Nano converter for inducing pyroptosis of cells as well as preparation method and application of nano converter
Targeting the metabolic characteristics of tumor senescent cells through nanoconverters, using cholesterol and hydrogen peroxide to convert them into singlet oxygen, solving the problem of chronic inflammatory tumor intervention, and achieving safe and efficient tumor cell intervention and immunotherapy enhancement.
Patent Information
- Application Number
- CN202510341815.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-21
- Publication Date
- 2025-07-01
AI Technical Summary
The prior art is difficult to efficiently and safely interfere with tumor senescent cells, resulting in the inability to effectively alleviate chronic inflammation of the tumor, affecting the effectiveness of immunotherapy.
A nanoconverter was developed, including energy donor dioxalate, photosensitizer dihydroporphine e6 and cholesterol oxidase, which targets the cholesterol and hydrogen peroxide metabolism characteristics of tumor senescent cells, and converts it into singlet oxygen to induce pyrolysis and interferes with senescent tumor cells.
It has achieved efficient and safe intervention in tumor senescent cells, reduced the risk of phototoxicity, enhanced the efficacy of immunotherapy, and promoted tumor immunotherapy.
Smart Images

Figure CN120227459A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of anti-tumor cell therapy, and specifically relates to a nanoconverter for inducing cell pyroptosis, and a preparation method and application thereof. Background Art
[0002] Cancer is one of the major health problems and the second leading cause of death as the population ages. Compared with traditional tumor treatment strategies such as radiotherapy and chemotherapy, immunotherapy, which uses the human immune system as a tool to treat tumors, has achieved great success in clinical practice. The current poor efficacy of immunotherapy is mainly due to the formation of an immunosuppressive microenvironment by the tumor. Chronic tumor inflammation can shape the immunosuppressive microenvironment by affecting the activity of immune cells and enhancing the immune escape ability of tumor cells. Currently, traditional anti-inflammatory therapies have problems with unclear targets and poor efficacy due to the high heterogeneity of tumors. Therefore, it is of great research significance to find a target that can effectively intervene in chronic inflammation to reshape the tumor immunosuppressive microenvironment.
[0003] Senescent tumor cells can maintain the development of chronic tumor inflammation by continuously releasing inflammatory factors. Therefore, intervention in senescent tumor cells can improve chronic tumor inflammation and enhance the immunotherapy effect of tumors. Although many small molecule compounds have been developed for selective elimination of senescent tumor cells, these small molecule compounds have poor water solubility and large side effects. For example, the anti-aging drug ABT-263 can cause thrombocytopenia in clinical practice. Recently, researchers have designed chimeric antigen receptor T cells that can selectively eliminate senescent cells based on the principle of chimeric antigen receptor T cell immunotherapy (CAR-T). However, this method has the problem of limited targets and is difficult to apply to the treatment of solid tumors. In addition, this method may cause patients to have high cytokineemia. Therefore, it is very important to intervene in senescent tumor cells efficiently and safely to alleviate chronic tumor inflammation. Summary of the invention
[0004] One of the purposes of the present invention is to provide a nanoconverter that induces cell pyroptosis, which can safely and efficiently intervene in tumor senescent cells and induce apoptosis of tumor senescent cells, which is of great significance for further research on tumor cells.
[0005] A second object of the present invention is to provide a method for preparing the nanoconverter.
[0006] A third object of the present invention is to provide applications of the nanoconverter.
[0007] The present invention provides a nano-converter for inducing pyroptosis. The raw materials for preparing the nano-converter include an energy donor, a photosensitizer, cholesterol oxidase, and maleimide-1,2-distearoyl-sn-glycero-3-phosphoethanolamine-poly(ethylene glycol) (Mal-DSPE-PEG).
[0008] The energy donor is bis(2,4,5-trichlorophenyl)oxalate, and its molecular structural formula is shown as follows:
[0009]
[0010] The photosensitizer is chlorin e6, and its molecular structural formula is shown as follows:
[0011]
[0012] In the nano-converter, bis(2,4,5-trichlorophenyl)oxalate and chlorin e6 form a nano-micelle with Mal-DSPE-PEG through hydrophilic-hydrophobic interactions, and cholesterol oxidase is modified on the surface of the nano-micelle by reacting with maleimide.
