two genes are on the left and right sides respectively.

[0047] We detected specimens of FGFR2 tumor patients with unknown fusion targets by DNA-Seq high-throughput sequencing and RNA-seq sequencing methods, and found a new translocation partner of FGFR2: TXLNB-FGFR2 gene translocation. The specific method is as follows:

[0048] 1. List of reagents and consumables

[0049] Table 1 Reagents

[0050]

[0051] Table 2 Instruments and consumables

[0052] Name Brand Ultra-low temperature refrigerator BIOBASE Liquid nitrogen tank Thermo Micropipette RAININ PCR instrument BIO-RAD Horizontal electrophoresis apparatus Liuyi Gel imaging system Liuyi Automatic nucleic acid and protein analysis system - capillary electrophoresis instrument Qsep100 Optizen Qubit fluorescence quantification Thermo

[0053] 2. DNA & RNA extraction process

[0054] (1) Trim off the excess paraffin from the FGFR2 brain tumor tissue block with unknown fusion target, and cut it into thin slices of 5-10 μm after exposing the tissue; (2) Take about 1×1 cm 2 of the slices (about 1-5 slices in total) and place them in a centrifuge tube (prepared by yourself), add 500 μl Buffer DS, and vortex for 10 seconds. Briefly centrifuge to collect the sample at the bottom of the tube. Incubate at 56 °C for 3 minutes, take it out from the water bath and let it stand, and proceed to the next step after cooling to room temperature; (3) Centrifuge at 12,000 rpm for 2 minutes, carefully and thoroughly aspirate the supernatant without aspirating the precipitate. The remaining dewaxing solution can be carefully removed with a small pipette tip (10 μl); (4) Add 180 μl Buffer GTL and 20 μl Proteinase K to the above tube, and vortex to mix evenly; (5) Incubate at 56 °C for 15 minutes, then place it on ice for 3 minutes. At room temperature, centrifuge at 12,000 rpm for 15 minutes; (6) Transfer the supernatant to a new 1.5 ml centrifuge tube for RNA extraction, and use the precipitate for DNA extraction;

[0055] DNA extraction:

[0056] Take the precipitate obtained in step (6), add 180 μl of Buffer GTL and 20 μl of Proteinase K to the precipitate. Vortex for 15 seconds to resuspend the precipitate. (1) Incubate at 56 °C for 3 hours until the sample is completely dissolved. Incubate at 90 °C for 1 hour. (2) Add 200 μl of Buffer GL, vortex to mix well, then add 200 μl of absolute ethanol, and vortex thoroughly to mix. Centrifuge briefly to collect the solution on the tube wall at the bottom of the tube. (3) Transfer all the solution obtained in step 9 to the adsorption column (Spin Columns DF) placed in the collection tube. The solution cannot be added all at once and can be transferred in multiple portions. Centrifuge at 12,000 rpm for 1 minute, pour out the waste liquid in the collection tube, and place the adsorption column back into the collection tube. (4) Add 500 μl of Buffer GW1 to the adsorption column, centrifuge at 12,000 rpm for 1 minute, pour out the waste liquid in the collection tube, and place the adsorption column back into the collection tube. (5) Add 500 μl of Buffer GW2 to the adsorption column, centrifuge at 12,000 rpm for 1 minute, pour out the waste liquid in the collection tube, and place the adsorption column back into the collection tube. (6) Centrifuge at 12,000 rpm for 2 minutes, pour out the waste liquid in the collection tube. Place the adsorption column at room temperature for 5 minutes to dry completely. (7) Place the adsorption column in a new 1.5 ml centrifuge tube, add 20 - 50 μl of Buffer EB to the middle of the adsorption column in a suspended manner, let it stand at room temperature for 5 minutes, centrifuge at 12,000 rpm for 1 minute, collect the DNA solution, and store it at -20 °C.

