A method for breeding insect-resistant transgenic poplar trees

Abstract

The application relates to a method for cultivating insect-resistant transgenic poplar trees. In order to solve the problem of poor insecticidal effect caused by uneven expression or unreasonable distribution of toxic proteins of the transgenic poplar plants, the application optimizes infection conditions and a vector system, introduces a plant genome on the main stem of a naturally grown poplar seedling, and the genetic stability of the transgenic plant, the target gene can be stably inherited and expressed in the offspring plants, and the transformation efficiency is high. The content of the toxic proteins in the cortex, phloem, xylem and pith of the transgenic plants obtained by the method is obviously increased, the content of the toxic proteins in the cortex is the highest, the content of the toxic proteins in the phloem, xylem and pith is uniform, and the transgenic plants have good insecticidal effect or good effect of inhibiting the development of larvae. Moreover, the content of the toxic proteins in the transgenic plants can be maintained stable for a long time in the plant, and the content of the toxic proteins changes by not more than 4% between April and the top sealing period.

Description

TECHNICAL FIELD

[0001] The present application relates to a method for cultivating transgenic poplar. BACKGROUND

[0002] In the mid-1990s, the poplar borer broke out in large scale in the three northern regions, with an area of more than 180,000 mu. The poplar borers mainly include Anoplophora glabripennis and Anoplophora nobilis. In the areas where the poplar borer is serious, the poplar damage rate is more than 85%, and the maximum damage rate is more than 90%. Therefore, the insect resistance research has important production significance, and the strong insect resistance is also one of the important indexes of forest tree breeding and afforestation production. In order to solve the above-mentioned insect pests, the genetic engineering technology is widely used in the insect resistance research of poplar. The ecological risk of transgenic forest trees is limited by the long life cycle of trees and the promotion range. The risk level is classified according to the transgenic origin, the influence of reproductive adaptability, and the influence on non-target organisms. The time and space limited release management is adopted for all transgenic plants, and the limited level and management mode are determined. When the genetic drift and the influence on non-target organisms are almost risk-free or extremely low, the non-limited release in the corresponding range can be adopted to evaluate the ecological risk and agricultural benefit. In addition, many scholars at home and abroad also put forward the strategy of setting up biological and physical barriers for the ecological safety of transgenic plants. The biological barrier is to make the genetically engineered trees sterile, etc. At present, the poplar is mainly planted by vegetative propagation, and it has been updated for 8-10 years and has not entered the adult stage, so the probability of polluting the environment by flying pollen of transgenic poplar is small. After fully considering the problems existing in the insect-resistant transgenic poplar and taking necessary countermeasures, the transgenic poplar will have important application prospects in the comprehensive management of poplar harmful organisms.

[0003] In recent years, with the wide application of genetic engineering technology, nearly dozens of poplar species have obtained insect-resistant transgenic plants. Among them, the most commonly used is Bacillus thuringiensis delta-endotoxin Bt gene. For example, the anti-coleoptera pest gene (Cry3A) is introduced into the genome of Populus alba var. pyramidalis by Agrobacterium tumefaciens mediation to obtain transgenic regenerated plants. The Bt gene expresses toxic protein in the plant, and the transgenic regenerated plants have obvious insecticidal effect. However, the expression amount of the target gene in different parts of the transgenic regenerated plants is different, and the expression amount of the toxic protein in the same part at different times is also different. For example, in the poplar branch, the content of toxic protein in xylem is obviously higher than that in phloem. However, there are many kinds of pests, and the biting or living positions are different, which further causes that the insecticidal effect is not ideal due to the uneven or unreasonable distribution of toxic protein expression. SUMMARY

[0004] The present application provides a method for cultivating insect-resistant transgenic poplar trees.

[0005] The method for cultivating insect-resistant transgenic poplar trees according to the present application is performed according to the following steps:

[0006] I. The main branch growing on the main stem of the naturally grown poplar seedling is cut off, and 20-25 cm is reserved; then the end of the main branch is immersed in a solid culture medium containing hairy root Agrobacterium carrying Bt insect-resistant genes, and after hairy roots grow on the end of the main branch, the main branch is taken out from the solid culture medium;

[0007] II. After the main branch with hairy roots grows naturally for 10-20 days, the end of the main branch grows by 1-2 cm, and then the end of the main branch is immersed in a solid culture medium containing hairy root Agrobacterium carrying Bt insect-resistant genes, and after hairy roots grow on the end of the main branch, the main branch is taken out from the solid culture medium;