[0013] The mass ratio of bis(2,4,5-trichlorophenyl)oxalate, chlorin e6, and cholesterol oxidase in the nano-converter is 10:1:0.1.
[0014] The nano-converter is a monodisperse spherical particle with a particle size of 90 - 100 nm.
[0015] The present invention also provides a method for preparing the nano-converter, including the following steps:
[0016] S1. Weigh bis(2,4,5-trichlorophenyl)oxalate, chlorin e6, and Mal-DSPE-PEG according to a preset mass ratio, dissolve them in acetone, and perform ultrasonic treatment to obtain a mixed solution.
[0017] S2. Add the mixed solution obtained in step S1 to deionized water, stir for a preset time, and then perform ultrafiltration to obtain a solution containing nano-micelles.
[0018] S3. Add a preset amount of cholesterol oxidase to the solution containing nano-micelles obtained in step S3, stir for a preset time, and then perform ultrafiltration to obtain the nano-converter.
[0019] Further, in step S1, the mass ratio of bis(2,4,5-trichlorophenyl)oxalate, chlorin e6, and Mal-DSPE-PEG is (10 - 20):(1 - 2):(20 - 40); the power of the ultrasonic treatment is 100 - 120 W, and the time is 30 - 60 s; the mass-volume ratio of bis(2,4,5-trichlorophenyl)oxalate to acetone in the mixed solution is (1 - 1.2):(50 - 60) mg / μL.
[0020] Further, in step S2, the volume ratio of deionized water to acetone in the mixed solution is 16:1; the stirring time is 12 - 15 h, and the stirring temperature is 20 - 25 °C; ultrafiltration is carried out using a 100 kDa ultrafiltration tube.
[0021] Further, in step S3, the addition amount of cholesterol oxidase is one - tenth of the addition amount of chlorin e6 in step S1; the stirring time is 12 - 15 h, and the stirring temperature is 4 - 6 °C; ultrafiltration is carried out using a 100 kDa ultrafiltration tube.
[0022] The present invention also provides an application of the said nanoconverter in inducing pyroptosis of senescent tumor cells.
[0023] Principle of the present invention:
[0024] In tumor - senescent cells, the cholesterol content and hydrogen peroxide content show an increasing metabolic characteristic. At the same time, cholesterol and hydrogen peroxide contribute to maintaining the senescent state of tumor cells. Cholesterol also maintains the immune escape ability of tumor - senescent cells by enhancing the stability of PD - L1 on the cell membrane. Based on this unique metabolic characteristic of tumor - senescent cells, the nanoconverter provided by the present invention can induce cell pyroptosis by converting cholesterol and hydrogen peroxide into singlet oxygen, and selectively intervene in senescent tumor cells through quantitative control. The nanoconverter mainly interferes with the lysosome - mitochondria axis by consuming cholesterol and generating reactive oxygen species, thereby activating caspase - 3 (cysteine - aspartic protease 3). Caspase - 3 cleaves gasdermin E (GSDME), thereby leading to cell pyroptosis.
[0025] The said nanoconverter mainly has three parts; the energy donor bis(2,4,6 - trichlorophenyl)oxalate can respond to hydrogen peroxide to generate chemical energy; the photosensitizer chlorin e6 accepts the energy excitation of the energy donor bis(2,4,6 - trichlorophenyl)oxalate and transfers the energy to oxygen to generate singlet oxygen; cholesterol oxidase consumes cholesterol to generate hydrogen peroxide.