[0057] RNA extraction:

[0058] (1) Incubate the supernatant obtained in (6) at 80 °C for 15 minutes; (2) Add 320 μl of Buffer GL, vortex to mix well, then add 720 μl of absolute ethanol, and immediately vortex thoroughly to mix; (3) Transfer all the obtained solution to the adsorption column (Spin Columns RS) placed in the collection tube. The solution cannot be added all at once and can be transferred in multiple portions. Centrifuge at 12,000 rpm for 1 minute, pour out the waste liquid in the collection tube, and place the adsorption column back into the collection tube; (4) Add 500 μl of Buffer RW2 to the adsorption column, centrifuge at 12,000 rpm for 1 minute, pour out the waste liquid in the collection tube, and place the adsorption column back into the collection tube; (5) Repeat step 17. Then centrifuge at 12,000 rpm for 2 minutes, pour out the waste liquid in the collection tube. Place the adsorption column at room temperature for 5 minutes to dry completely; (6) Place the adsorption column in a new RNase-free centrifuge tube, add 20 - 50 μl of RNase-Free Water to the middle of the adsorption column in a suspended manner, let it stand at room temperature for 5 minutes, centrifuge at 12,000 rpm for 1 minute, collect the RNA solution, and store it at -80 °C;

[0059] 3. Transcriptome library construction

[0060] 3.1 Enrich mRNA

[0061] (1) Take out the magnetic bead reagent from 4 °C and let it stand to equilibrate its temperature to room temperature; (2) Prepare the RNA sample: In a Nuclease-free PCR tube, dilute 0.01 - 12.5 μg of total RNA to 50 μl with Nuclease-free ddH2O and place it on ice for later use; Note not to place it for too long to prevent RNA degradation; (3) Invert the mRNACapture Beads 2.0 up and down to mix well, aspirate 50 μl and add it to the total RNA sample, and pipette 6 times to mix thoroughly; (4) Place the sample in a PCR instrument at 65 °C for 5 min, 25 °C for 5 min, and hold at 4 °C to bind the mRNA to the magnetic beads; (5) Place the sample on a magnetic stand for 5 min to separate the mRNA from the total RNA; After the solution becomes clear, carefully remove the supernatant; (6) Take the sample off the magnetic stand, add 200 μl of Beads Wash Buffer 2.0, pipette 6 times to mix thoroughly, let it stand on the magnetic stand for 5 min, and after the solution becomes clear, carefully remove the supernatant; (7) Take the sample off the magnetic stand, add 50 μl of Tris Buffer 2.0 to resuspend the magnetic beads; Pipette 6 times to mix thoroughly; (8) Place the sample in a PCR instrument at 80 °C for 2 min and hold at 25 °C to elute the mRNA; (9) Add 50 μl of Beads Binding Buffer 2.0 and pipette 6 times to mix thoroughly; (10) Let it stand at room temperature for 5 min to bind the mRNA to the magnetic beads; (11) Place the sample on a magnetic stand for 5 min to separate the mRNA from the total RNA; After the solution becomes clear, carefully remove the supernatant; (12) Take the sample off the magnetic stand, add 200 μl of Beads Wash Buffer 2.0, pipette 6 times to mix thoroughly, let it stand on the magnetic stand for 5 min, and after the solution becomes clear, carefully remove the supernatant; Note: Make sure to suck out all the residual liquid completely. Incomplete removal of the Beads Wash Buffer will affect the mRNA fragmentation effect;

[0062] 3.2 Target mRNA Fragmentation

[0063] (1) Prepare Frag / Prime Buffer (1×), and prepare the following reaction solution in a Nuclease-free centrifuge tube:

[0064] Table 3

[0065]

[0066] (2) Resuspend the magnetic beads by adding 18.5 μl of Frag / Prime Buffer accordingly, and gently pipette up and down 10 times to mix well. Since the sample is severely degraded, there is no need to perform the fragmentation process and proceed directly to the next step; (3) Place the sample on a magnetic stand. After the solution becomes clear (about 5 min), carefully pipette 16 μl of the supernatant into a new nuclease-free PCR tube and immediately perform the first-strand cDNA synthesis reaction.