[0008] III. Step II is repeated 3-5 times;

[0009] IV. After step III is completed, the hairy root Agrobacterium carrying Bt insect-resistant genes in the solid culture medium is replaced with Bt hairy root Agrobacterium carrying insect-resistant genes;

[0010] V. Then the end of the main branch is immersed in a solid culture medium containing Bt hairy root Agrobacterium carrying insect-resistant genes, and after tumors grow on the end of the main branch, the main branch is taken out from the solid culture medium;

[0011] VI. After the main branch with hairy roots grows naturally for 10-20 days, the end of the main branch grows by 1-2 cm, and then the end of the main branch is immersed in a solid culture medium containing Bt hairy root Agrobacterium carrying insect-resistant genes, and after tumors grow on the end of the main branch, the main branch is taken out from the solid culture medium;

[0012] VII. Step VI is repeated 3-5 times;

[0013] VIII. After step VII is completed, the main branch is allowed to grow naturally, and after the end of the main branch grows by 20-30 cm, propagation is performed to obtain transgenic insect-resistant plants.

[0014] The present application optimizes the infection conditions and vector system, introduces plant genomes on the main stem of naturally grown poplar seedlings, and the transformed gene structure is complete, the genetic stability of the transgenic plants, and the target genes can be stably inherited and expressed in the offspring plants, and the transformation efficiency is high.

[0015] The present application can obtain poplar transgenic regenerated plants without using antibiotics for selection and cultivation, reduces the use of screening reagents such as antibiotics, and does not need to perform a regeneration medium process, and also simplifies the cultivation process.

[0016] The content of the toxic protein in the cortex, phloem, xylem and pith of the transgenic plant obtained by the method is obviously increased, and the content of the toxic protein in the bark layer is the highest, the content of the toxic protein in the phloem, xylem and pith is uniform, and the transgenic plant has good effects of killing adult insects or inhibiting the development of larvae. Moreover, the content of the toxic protein in the transgenic plant can be maintained stable for a long time in the plant, and the content of the toxic protein changes by not more than 4% between April and the topping period. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 Figure 1 is a schematic diagram of the structure of a poplar seedling in Example 1 of the present application;

[0018] Figure 2 Figure 2 is a PCR amplification result of the BtCry34 gene of the transgenic poplar in the present application;

[0019] Figure 3 Figure 3 is a graph for testing the content of the toxic protein of the transgenic poplar in the present application;

[0020] Figure 4 Figure 4 is a graph for testing the content of the toxic protein of the transgenic poplar in Comparative Example 1;

[0021] Figure 5 Figure 5 is a graph for testing the content of the toxic protein of the transgenic poplar in Comparative Example 2. DETAILED DESCRIPTION

[0022] The technical solution of the present application is not limited to the following specific embodiments, and also includes any reasonable combination of the specific embodiments.

[0023] Specific embodiment one: the method for cultivating the insect-resistant transgenic poplar in the present embodiment is performed according to the following steps:

[0024] I. The main branch growing on the main stem of the naturally grown poplar seedling is cut off, and 20-25 cm is reserved; then the end of the main branch is immersed into a solid culture medium containing Agrobacterium rhizogenes carrying the Bt insect-resistant gene, and the hairy roots grow on the end of the main branch; and then the main branch is taken out from the solid culture medium;

[0025] II. After the naturally grown main branch with hairy roots grows for 10-20 days, the end of the main branch grows by 1-2 cm, and then the end of the main branch is immersed into a solid culture medium containing Agrobacterium rhizogenes carrying the Bt insect-resistant gene, and the hairy roots grow on the end of the main branch; and then the main branch is taken out from the solid culture medium;

[0026] III. Step II is repeated for 3-5 times;

[0027] IV. After step III is completed, the Agrobacterium rhizogenes carrying the Bt insect-resistant gene in the solid culture medium is replaced by Agrobacterium tumefaciens carrying the Bt insect-resistant gene;

[0028] V. The end of the main branch is immersed into solid medium containing Agrobacterium tumefaciens carrying Bt insect-resistant gene again. After the tumor grows at the end of the main branch, the main branch is taken out from the solid medium;

[0029] VI. After the hairy roots grow naturally for 10-20 days, the end of the main branch grows 1-2 cm. The end of the main branch is immersed into solid medium containing Agrobacterium tumefaciens carrying Bt insect-resistant gene again. After the tumor grows at the end of the main branch, the main branch is taken out from the solid medium;

[0030] VII. Step VI is repeated for 3-5 times;

[0031] VIII. After step VII is completed, the main branch is allowed to grow naturally. After the end of the main branch grows 20-30 cm, propagation is performed to obtain transgenic insect-resistant plants.