[0026] Advantages of the present invention:
[0027] (1) The nanoconverter disclosed in the present invention targets the unique metabolic characteristics of senescent tumor cells, and has universality and high safety;
[0028] (2) The nanoconverter disclosed in the present invention uses chemical energy to drive photodynamic therapy, reducing the possible phototoxicity. Description of the drawings
[0029] Figure 1 A is the TEM image of the nanoconverter prepared in Example 1; Figure 1 B is the size distribution diagram of the nanomicelles and nanoconverters prepared in Example 1; Figure 1C is the UV-Vis absorption spectra of the nanoconverter prepared in Example 1 and the preparation raw materials;
[0030] Figure 2 A is the chemiluminescence signal intensity diagram of experimental groups A-D in Example 2; Figure 2 B is the comparison diagram of the wavelength of chemiluminescence responsive to hydrogen peroxide and the fluorescence emission wavelength of Ce6; Figure 2 C is the chemiluminescence signal intensity diagram of experimental groups E-H in Example 2; Figure 2 D is the comparison diagram of the wavelength of chemiluminescence responsive to cholesterol and the fluorescence emission wavelength of Ce6;
[0031] Figure 3 A is the fluorescence intensity diagram of experimental groups CPX, CX+H2O2, and CPX+H2O2 in Example 2; Figure 3 B is the singlet oxygen content diagram of different experimental groups after adding DPBF in Example 2;
[0032] Figure 4 is the galactosidase staining diagram of proliferating H460 cells and senescent H460 cells in Example 3;
[0033] Figure 5 is the comparison diagram of the nuclei, cytoskeletons, and merged diagrams of nuclei and cytoskeletons of proliferating H460 cells and senescent H460 cells after cytoskeleton staining in Example 3;
[0034] Figure 6 is the fluorescence comparison diagram of proliferating H460 cells and senescent H460 cells after EdU staining in Example 3;
[0035] Figure 7 A is the comparison diagram of the mRNA content of p21 in proliferating H460 cells and senescent H460 cells in Example 3; Figure 7 B is the comparison diagram of the mRNA content of p16 in proliferating H460 cells and senescent H460 cells in Example 3; Figure 7 C is the comparison diagram of the mRNA content of IL-8 in proliferating H460 cells and senescent H460 cells in Example 3; Figure 7 D is the comparison diagram of the mRNA content of IL-6 in proliferating H460 cells and senescent H460 cells in Example 3;
[0036] Figure 8 is the comparison diagram of the nuclei, CPX, and merged diagrams of nuclei and CPX of proliferating H460 cells and senescent H460 cells after Hoechst 33342 staining;
[0037] Figure 9Figure A shows the comparison of the viability of proliferating H460 cells and senescent H460 cells at the same CPX concentration in Example 4; Figure 9 Figure B shows the fluorescence comparison of live and dead cells under different treatments in Example 4;
[0038] Figure 10 Figure shows the bright-field images and magnified images of cell morphology under different treatments in Example 5;
[0039] Figure 11 Figure shows the comparison map after acridine orange staining under different treatments in Example 5;
[0040] Figure 12 Figure A shows the electron micrographs of proliferating H460 cells and senescent H460 cells treated with CPX in the biological electron microscopy analysis part of Example 5; Figure 12 Figure B shows the enhanced chemiluminescence analysis result map in the Western blot analysis part of Example 5;
[0041] Figure 13 Figure A shows the galactosidase staining map of senescent H460 cells and proliferating H460 cells in the senescent H460 xenograft tumor model in Example 6; Figure 13 Figure B shows the galactosidase staining map of senescent 4T1 cells and proliferating 4T1 cells in the bilateral 4T1 xenograft tumor model;
[0042] Figure 14 Figure A shows the change of H460 tumor volume under different treatments in Example 7; Figure 14 Figure B shows the physical map of the change of H460 tumor volume under different treatments in Example 7;
[0043] Figure 15 Figure shows the change of in-situ tumor volume and distal tumor volume under different treatments in Example 7;
[0044] Figure 16 Figure A shows CD80 + / CD86 + comparison map of the activation degree of antigen-presenting cells under different treatments; Figure 16 Figure B shows the comparison map of the activation degree of CD4+ / CD8 T cells in tumors under different treatments. Detailed implementation method
[0045] Example 1 Synthesis of nanoconverters
[0046] 5 mg of Mal-DSPE-PEG, 0.5 mg of Ce6 and 10 mg of CPPO were dissolved in 500 μL of acetonitrile, and then sonicated at 100 W until the components were fully dissolved. Subsequently, this solution was slowly added to 8 mL of deionized water and stirred for 12 h. The above solution was ultrafiltered using a 100 kDa ultrafiltration tube to obtain nanomicelles CP. Finally, 50 μL of 1 mg / mL COX was added to the above solution and stirred overnight at 4 °C. The solution was ultrafiltered using a 100 kDa ultrafiltration tube to obtain nanoconverter CPX. Other control groups only added the corresponding components. The finally prepared nanoconverter CPX was observed under a TEM microscope. As Figure 1 shown in A, CPX was monodisperse spherical particles with a particle size of about 90 nm. At the same time, as Figure 1 shown in B, the hydrated particle size of CPX increased compared to that of CP, which may be because the surface modification with cholesterol oxidase increased the particle size of the material. As Figure 1 shown in C, the UV-visible absorption spectrum of CPX contained the characteristic peaks of Ce6, CPPO, and COX. All of the above demonstrated the successful preparation of the material.