[0067] 3.3 Double-stranded cDNA synthesis

[0068] (1) Take out the components required for double-stranded cDNA synthesis from -30 to -15 °C, thaw on ice, invert the tube up and down to mix well, and briefly centrifuge to collect at the bottom of the tube. Prepare the first-strand cDNA synthesis reaction system according to the following table:

[0069] Table 4

[0070]

[0071] (2) Set the pipette to a 20 μl range and gently pipette up and down 10 times to mix well;

[0072] (3) Perform the first-strand cDNA synthesis reaction in a PCR instrument:

[0073] Table 5

[0074]

[0075]

[0076] Immediately perform the second-strand cDNA synthesis reaction after completion;

[0077] (4) Prepare the second-strand cDNA synthesis reaction system according to the following table:

[0078] Table 6

[0079]

[0080] (5) Set the pipette to a 50 μl range and gently pipette up and down 10 times to mix well;

[0081] (6) Perform the second-strand cDNA synthesis reaction in a PCR instrument:

[0082] Table 7

[0083]

[0084] 3.4 Adapter ligation

[0085] 1) Prepare the following ligation system according to the following table:

[0086] Table 8

[0087]

[0088] 2) Adjust the pipette to the 80 μl range and gently pipette up and down 10 times to mix well;

[0089] 3) Perform the ligation reaction in a PCR instrument:

[0090] Table 9

[0091]

[0092] 3.5 Purification of the ligation product

[0093] (1) Invert or vortex to fully mix the VAHTS DNA Clean Beads. Pipette 45 μl (0.45×) and add it to the ligation product. Gently pipette up and down 10 times to fully mix; (2) Incubate at room temperature for 10 min to bind the DNA to the magnetic beads; (3) Place the sample on the magnetic stand. After the solution becomes clear (about 5 min), carefully remove the supernatant; (4) Keep the sample on the magnetic stand. Add 200 μl of freshly prepared 80% ethanol to wash the magnetic beads. Incubate at room temperature for 30 sec and carefully remove the supernatant; (5) Repeat step (4) once; (6) Keep the sample on the magnetic stand and dry the magnetic beads with the lid open at room temperature for about 5 - 10 min; (7) Remove the sample from the magnetic stand. Add 102.5 μl of Nuclease-free ddH2O, vortex or gently pipette up and down to fully mix. Let it stand at room temperature for 2 min and then place it on the magnetic stand. After the solution becomes clear (about 5 min), carefully pipette 100 μl of the supernatant into a new Nuclease-free PCR tube; (8) Invert or vortex to fully mix the VAHTS DNA Clean Beads. Pipette 65 μl (0.65×) and add it to the purified ligation product. Gently pipette up and down 10 times to fully mix; (9) Incubate at room temperature for 10 min to bind the DNA to the magnetic beads; (10) Place the sample on the magnetic stand. After the solution becomes clear (about 5 min), keep the sample on the magnetic stand all the time and pipette 160 μl of the supernatant (retain the supernatant in this step, do not discard!) into a new Nuclease-free PCR tube; (11) Add 20 μl (0.2×) of VAHTS DNA Clean Beads, gently pipette up and down 10 times to fully mix; (12) Incubate at room temperature for 10 min to bind the DNA to the magnetic beads; (13) Place the sample on the magnetic stand. After the solution becomes clear (about 5 min), carefully remove the supernatant; (14) Keep the sample on the magnetic stand. Add 200 μl of freshly prepared 80% ethanol to wash the magnetic beads. Incubate at room temperature for 30 sec and carefully remove the supernatant; (15) Repeat step (14) once; (16) Keep the sample on the magnetic stand all the time and dry the magnetic beads at room temperature for about 5 - 10 min; (17) Remove the sample from the magnetic stand. Add 22.5 μl of Nuclease-free ddH2O, vortex or gently pipette up and down to fully mix. Let it stand at room temperature for 2 min and place it on the magnetic stand. After the solution becomes clear (about 5 min), carefully pipette 20 μl of the supernatant into a new Nuclease-free PCR tube;

[0094] 3.6 Library Amplification

[0095] 1) Prepare the reaction system:

[0096] Table 10

[0097]

[0098] 2) Adjust the pipette to the 30 μl range and gently pipette up and down 10 times to mix well.