[0032] The present embodiment optimizes infection conditions and vector systems to introduce plant genomes on the main stem of naturally grown poplar seedlings. The transformed gene structure is complete. The genetic stability of the transgenic plants is high. The target gene can be stably inherited and expressed in the offspring plants. The transformation efficiency is high.

[0033] The present embodiment does not require the use of antibiotics for selection and cultivation to obtain transgenic poplar regenerative plants. The use of screening reagents such as antibiotics is reduced. The regeneration medium process is not required. The culture process is simplified.

[0034] The content of the toxin protein in the cortex, phloem, xylem and pith of the transgenic plants obtained by the method of the present embodiment is significantly increased. The content of the toxin protein in the bark layer is the highest. The content of the toxin protein in the phloem, xylem and pith is uniform. The transgenic plants have good adult insect killing effect or larva development inhibiting effect. The content of the toxin protein in the transgenic plants can be maintained stable for a long time in the plant. The content of the toxin protein changes by no more than 4% between April and the topping period.

[0035] Specific embodiment two: The difference between the present embodiment and specific embodiment one is that the Agrobacterium rhizogenes in step one and step two is ATCC15834 or LBA9402.

[0036] Specific embodiment three: The difference between the present embodiment and specific embodiment two is that the seedling age of the poplar seedlings in step one is 2 years. The height is 50-70 cm.

[0037] Specific embodiment four: The difference between the present embodiment and one of specific embodiments one to three is that the poplar seedlings in step one are Populus deltoids 108, Populus gansuensis or Populus davidiana.

[0038] Specific embodiment five: The difference between the present embodiment and one of specific embodiments one to four is that the Agrobacterium tumefaciens in step four and step five is AGL1.

[0039] Specific embodiment six: this embodiment is different from one of the specific embodiments one to five in that the solid culture medium in steps one to six is MS solid culture medium.

[0040] Specific embodiment seven: this embodiment is different from one of the specific embodiments one to six in that the temperature for natural growth in steps one to eight is 20-30°C.

[0041] Specific embodiment eight: this embodiment is different from one of the specific embodiments one to seven in that the anti-insect gene in steps one to eight is BtCry3A, BtCry1Aa, BtCry1B, BtCry3Aa.

[0042] Specific embodiment nine: this embodiment is different from one of the specific embodiments one to eight in that the propagation method in step eight is branch layering propagation, cutting propagation on rootstock or water culture propagation.

[0043] Specific embodiment ten: this embodiment is different from one of the specific embodiments one to nine in that after the end of the main branch grows 25 cm, propagation is carried out to obtain transgenic anti-insect plants.

[0044] Example 1

[0045] The method for cultivating anti-insect transgenic poplar in this example is carried out according to the following steps:

[0046] I. The main branch growing on the main stem of the naturally grown poplar seedling is cut off, and 24 cm is reserved; then the end of the main branch is immersed in a solid culture medium containing hairy root Agrobacterium carrying Bt anti-insect gene, and after hairy roots grow at the end of the main branch, the main branch is taken out from the solid culture medium; the hairy root Agrobacterium is ATCC15834; the seedling age of the poplar seedling is 2 years, and the height is 60 cm; the poplar seedling is Populus deltoids x Populus nigra No. 108;

[0047] II. After the main branch with hairy roots naturally grows for 15 days, the end of the main branch grows 1.1 cm, and then the end of the main branch is immersed in a solid culture medium containing hairy root Agrobacterium carrying Bt anti-insect gene, and after hairy roots grow at the end of the main branch, the main branch is taken out from the solid culture medium;

[0048] III. Repeat step II 4 times;

[0049] IV. After step III is completed, replace the hairy root Agrobacterium carrying Bt anti-insect gene in the solid culture medium with Bt anti-insect gene carrying Agrobacterium tumefaciens; the Agrobacterium tumefaciens is AGL1;

[0050] V. Then immerse the end of the main branch in a solid culture medium containing Bt anti-insect gene carrying Agrobacterium tumefaciens, and after tumor grows at the end of the main branch, take out the main branch from the solid culture medium;

[0051] 6. After the main branch with hairy roots has grown naturally for 15 days, the end of the main branch has grown 1.15 cm. Then, the end of the main branch is immersed in a solid culture medium containing Agrobacterium tumefaciens carrying the Bt insect-resistant gene. After the tumor grows at the end of the main branch, the main branch is removed from the solid culture medium.