[0047] Example 2 Characterization of the properties of the nanoconverter
[0048] The nanoconverter converts cholesterol and hydrogen peroxide into chemical energy through cholesterol oxidase and CPPO, and then the chemical energy activates Ce6 to generate singlet oxygen. Therefore, it is necessary to examine whether the nanoconverter can respond to cholesterol in hydrogen peroxide to generate chemical energy and activate Ce6.
[0049] First, it is necessary to experiment whether energy transfer occurs; eight experimental groups were taken for the experiment, specifically including:
[0050] A. 50 μL of CPX prepared in Example 1 (200 μM Ce6) + 50 μL of 1 M hydrogen peroxide;
[0051] B. CP (200 μM Ce6) + 50 μL of 1 M hydrogen peroxide;
[0052] C. Ce6 (200 μM Ce6) + 50 μL of 1 M hydrogen peroxide;
[0053] D. PX (60 ng / mL COX) + 50 μL of 1 M hydrogen peroxide;
[0054] E. 50 μL of CPX prepared in Example 1 (200 μM Ce6) + 50 μL of 1 M cholesterol;
[0055] F. CP (200 μM Ce6) + 50 μL of 1 M cholesterol;
[0056] G.Ce6 (200 μM Ce6) + 50 μL of 1 M cholesterol;
[0057] H.PX (60 ng / mL COX) + 50 μL of 1 M cholesterol.
[0058] Subsequently, their luminescence signals were analyzed using the IVIS system. As Figure 2 shown in A, in experimental groups A - D, as long as CPPO is present, the nanoconverter can respond to hydrogen peroxide to generate chemiluminescence signals. As Figure 2 shown in C, in experimental groups E - H, when both COX and CPPO are present, the nanoconverter can respond to cholesterol to generate chemiluminescence signals. By comparing the wavelength of chemiluminescence and the fluorescence emission wavelength of Ce6 ( Figure 2 B and Figure 2 D), it was found that the wavelength of chemiluminescence was consistent with that of Ce6, indicating that the chemical energy generated by CPPO could excite Ce6.
[0059] Then, a singlet oxygen probe was used to investigate whether the process of singlet oxygen generation caused by energy transfer occurred; first, the singlet oxygen content of three experimental groups, namely CPX, CX + H2O2, and CPX + H2O2, was investigated using a singlet oxygen fluorescence probe. As Figure 3 shown in A, singlet oxygen can only be generated when both hydrogen peroxide and CPPO are present, indicating that Ce6 can be activated by chemical energy to generate singlet oxygen. In addition, the singlet oxygen content generated after adding cholesterol to Ce6, CP, PX, and CPX was investigated using the colorimetric probe 1,3 - diphenylisobenzofuran (DPBF). As Figure 7 shown in B. Only CPX can respond to cholesterol to generate singlet oxygen, indicating that only cholesterol oxidase can oxidize cholesterol to produce hydrogen peroxide. All of the above illustrate that CPX has the ability to respond to hydrogen peroxide and cholesterol to generate singlet oxygen.
[0060] Example 3 Construction of an aging tumor cell model
[0061] In this example, human large cell lung cancer cells (H460) were selected, and chemotherapy drugs (DOX) were used to induce the senescence of H460 cells. The specific steps were as follows:
[0062] The H460 cells were treated with DOX at a concentration of 300 nM for three days, and then the culture medium was replaced with normal fresh medium. The treated H460 cells were cultured for one day to obtain senescent H460 cells, which served as the experimental group.