[0099] 3) Place the sample in a PCR instrument and perform library amplification reaction:

[0100] Table 11

[0101]

[0102] 3.7 Purification of library amplification products:

[0103] (1) Invert or vortex to mix the VAHTS DNA Clean Beads well, pipette 45 μl (0.9×) and add it to the PCR product, and gently pipette up and down 10 times with a pipette to mix well; (2) Incubate at room temperature for 10 min to bind the DNA to the magnetic beads; (3) Place the sample on a magnetic stand, and after the solution becomes clear (about 5 min), carefully remove the supernatant; keep the sample on the magnetic stand, add 200 μl of 80% ethanol (freshly prepared) to wash the magnetic beads, incubate at room temperature for 30 sec, and carefully remove the supernatant; (4) Repeat step 3) once; (5) Keep the sample on the magnetic stand, and dry the magnetic beads with the lid open at room temperature for about 5 - 10 min; (6) Take the sample off the magnetic stand, add 25 μl of Nuclease-free ddH2O, vortex or gently pipette up and down to mix well, let it stand at room temperature for 2 min and then place it on the magnetic stand, and after the solution becomes clear (about 5 min), carefully pipette 22.5 μl of the supernatant into a new Nuclease-free PCR tube; (7) It is recommended to accurately quantify the library concentration using Qubit. Observe the library fragment size by agarose gel electrophoresis;

[0104] 4. High-throughput sequencing

[0105] Send the DNA library to BGI (Shanghai) Co., Ltd. for second-generation NGS sequencing.

[0106] 5. Data analysis - Finding fusions - Software for analyzing fusions and displaying fusion breakpoints

[0107] The software and parameters for data splitting and raw data filtering are the same as those in the DNAseq data processing steps. The filtered sequences are mapped back to the reference genome (ucsc hg19) using the hisat2 software (version: 2.1.0) with the parameters "-p 8 --fr –dta" to obtain a sam file. The sam file is sorted and converted into a bam file using the picard software (version: 2.10.3 - SNAPSHOT). Four software programs, STARFusion (version: 1.10.0, parameters "--min_FFPM 0.001 --no_annotation_filter"), Arriba (version: 2.1.0, parameter "-E 1"), fusioncatcher (version: 1.33, parameter "--skip-star"), and EricScript (version: 0.5.5b, parameter "-p 8"), are used for fusion gene detection. The union of the four methods is taken, and it is detected that the FGFR2 gene NM_022970: exon: 17 and the TXLNB gene NM_153235: intron: 7 have a fusion, and the genfuse software (version: 0.6.1) is used for verification. The results are as Figure 2 shown.

[0108] Example 2 Obtaining and Screening of the TXLNB - FGFR2 Fusion Gene at the DNA Level

[0109] 1. DNA Library Construction

[0110] 1.1 End Repair & A - addition

[0111] (1) Fragmentation of the DNA sample fragments obtained by extraction in Example 1 shall be carried out according to the conditions of each laboratory. It is recommended to use the Covaris TM series of DNA sonication instruments for sample fragmentation. The sample is fragmented to an average fragment size of 250 - 300 bp; (2) Input amount for library construction: Take 200 ng after fragmentation, with a volume not exceeding 40 ul. If it is less than 40 ul, make it up to 40 ul with enzyme - free water;

[0112] Table 12

[0113]

[0114]

[0115] (3) According to the following table, prepare the reaction system in a 0.2 ml PCR tube placed on ice:

[0116] (4) Start the following reaction program on the PCR instrument. When the temperature stabilizes at 20°C, place the reaction tube into the PCR instrument:

[0117] Table 13

[0118]

[0119] 1.2 Adapter Ligation

[0120] (1) Take out the 4.1.3 PCR reaction tube from the PCR instrument, place it on ice, and prepare the reaction system according to the following table:

[0121] Table 14

[0122]