[0052] 7. Repeat step six four times;

[0053] 8. After step seven is completed, allow the main branch to grow naturally. After the end of the main branch grows to 22cm, propagate it to obtain transgenic insect-resistant plants. The propagation method is branch layering. Four groups of transgenic poplar experimental groups were obtained through branch layering, namely group 1 to group 4. At the same time, negative control and positive control groups were set up. Groups 1 to 4 correspond to the bark (epidermis), phloem, xylem and pith of the branches of transgenic poplar trees, respectively.

[0054] The solid culture medium is MS solid culture medium; the natural growth temperature is 20-30℃; the Bt insect-resistant gene is BtCry3A;

[0055] PCR detection of exogenous genes: Genomic DNA from poplar trees was extracted using the CTAB method for PCR detection of the BtCry3A gene; the primer sequences for the BtCry3A gene were 5'ACCGTCTCTCGTAAGCTCCGTCTT3' and...

[0056] 5'TGCCCAA-CCGAGGACCCCTGGAAG3', amplified fragment length 612bp; PCR amplification conditions were 94℃ for 50s, 52℃ for 60s, 72℃ for 100s, for a total of 20 cycles. Figure 2 The results show the PCR amplification of the BtCry34 gene in transgenic poplar; 1 in the figure is the negative control group (blank control, original seedling of Populus euphratica 108), 2-5 correspond to experimental groups 1-4, and 5 corresponds to the positive control group; through Figure 2 It can be seen that all four groups of transgenic poplar experimental groups were able to amplify the same 612bp specific band after PCR amplification, proving that the BtCry3A gene was successfully integrated into the transgenic poplar.

[0057] The relative content of Bt toxin protein in groups 1-4 and the negative control was determined by ELISA. Figure 3 The graph shows the test results for the toxic protein content in transgenic poplar trees. It can be seen that the relative content of toxic protein is the highest in the bark of the transgenic plants in this embodiment, while the relative content of toxic protein is uniform in the phloem, xylem, and pith. The relative content of toxic protein does not change by more than 4% between April and the topping period. In contrast, the relative content of toxic protein in the negative control group (blank control) changes by more than 9%, and the relative content of toxic protein decreases significantly, especially near the topping period.

[0058] By comparing the relative content of toxic protein test and PCR detection of foreign genes, it can be shown that the introduction of plant genome on the main stem of naturally grown poplar seedlings in this embodiment has genetic stability of transgenic plants, and the target gene can be stably inherited and expressed in the offspring plants, and transgenic poplar regeneration plants can be obtained without using antibiotics for selection and cultivation, reducing the use of screening reagents such as antibiotics and simplifying the culture process.

[0059] Example 2

[0060] The method for cultivating insect-resistant transgenic poplar in this embodiment is carried out according to the following steps:

[0061] I. The main branch growing on the main stem of naturally grown poplar seedlings is cut off, and 24 cm is reserved; then the end of the main branch is immersed in a solid culture medium containing hairy root Agrobacterium carrying Bt insect-resistant genes, and after hairy roots grow at the end of the main branch, the main branch is taken out from the solid culture medium; the hairy root Agrobacterium is ATCC15834; the seedling age of the poplar seedlings is 2 years, and the height is 60 cm; the poplar seedlings are Populus alba L. cv. 108;

[0062] II. After the main branch with hairy roots grows naturally for 15 days, the end of the main branch grows by 1.1 cm, and then the end of the main branch is immersed in a solid culture medium containing hairy root Agrobacterium carrying Bt insect-resistant genes, and after hairy roots grow at the end of the main branch, the main branch is taken out from the solid culture medium;

[0063] III. Repeat step II 4 times;

[0064] IV. After step III is completed, replace the hairy root Agrobacterium carrying Bt insect-resistant genes in the solid culture medium with Bt hairy root Agrobacterium carrying insect-resistant genes; the hairy root Agrobacterium is AGL1;

[0065] V. Then immerse the end of the main branch in a solid culture medium containing hairy root Agrobacterium carrying Bt insect-resistant genes, and after hairy roots grow at the end of the main branch, take the main branch out of the solid culture medium;

[0066] VI. After the main branch with hairy roots grows naturally for 15 days, the end of the main branch grows by 1.15 cm, and then the end of the main branch is immersed in a solid culture medium containing hairy root Agrobacterium carrying Bt insect-resistant genes, and after hairy roots grow at the end of the main branch, the main branch is taken out from the solid culture medium;