[0063] A control group was set up, and the control group was proliferating H460 cells that were not treated with DOX.
[0064] The successful construction of senescent cells was demonstrated by senescence-associated β-galactosidase staining, cell proliferation assay, cytoskeleton staining, and reverse transcription quantitative PCR of four senescence-associated genes, p16, p21, SASP (IL-6 and IL-8).
[0065] Senescence-associated β-galactosidase staining: The experimental group and the control group were seeded in 12-well plates (1×10 5 cells per well) and cultured for 24 hours. Then, β-galactosidase assay was performed using a senescence β-galactosidase staining kit (Beyotime, C0602) according to the manufacturer's instructions. Images were collected by an inverted fluorescence microscope (Olympus). As Figure 4 shown, the expression of senescence-associated β-galactosidase in senescent H460 cells induced by DOX stimulation in the experimental group was higher than that in proliferating H460 cells in the control group.
[0066] Cytoskeleton staining: The experimental group and the control group were seeded in confocal dishes (2×10 5 cells per dish) and cultured for 24 hours. Then, cytoskeleton staining was performed using a cytoskeleton green fluorescent probe (Beyotime, C2201S) according to the manufacturer's instructions. Images were collected by a confocal fluorescence microscope (Olympus). As Figure 5 shown, the positive area of the cytoskeleton in senescent H460 cells in the experimental group increased significantly.
[0067] Cell proliferation assay: The experimental group and the control group were seeded in 24-well plates (5×10 4 cells per well) and incubated for 24 hours. Then the cells were stained with EdU (10 μM) for 2 hours according to the manufacturer's protocol (Beyotime, C0071S). Fluorescent images of these cells were obtained using a Lionheart FX automated microscope (BioTek). As Figure 6 shown, there was almost no green fluorescence in senescent H460 cells in the experimental group, indicating that the cells had stopped proliferating.
[0068] Reverse transcription quantitative PCR: Total RNA was isolated using Super Total RNA Extraction Kit (Promega). Then the RNA was reverse transcribed into cDNA using RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific) and SYBR Green qPCR MasterMix (Low ROX, Bimake). Then RT-qPCR was performed on a 7500 RT-qPCR system.
[0069] Using 2-ΔΔCT The method uses glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as an internal reference to calculate the RNA levels of p21, p16, IL-8 and IL-6.
[0070] The primer sequences used for humans are as follows: p16: F: GCTGCCCAACGCACCGAATA, R: ACCACCAGCGTGTCCA.
[0071] IL-8: F: AGACAGCAGAGCACACAAGC, R: ATGGTTCCTTCCGGTGGT;
[0072] p21: F: GACAGCAGAGGAAGACCATGTGGAC, R: GAGTGGTAGAAATCTGTCATGCTG;
[0073] IL-6: F: CCAGGAGCCCAGCTATGAAC, R: CCCAGGGAGAAGGCAACTG;
[0074] GAPDH: F: GAAGGTGAAGGTCGGAGTC, R: TTGAGGTCAATGAAGGGG.
[0075] As Figure 7 shown, p21, p16, IL-8 and IL-6 all have relatively high mRNA contents in the senescent H460 cells in the experimental group, indicating that the senescent H460 cells have been successfully constructed.
[0076] Example 4 Verification of the Targeting and Cytotoxicity of the Nanoconverter
[0077] The senescent H460 cells in the experimental group and the proliferating H460 cells in the control group in Example 3 were used and inoculated in a confocal dish (2×10 5 cells per dish), and cultured for 24 hours. Then, different confocal dishes were incubated with CPX for 2 hours. Immediately afterwards, Hoechst 33342 (Beyotime, C1029) was used for nuclear staining. After washing twice with PBS, images were collected through a fluorescence microscope (Olympus). As Figure 8 shown, CPX can be effectively taken up by senescent cells and proliferating cells, and senescent cells take up more CPX, which may be due to the increased lysosome content in senescent cells.