[0123] (2) Start the following reaction program on the PCR instrument. When the temperature stabilizes at 20°C, place the reaction tube into the PCR instrument:

[0124] Table 15

[0125]

[0126] 1.3 Purification of Ligation Products

[0127] (1) Add 40 μl of SP Beads to the ligation reaction product from the previous step, mix well, and incubate at 25°C for 10 min;

[0128] (2) Centrifuge the PCR tube briefly and place it on the magnetic stand for 5 - 10 min until the liquid is completely clear. Use a pipette to aspirate and discard the supernatant; (3) Slowly add 150 μl of 80% ethanol along the side wall of the PCR tube, taking care not to disturb the magnetic beads. Let it stand for 30 sec, then use a pipette to aspirate and discard the supernatant; (4) Repeat step 3) once; (5) Centrifuge the PCR tube briefly and place it on the magnetic stand. Use a 10 μl pipette tip to remove a small amount of residual ethanol, taking care not to aspirate the magnetic beads; (6) Open the lid of the PCR tube and let it stand at room temperature for about 5 min until the ethanol has completely evaporated; (7) Remove the PCR tube, add 22 μl of Nuclease Free Water to the PCR tube, suspend the magnetic beads evenly, and incubate at 25°C for 2 min; (8) Centrifuge the PCR tube briefly and place it on the magnetic stand for 2 min until the liquid is completely clear. Carefully use a pipette to aspirate 20 μl of the supernatant and transfer it to a new 0.2 ml PCR tube.

[0129] 1.4 PCR Amplification

[0130] 1) Prepare the reaction system in a 0.2 mL PCR tube placed on ice according to the following table:

[0131] Table 16

[0132]

[0133]

[0134] 2) Place the PCR tube in the PCR instrument and start the following program:

[0135] Table 17

[0136]

[0137] 1.5 Purification of the amplified library

[0138] 1) Add 50 μl of SP Beads to the ligation reaction product from the previous step, mix well and incubate at 25 °C for 10 min;

[0139] 2) Centrifuge the PCR tube briefly and then place it on the magnetic stand for 5 - 10 min until the liquid is completely clear, and use a pipette to aspirate and discard the supernatant;

[0140] 3) Slowly add 150 μl of 80% ethanol along the side wall of the PCR tube, taking care not to disturb the magnetic beads, let stand for 30 sec, and use a pipette to aspirate and discard the supernatant;

[0141] 4) Repeat step 3) once;

[0142] 5) Centrifuge the PCR tube briefly and then place it on the magnetic stand, and use a 10 μl tip to remove a small amount of residual ethanol, taking care not to aspirate the magnetic beads;

[0143] 6) Open the lid of the PCR tube and let stand at room temperature for about 5 min until the ethanol has completely evaporated;

[0144] 7) Remove the PCR tube, add 42 μl of Nuclease Free Water to the PCR tube, suspend the magnetic beads evenly, and incubate at 25 °C for 2 min;

[0145] 8) Centrifuge the PCR tube briefly and then place it on the magnetic stand for 2 min until the liquid is completely clear, and carefully use a pipette to aspirate 40 μl of the supernatant and transfer it to a new 1.5 ml PCR tube.

[0146] 2. High-throughput sequencing

[0147] Send the cDNA library to CodeM Biosciences (Shanghai) Co., Ltd. for second-generation NGS sequencing.

[0148] 3. Data analysis - Finding fusions - Software for analyzing fusions and displaying fusion breakpoints

[0149] The off-machine data was split using the bcl2fastq software (version: 2.20.0.422) to obtain the original fastq format files. Since the original sequencing data may contain sequencing adapter sequences, low-quality reads, sequences with a high N rate, and sequences with too short lengths, this will seriously affect the quality of subsequent assembly. To ensure the accuracy of subsequent bioinformatics analysis, the original sequencing data was first filtered to obtain high-quality sequencing data (clean data) to ensure the smooth progress of subsequent analysis. This step was processed using the fastp software (version: 0.20.0) with default parameters. The bwa software (version: 2.2.1) was used to map the sequences to the reference genome (ucsc hg19) to obtain the sam file. Sambamba (version: 0.8.0) was used to perform preprocessing such as sorting and marking duplicates on the sam to generate the bam file, and then manta (version: 1.6.0) was used for fusion gene detection with the parameter "--exome --generateEvidenceBam". The TXLNB_FGFR2 fusion (mutation abundance 34.84%) was detected, see Figure 3 , and the breakpoint positions were chr6:139574292 and chr10:123241610.