[0067] VII. Repeat step VI 4 times;

[0068] Eight, after step seven is completed, let the main branch grow naturally, the main branch end grows 22 cm, then reproduce, and get the transgenic insect-resistant plant; the reproduction method is branch layering reproduction; 4 groups of transgenic poplar experimental groups are obtained through branch layering reproduction, which are group 1 to group 4 respectively, and negative control and positive control groups are set at the same time; group 1 to group 4 respectively correspond to the cortex (epidermis), phloem, xylem and pith in the branches of the transgenic poplar. The composition of the MS solid culture medium is: MS powder 0.49-4.74 g / L, agar 6-7 g / L, pH 5.6-6.0;

[0069] The solid culture medium is MS solid culture medium; the temperature of natural growth is 20-30 DEG C; the Bt insect-resistant gene is BtCry1Aa;

[0070] The relative content of Bt toxin protein in group 1 to group 4 and the negative control is determined by ELISA method; the relative content of toxin protein in the bark layer of the transgenic plant in this embodiment is the highest, the relative content of toxin protein in the phloem, xylem and pith is uniform, and the relative content of toxin protein changes by not more than 4% between April and the top sealing period; and the relative content of toxin protein in the negative control group (blank control) changes more than 8%, especially the relative content of toxin protein significantly decreases near the top sealing period.

[0071] Comparative example 1:

[0072] The method for cultivating insect-resistant transgenic poplar in this comparative example is carried out according to the following steps:

[0073] I. The main branch growing on the main stem of the naturally grown poplar seedling is cut off, and 24 cm is reserved; then the end of the main branch is immersed in a solid culture medium containing hairy root agrobacterium carrying Bt insect-resistant gene, and the hairy roots grow on the end of the main branch; the hairy root agrobacterium is ATCC15834; the seedling age of the poplar seedling is 2 years, and the height is 60 cm; the poplar seedling is No. 108 of European and American poplar;

[0074] II. After the main branch with hairy roots grows naturally for 15 days, the end of the main branch grows 1.1 cm, and then the end of the main branch is immersed in a solid culture medium containing hairy root agrobacterium carrying Bt insect-resistant gene, and the hairy roots grow on the end of the main branch;

[0075] III. Repeat step II for 8 times;

[0076] IV. After step III is completed, let the main branch grow naturally, the main branch end grows 22 cm, then reproduce, and get the transgenic insect-resistant plant; the reproduction method is branch layering reproduction;

[0077] The four groups of transgenic poplar comparison groups are comparison 1-1 group to comparison 1-4 group, which respectively correspond to the cortex (epidermis), phloem, xylem and pith in the branches of the transgenic poplar.

[0078] The solid culture medium is MS solid culture medium; the temperature of natural growth is 20-30 DEG C; the Bt insect-resistant gene is Bt Cry3A;

[0079] The relative content of Bt toxin protein in comparison 1-1 group to comparison 1-4 group is determined by ELISA method. Figure 4 It can be seen that the relative content of toxin protein in the transgenic plant mediated by Agrobacterium tumefaciens carrying Bt insect-resistant gene is far lower than that of experimental group 1 in example 1, and the relative content of toxin protein in different positions has no regularity, and the relative content of toxin protein changes greatly between April and the top sealing period.

[0080] Comparative example 2:

[0081] The method for cultivating insect-resistant transgenic poplar in the present comparative example is carried out according to the following steps:

[0082] I. The main branch growing on the main stem of the natural growth poplar seedling is cut off, and 24 cm is reserved; then the end of the main branch is immersed in the solid culture medium containing Agrobacterium tumefaciens carrying Bt insect-resistant gene, and the hairy roots grow on the end of the main branch; the Agrobacterium tumefaciens is AGL1; the seedling age of the poplar seedling is 2 years, and the height is 60 cm; the poplar seedling is No. 108 of European and American poplar;

[0083] II. After the main branch with hairy roots grows naturally for 15 days, the end of the main branch grows by 1.1 cm, and then the end of the main branch is immersed in the solid culture medium containing Agrobacterium tumefaciens carrying Bt insect-resistant gene, and the hairy roots grow on the end of the main branch; the Agrobacterium tumefaciens is AGL1; the seedling age of the poplar seedling is 2 years, and the height is 60 cm; the poplar seedling is No. 108 of European and American poplar;