[0078] The senescent H460 cells in the experimental group and the proliferating H460 cells in the control group in Example 3 were inoculated in a 96-well plate (8×10 3Cells), and incubated for 12 hours. The cells were treated with 100 μL of RPMI-1640 medium (10% FBS) containing different concentrations of CPX for 24 hours. Cell viability was measured using the CCK-8 assay according to the manufacturer's protocol. As Figure 9 shown in A, at the same CPX concentration, the cell viability of senescent cells was significantly lower than that of proliferating cells.
[0079] It was further verified by live / dead cell staining that CPX could interfere with senescent tumor cells. The senescent H460 cells in the experimental group in Example 3 were seeded in confocal dishes (2×10 5 cells per dish), and cultured for 24 hours. Then, they were treated with CPX, Ce6, CP (50 μM Ce6), and PX (15 ng / mL COX) for 24 hours respectively. Subsequently, the cells were stained with calcein / propidium iodide for live / dead cell staining. As Figure 9 shown in B, among different treatments, only CPX treatment led to a decrease in the fluorescence intensity of live cells and a significant increase in the red fluorescence of dead cells in live / dead cell staining.
[0080] Example 5 Verification experiment of nanoparticle converter-induced pyroptosis in senescent tumor cells
[0081] The senescent H460 cells in the experimental group in Example 3 were seeded in 12-well plates (1×10 5 cells per well), and cultured for 24 hours. The cells were treated with CPX, Ce6, CP (50 μM Ce6), and PX (15 ng / mL COX) for 24 hours respectively. The bright-field images of these cells were obtained using a Lionheart FX automated microscope (BioTek) to analyze the cell morphology after different treatments. The results are as Figure 10 shown. Obvious pyroptosis characteristics, namely the formation of pores and vacuolization on the cell membrane, appeared after CPX treatment.
[0082] Since the mechanism of the nanoparticle converter function is to interfere with the lysosome-mitochondria axis, leading to the cleavage of caspase-3 and the activation of GASME, the integrity of lysosomes, biological electron microscopy analysis, and Western blot analysis were performed on senescent cells treated differently for verification.
[0083] Analysis of lysosome integrity: The integrity of lysosomes after different treatments was examined using acridine orange dye. The senescent H460 cells were seeded in confocal dishes (2×10 5Cells) and cultured for 24 hours. The cells were treated with CPX, Ce6, CP (50 μM Ce6), and PX (15 ng / mL COX) for 12 hours. Subsequently, the cells were washed twice with PBS and then stained with acridine orange staining working solution. Images were collected by fluorescence microscopy (Olympus). As Figure 11 shown, the yellow fluorescence decreased significantly after CPX treatment, which may be due to the rupture of lysosomes resulting in an increase in the pH inside the lysosomes and a decrease in the red fluorescence of acridine orange.
[0084] Bioelectron microscopy analysis: Proliferating H460 cells and senescent H460 cells were seeded in large dishes (1×10 6 cells per dish, one large dish for proliferating cells / two large dishes for senescent cells) and cultured for 24 hours. One group of senescent cells was treated with CPX (50 μM Ce6) for 24 hours. The proliferating and senescent cells were digested and fixed with electron microscopy fixative, and their samples were analyzed by TEM. As Figure 12 shown in A, the cell volume of senescent cells was significantly larger. After CPX treatment, obvious vacuolization occurred in the cells and the mitochondrial cristae structure was lost.
[0085] Western blot analysis: Proliferating H460 and senescent H460 cells were seeded in 6-well plates (2×10 5 cells per well). After the cells adhered, the proliferating H460 cells were treated with PBS or CPX (50 μM Ce6) for 4 hours. The senescent NCI-H460 cells were treated with CPX, Ce6, CP (50 μM Ce6), and PX (15 ng / mL COX) for 4 hours, respectively. Subsequently, the cells were washed twice with PBS and lysed using RIPA lysis buffer containing protease inhibitor mixture. The protein concentration was determined using a BCA protein assay kit (Thermo Fisher Scientific). For electrophoresis, 20 μg of each protein sample was loaded onto a sodium dodecyl sulfate-polyacrylamide gel and then transferred to a nitrocellulose membrane. The membrane was blocked with skim milk powder at room temperature for 1 hour and then incubated with primary antibodies against the target proteins (anti-caspase-3 antibody: Beyotime, AF1675; anti-tubulin antibody: CST, D71G9; anti-PD-L1 antibody: CST, E1L3N; anti-GSDME antibody: Abcam, ab215291) at 4 °C overnight. Then, the membrane was incubated with the corresponding secondary antibody (anti-rabbit IgG, HRP-linked, CST, 7074P2) at room temperature for 1 hour. Finally, the target protein expression levels were detected by enhanced chemiluminescence (ECL) analysis. AsFigure 12 As shown in B, after treating senescent H460 cells with CPX, GSDME was significantly decreased and its upstream pathway caspase-3 was cleaved, indicating that CPX might induce pyroptosis by damaging mitochondria.