[0150] Example 3 RNA level: Verification of the TXLNB-FGFR2 fusion gene

[0151] 1. Primer design for first-generation verification - Primer design requirements:

[0152] 1) There are no non-specific amplification fragments in the alignment;

[0153] 2) The primer length is generally 18 - 30bp;

[0154] 3) The GC content of the primer is generally 40% - 60%;

[0155] 4) The Tm value is generally selected as 57 - 63°C, and the forward and reverse difference is less than 2°C;

[0156] 5) The amplification fragment range is 150bp - 800bp. Considering the poor sample quality, it is best to control the amplification fragment within 150bp - 300bp;

[0157] The specific primers for the fusion gene were synthesized by Jiangsu Saisuofei Biotechnology Co., Ltd.

[0158] The specific primer sequences of the fusion gene are shown in Table 18.

[0159] Table 18

[0160]

[0161] 2. Total RNA Reverse Transcription Procedure

[0162] Denaturation of RNA Template

[0163] 1) Take 8 μl of Total RNA in an RNase-free centrifuge tube, heat at 65 °C for 5 min, quickly place on ice for rapid cooling, and let stand on ice for 2 min.

[0164] 2) Add 2 μl of 5x gDNAwiper Mix to the above mixture, gently pipette to mix well. Incubate at 42 °C for 2 min.

[0165] 3) Prepare the first-strand cDNA synthesis reaction mixture:

[0166] Table 19

[0167]

[0168] Gently pipette to mix well.

[0169] 4) Perform the first-strand cDNA synthesis reaction under the following conditions

[0170] Table 20

[0171]

[0172] The product can be immediately used for PCR reaction, or stored at -20 °C and used within half a year; for long-term storage, it is recommended to aliquot and store at -70 °C. cDNA should be avoided from repeated freezing and thawing.

[0173] 3. PCR Amplification - Amplification System and Conditions

[0174] Amplification System:

[0175] Table 21

[0176]

[0177] Amplification Conditions:

[0178] Table 22

[0179]

[0180] 4. Agarose Gel Electrophoresis - Gel Image Display

[0181] 1) Weigh 8 g of agarose and pour it into a 1000 mL beaker, add 400 mL of 1.0× TAE buffer;

[0182] 2) Place it in a microwave oven and heat to boiling twice to ensure complete dissolution of agarose. Take out the beaker, let it cool to 65 °C at room temperature, and add nucleic acid stain according to the ratio;

[0183] 3) Pour the agarose solution into two horizontally placed agarose gel trays of 200 mL respectively. If there are bubbles, use a comb to drive them away. After there are no bubbles, place the comb and wait for it to solidify completely. Then gently pull out the comb to form separated sample loading holes on the gel plate;

[0184] 4) Place the organic glass inner tank with the poured gel into the electrophoresis tank, and add 1.0×TAE buffer into the electrophoresis tank to make the liquid level more than 0.5 cm above the tray;

[0185] 5) Add 1.5 μl of buffer to the amplified PCR product. After mixing, aspirate all the products for gel running. The loading amount of the Marker is 5 μl. Replace the pipette tip after adding each sample to prevent contamination;

[0186] 6) The gel plate after sample loading should be immediately electrophoresed at a voltage of 220 V. Stop electrophoresis when the bromophenol blue moves to about 1 cm from the lower edge of the gel plate;

[0187] 7) After electrophoresis, take out the gel mold, push it onto a clean glass plate, observe it under an ultraviolet lamp. The position where DNA exists shows white fluorescence. Take a photo and save it using a gel imaging system. The results are shown in Figure 4 .