[0084] III. Repeat step II for 8 times;

[0085] IV. After step VII is completed, the main branch is allowed to grow naturally, and the end of the main branch grows by 22 cm, and then propagation is carried out to obtain transgenic insect-resistant plants; the propagation method is branch layering propagation; four groups of transgenic poplar comparison groups are obtained by branch layering propagation, which are comparison 2-1 group to comparison 2-4 group, which respectively correspond to the cortex (epidermis), phloem, xylem and pith in the branches of the transgenic poplar. The solid culture medium is MS solid culture medium; the temperature of natural growth is 20-30 DEG C; the Bt insect-resistant gene is Bt Cry3A;

[0086] The relative content of Bt toxin protein in comparison 1-1 group to comparison 1-4 group is determined by ELISA method.Figure 5 For the transgenic Ginkgo toxin protein content test chart in Comparative Example 2, it can be seen that the relative content of toxin protein in the transgenic plant mediated by Agrobacterium carrying Bt insect-resistant gene is far lower than that of Experimental Group 1 of Example 1, and the relative content of toxin protein at different positions has no regularity, and the relative content of toxin protein changes greatly between April and the topping period.

Claims

1. A method for cultivating insect-resistant transgenic poplar trees, characterized in that: The method for cultivating the transgenic poplar with insect resistance is carried out according to the following steps: I. cutting the main branch growing on the main stem of the naturally grown poplar seedling, and reserving 20-25 cm; then immersing the end of the main branch into the solid culture medium containing the hairy root Agrobacterium carrying the Bt insect resistance gene, and taking out the main branch from the solid culture medium after the hairy roots grow on the end of the main branch; II. after the main branch with the hairy roots naturally grows for 10-20 days, the end of the main branch grows 1-2 cm, and then the end of the main branch is immersed into the solid culture medium containing the hairy root Agrobacterium carrying the Bt insect resistance gene, and the main branch is taken out from the solid culture medium after the hairy roots grow on the end of the main branch; III. repeating step II for 3-5 times; IV. after step III is completed, the hairy root Agrobacterium carrying the Bt insect resistance gene in the solid culture medium is replaced by the Bt Agrobacterium tumefaciens carrying the insect resistance gene; V. then the end of the main branch is immersed into the solid culture medium containing the Bt Agrobacterium tumefaciens carrying the insect resistance gene, and the main branch is taken out from the solid culture medium after the tumor grows on the end of the main branch; VI. after the main branch with the hairy roots naturally grows for 10-20 days, the end of the main branch grows 1-2 cm, and then the end of the main branch is immersed into the solid culture medium containing the Bt Agrobacterium tumefaciens carrying the insect resistance gene, and the main branch is taken out from the solid culture medium after the tumor grows on the end of the main branch; VII. repeating step VI for 3-5 times; VIII. after step VII is completed, the main branch is naturally grown, the end of the main branch grows 20-30 cm, and then the propagation is carried out to obtain the transgenic insect-resistant plant.

2. The method of breeding a transgenic poplar tree with insect resistance according to claim 1, characterized in that: The hairy root Agrobacterium is ATCC15834 or LBA9402.

3. The method of breeding insect-resistant transgenic poplar trees according to claim 1, characterized in that: The seedling age of the poplar seedling is 2 years, and the height is 50-70 cm.

4. The method of breeding insect-resistant transgenic poplar trees according to claim 1, characterized in that: The poplar seedling is Populus deltoids 108, Populus deltoids var. Lonsana or Populus deltoids var. Haqing.

5. The method of breeding insect-resistant transgenic poplar trees according to claim 1, characterized in that: The Agrobacterium tumefaciens in step IV is AGL1.

6. The method of breeding insect-resistant transgenic poplar trees of claim 1, wherein: The solid culture medium is MS solid culture medium.

7. The method of breeding transgenic poplar trees with insect resistance according to claim 1, characterized in that: The temperature for the natural growth is 20-30℃.

8. The method of breeding insect-resistant transgenic poplar trees of claim 1, wherein: The insect resistance gene is BtCry3A, BtCry1Aa, BtCry1B or BtCry3Aa.

9. The method of breeding insect-resistant transgenic poplar trees according to claim 1, wherein: The propagation method in step VIII is branch layering propagation, cutting propagation on stock or water culture propagation.

10. The method of breeding insect-resistant transgenic poplar trees of claim 1, wherein: After the end of the main branch grows 25 cm, the propagation is carried out to obtain the transgenic insect-resistant plant.

Images