[0086] Example 6 Construction of senescent H460 xenograft tumor model
[0087] To construct a senescent H460 xenograft tumor model, H460 cells (5×10 6 ) resuspended in 1640 were mixed evenly with Matrigel (volume ratio 2:1), and the mixture was subcutaneously injected into the back of 4-5-week-old female BALB / c nude mice. Subsequently, the tumor size and body weight of each group were monitored. When the size of the H460 xenograft tumor reached 20-40 mm 3 , the mice were intraperitoneally injected with a dose of 1 mg / kg of DOX three times within one week. After this treatment, the tumor size and body weight of each group were continuously monitored. According to the manufacturer's instructions, we used a senescence β-galactosidase staining kit (Beyotime, C0602) to perform β-galactosidase analysis on tumor frozen sections. As Figure 13 shown in A, the tumor sections after DOX stimulation showed obvious blue-green color, indicating that DOX treatment could induce senescence in H460 tumor tissues.
[0088] To construct a bilateral 4T1 xenograft tumor model, 4T1 cells (1×10 6 ) resuspended in 1640 were subcutaneously injected into the right side of 4-5-week-old female BALB / c mice. The tumor on the right side was called the senescent orthotopic tumor. When the tumor size reached 30 mm 3 , the mice were intraperitoneally injected with a dose of 1 mg / kg of DOX three times within one week. After that, 4T1 cells (1×10 6 ) were subcutaneously injected on the left side, which was called the distal tumor. Then these mice underwent subsequent in vivo experiments and the tumor size and body weight of each group were continuously monitored. According to the manufacturer's instructions, a senescence β-galactosidase staining kit (Beyotime, C0602) was used to perform β-galactosidase analysis on tumor frozen sections. As Figure 13 shown in B, the tumor sections after DOX stimulation showed obvious blue color, indicating that DOX treatment could induce senescence in 4T1 tumor tissues.
[0089] Example 7 Application of nanoconverters to senescent tumor cells
[0090] When the H460 tumor size reached approximately 50 mm 3When the mice with senescent H460 xenograft tumors were randomly divided into five groups (n = 5 per group). These groups were injected with 100 μL of PBS, Ce6 (1.5 mg / mL), CP (1.5 mg / mL Ce6), CPX (1.5 mg / mL Ce6), and PX (0.75 mg / mL COX) via the tail vein on days 1, 3, and 4, respectively. Subsequently, tumor size and body weight were measured daily. The tumor volume (V) was calculated according to the formula V = AB2 / 2, where A and B represent the length and width of the tumor (unit: millimeter), respectively. As Figure 14 shown, CPX significantly inhibited the growth of H460 tumors, and the volume of H460 tumors treated with CPX was smaller than that of other control groups on day 14. This indicates that CPX can enhance the efficacy of DOX chemotherapy.
[0091] Meanwhile, the nano-converter provided by the present invention was used for the mice treated with immune checkpoint blockade therapy to verify whether its effect took effect, including the following steps:
[0092] The mice carrying right-sided senescent 4T1 xenograft tumors were randomly divided into three groups (n = 5 per group). As a control, a group of mice with proliferating H4604T1 xenograft tumors (n = 5) was used. These tumor-bearing mice were randomly assigned to four groups: PBS group, αPD-1S group, αPD-1P group, and CPX + αPD-1 group. On day 0, 4T1 cells (distal tumor, 1×10 6 ) were subcutaneously injected on the left side. The mice in the CPX + αPD-1 group were injected with 20 μL of CPX (containing 1.5 mg / mL Ce6) into the in-situ tumor on days 0, 2, and 4. Meanwhile, the mice in the αPD-1S, αPD-1P, and CPX + αPD-1 groups were intraperitoneally injected with 5 mg / kg of anti-PD-1 antibody (BioXcell, BE0146) on days 0, 2, and 4. Subsequently, tumor size and body weight were continuously monitored.