[0188] 5. Sequencing and sequence splicing - finding breakpoints

[0189] 5.1 Recovery of PCR products

[0190] 1) Cut the single target DNA band from the agarose gel and put it into a clean centrifuge tube;

[0191] 2) Add 300 μl of solution PN to the gel block, place it in a 70 °C water bath for 15 min, and gently invert the centrifuge tube up and down continuously during this period to ensure that the gel block is fully dissolved;

[0192] 3) Add the solution obtained in the previous step to an adsorption column CA2 (the adsorption column is placed in the collection tube), let it stand at room temperature for 2 min, centrifuge at 12,000 rpm (~13,400×g) for 60 sec, pour out the waste liquid in the collection tube, and put the adsorption column CA2 into the collection tube;

[0193] 4) Add 600 μl of washing solution PW to the adsorption column CA2 (please check whether absolute ethanol has been added before use), centrifuge at 12,000 rpm (~13,400×g) for 60 sec, pour out the waste liquid in the collection tube, and put the adsorption column CA2 into the collection tube. Put the adsorption column CA2 into the collection tube;

[0194] 5) Repeat the operation step 4);

[0195] 6) Place the adsorption column CA2 back into the collection tube, centrifuge at 12,000 rpm (~13,400×g) for 2 min to remove as much eluent as possible. Leave the adsorption column CA2 at room temperature for several minutes to dry thoroughly to prevent the residual eluent from affecting the next experiment;

[0196] 7) Place the adsorption column CA2 into a clean centrifuge tube, suspend and add an appropriate amount of elution buffer EB to the middle of the adsorption membrane, and leave it at room temperature for 2 min. Centrifuge at 12,000 rpm (~13,400×g) for 2 min to collect the DNA solution;

[0197] 8) Transfer the gel recovery sample to the sequencing personnel.

[0198] 5.2 PCR reaction before sequencing

[0199] PCR reaction system and procedure before sequencing

[0200] Take a 96-well plate and add the following reaction system:

[0201] Table 23

[0202]

[0203] The PCR procedure before sequencing is shown in Table 24:

[0204] Table 24

[0205]

[0206] 5.3 Purification of sequencing products

[0207] (1) Add 6 μl of diluted magnetic beads and 30 μl of 85% alcohol to each reaction well, cover and shake for 15 s, centrifuge briefly for 2 s, and leave at room temperature for 10 min.

[0208] (2) Place it on the magnetic stand in sequence and leave it for 5 min, discard the cover, aspirate 40 μl of the reaction solution and discard it. When aspirating the reaction solution, the tip direction should be opposite to the magnetic bead adsorption direction to avoid aspirating the magnetic beads. The same operation applies to all subsequent operations on the magnetic stand.

[0209] (3) Elution: Add 100 μl of 85% alcohol and aspirate it. Repeat 3 times. (Add with the first gear, aspirate with the second gear) Discard the original tube cover of the eight-connected row, add a new cover and centrifuge briefly for 2 s to ensure that the side of the magnetic beads is outside. Dry for 15 min.

[0210] (4) Add 30 μl of H2O to each reaction well, shake evenly, and place it on the magnetic stand for 5 min.

[0211] (5) Transfer the wells with samples to a new 96-well plate, and fill the empty wells with water. There should be no empty wells.

[0212] (6) Seal the membrane, centrifuge, and check for magnetic beads and air bubbles.

[0213] (7) Detect on the ABI 3730xl.

[0214] (8) Install sequence analysis software SeqMan II or Chromas, read and analyze the sequencing results as Figure 5 shown.

[0215] See the schematic diagram of RNA fusion mode in Figure 6 .

[0216] Example 4 DNA level: Verification of TXLNB-FGFR2 fusion gene

[0217] The design of PCR primers and the detection process refer to Steps 1, 3, 4, and 5 of Example 3. For specific results, see Figure 7 and 8 See the schematic diagram of DNA fusion mode in Figure 9 .

[0218] 1. Primer design results

[0219] Table 25

[0220]

[0221] Example 5 Detection of control group cases

[0222] For 12 diagnosed control group cases (including 5 cases of glioma, 5 cases of neuroblastoma, 1 case of juvenile pleomorphic low-grade neuroepithelial tumor with FGFR2-CTNNA rearrangement, and 1 case of FGFR3-TACC3 fusion) of juvenile pleomorphic low-grade neuroepithelial tumor, theoretically, there is no TXLNB-FGFR2 gene fusion. Use the primer combination of the present invention for detection (SEQ ID NO.3 and 4, 5 and 6 are used to detect RNA and DNA respectively). The methods of DNA and RNA extraction, RNA reverse transcription PCR, and sequencing are the same as above.

[0223] See the results in Figure 10 It can be seen that when using the primer combination designed by the present invention for detection, the TXLNB-FGFR2 fusion gene is not detected, which proves that the primers designed in this project have high specificity.

[0224] Evaluation: The primer combination of the present invention is a supplement to the original primers for FGFR2 translocation juvenile pleomorphic low-grade neuroepithelial tumor fusion gene, expands the types of FGFR2 translocation juvenile pleomorphic low-grade neuroepithelial tumor fusion genes, and increases the detection rate of diagnosing this tumor by PCR method.

[0225] Example 6 Prediction of the Location and Conformation of the Fusion Protein and Exploration of the Mechanism

[0226] PSORT II was used to predict the subcellular localization of the TXLNB-FGFR2 fusion protein. The results are shown in Figure 11 , indicating that it is localized in the plasma membrane. The COILS and Paircoil2 software were respectively used to predict whether the newly formed fusion protein has a coiled-coil domain, and the consistency of the two software was evaluated to help further explain the mechanism by which the fusion protein exerts its biological effects. The results are shown in Figure 12 and Figure 13 . Among them, the amino acids predicted by the COILS software to have a coiled-coil domain are at positions 791-822AA and 835-881AA, while the Paircoil2 software predicts them to be at positions 779-822AA and 841-875AA. The predictions of the two software are in good agreement.

[0227] Homology modeling was performed using swiss-model (see Figures 14 - 16 ), and it was found that the TXLNB-FGFR2 fusion protein retained the functional domain of the FGFR2 protein.

[0228] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A TXLNB-FGFR2 fusion gene, characterized in that, The DNA sequence of the fusion gene is shown in SEQ ID NO.1, and the RNA sequence is shown in SEQ ID NO.

2.

2. A PCR primer for detecting the TXLNB-FGFR2 fusion gene according to claim 1, characterized in that, The primers for detecting the DNA sequence of the fusion gene consist of SEQ ID NO.5 and SEQ ID NO.

6.

3. A PCR primer for detecting the TXLNB-FGFR2 fusion gene recited in claim 1, characterized in that, The primers for detecting the RNA sequence consist of SEQ ID NO.3 and SEQ ID NO.

4.

4. A product for diagnosing juvenile polymorphous low-grade neuroepithelial tumors, characterized in that, The product contains the PCR primers described in claim 2.

5. A product for diagnosing juvenile polymorphous low-grade neuroepithelial tumors, characterized in that, The product contains the PCR primers described in claim 3.

6. The product according to claim 4 or 5, characterized in that, The product is a chip or a kit.

7. Use of the PCR primers according to claim 2 or 3 in the preparation of a product for diagnosing juvenile pleomorphic low-grade neuroepithelial tumors.

8. Use of the TXLNB-FGFR2 fusion gene according to claim 1 in the preparation of a product for diagnosing juvenile pleomorphic low-grade neuroepithelial tumors.

9. The application according to claim 7, characterized in that, The product is a kit.

10. The application according to claim 9, characterized in that, The usage method of the kit is as follows: (1) Extract RNA from the tissue block; (2) Reverse transcribe to obtain cDNA; (3) Perform PCR using the primers in claim 3; (4) Make a judgment based on the amplification result; or (1) Extract DNA from the tissue block; (2) Perform PCR using the primers in claim 2; (3) Make a judgment based on the amplification result.

Images