[0093] Furthermore, immune cells were further analyzed. As Figure 16 shown in A, the CPX combined with anti-PD-1 therapy significantly enhanced the CD80 + / CD86 + antigen-presenting cells in the spleen tissue, indicating that the CPX combined with immunotherapy promotes the activation of antigen-presenting cells. As Figure 16 shown in B, by analyzing the T cells in the in-situ tumor, it was found that the CD4+ / CD8 T cells in the tumor were significantly increased, indicating that CPX can significantly increase the activation of T cells in the tumor.
Claims
1. A nanoconverter for inducing cell pyroptosis, characterized in that: The raw materials for preparing the nanoconverter include an energy donor, a photosensitizer, cholesterol oxidase and maleimide-1,2-distearoyl-sn-glycero-3-phosphoethanolamine-poly(ethylene glycol); the mass ratio of bisoxalate, dihydrochlorin e6 and cholesterol oxidase in the nanoconverter is 10:1:0.
1.
2. The nanoconverter for inducing cell pyroptosis according to claim 1, characterized in that: The energy donor is bisoxalate, and its molecular structure is shown below:
3. The nanoconverter for inducing cell pyroptosis according to claim 1, characterized in that: The photosensitizer is dihydrochlorin e6, and its molecular structure is shown below:
4. The nanoconverter for inducing cell pyroptosis according to claim 1, characterized in that: In the nanoconverter, bisoxalate and dihydrochlorin e6 form nanomicelles with Mal-DSPE-PEG through hydrophilic-hydrophobic interaction, and cholesterol oxidase is modified on the surface of the nanomicelles through reaction with maleimide.
5. The nanoconverter for inducing cell pyroptosis according to claim 1, characterized in that: The nanoconverter is a monodisperse spherical particle with a particle size of 90-100 nm.
6. A method for preparing the nanoconverter according to any one of claims 1 to 5, characterized in that: The following steps are involved: S1. Weighing bisoxalate, dihydrochlorin e6 and Mal-DSPE-PEG according to a preset mass ratio, dissolving them in acetone, and performing ultrasonic treatment to obtain a mixed solution; S2. The mixed solution obtained in step S1 is added to deionized water, stirred for a preset time, and then ultrafiltered to obtain a solution containing nano-micelles; S3. Add a preset amount of cholesterol oxidase to the solution containing nano-micelles obtained in step S3, stir for a preset time, and then perform ultrafiltration to obtain the nano-converter.
7. The method for preparing a nanoconverter according to claim 6, characterized in that: In step S1, the mass ratio of bisoxalate, dihydrochlorin e6 and Mal-DSPE-PEG is (10-20):(1-2):(20-40); the power of the ultrasonic treatment is 100-120W, and the time is 30-60s; the mass volume ratio of bisoxalate to acetone in the mixed solution is (1-1.2):(50-60) mg / μL.
8. The method for preparing a nanoconverter according to claim 6, characterized in that: In step S2, the volume ratio of the deionized water to the acetone in the mixed solution is 16:1; the stirring time is 12 hours, and the stirring temperature is 20-25° C.; and the ultrafiltration is performed using a 100 kDa ultrafiltration tube.
9. The method for preparing a nanoconverter according to claim 6, characterized in that: In step S3, the amount of cholesterol oxidase added is one tenth of the amount of dihydrochlorin e6 added in step S1; the stirring time is 12-15 hours, and the stirring temperature is 4-6° C.; and the ultrafiltration is performed using a 100 kDa ultrafiltration tube.
10. Use of the nanoconverter according to any one of claims 1 to 5 or the nanoconverter prepared by the preparation method according to any one of claims 6 to 9 in inducing pyroptosis of senescent tumor cells.