Monascus strain and application thereof

Abstract

The invention provides a monascus strain, monascus, monascus decoction pieces, a preparation method of monascus, a monascus extract and a medicine. The Latin chemical name of the monascus purpureus strain is Monascus purpureus, and the preservation number of the monascus purpureus strain is CGMCC (China General Microbiological Culture Collection Center) No.40777. In a monascus product prepared by fermentation of the monascus strain provided by the invention, the content of lovastatin compounds and the content of extracts are high, and the monascus product contains polyhydroxy sterol and flavonoid components and is good in safety, so that the pharmaceutical activity and quality of the monascus product are improved.

Description

Technical Field

[0001] This application relates to the field of microbial fermentation, and specifically relates to a Monascus strain, Monascus, Monascus cut pieces, a preparation method of Monascus, a Monascus extract, and a drug. Background Art

[0002] Monascus is a traditional fermented product in China. Due to different main components, it is applied in different fields such as pharmaceuticals, food, and dyeing. The discovery of lovastatin compounds in Monascus has made Monascus the first choice for inhibiting cholesterol synthesis and reducing blood lipids in natural medicines and has attracted worldwide attention.

[0003] There are many types of lovastatin compounds, specifically lovastatin (Monacolin K (MK)), lovastatin acid (Acid form of Monacolin K (MKA)), lovastatin J (Monacolin J (MJ)), lovastatin J acid (Acidform of Monacolin J (MJA)), lovastatin L (Monacolin J (ML)), lovastatin L acid (Acid form ofMonacolin L (MLA)), lovastatin M (Monacolin M (MM)), lovastatin M acid (Acid form ofMonacolin M (MMA)), dehydrolovastatin (Dehydromonacolin K (DMK)). In some content determination methods, monacolin K is the sum of the contents of lovastatin and lovastatin butyric acid and is the detection index of Monascus. However, research has shown that the other lovastatin compounds also have high cholesterol synthesis inhibitory and blood lipid-lowering activities. Therefore, while increasing the contents of lovastatin and lovastatin butyric acid, increasing the overall content of lovastatin compounds can also improve the drug activity of Monascus.

[0004] Currently, the form of Monascus as a natural lipid-lowering drug is usually Monascus cut pieces. The state and some provinces and cities have put forward initiative standards for the extractives and the content of lovastatin compounds in Monascus cut pieces to ensure the lipid-lowering effect of Monascus cut pieces. Extractives refer to the determination of soluble substances in medicinal materials and cut pieces using water or alcoholic solvents, and the content of the extractives of the medicinal materials is used as the standard for its quality control, which is generally used when the active ingredients in the medicinal materials have very low contents or the index ingredients are unclear or there is no precise quantitative method. Medicinal Monascus contains a variety of active ingredients and has various pharmacological effects, such as sterols, r-aminobutyric acid, pigments, organic acids, etc., and has effects such as regulating blood lipids, lowering blood sugar, lowering cholesterol, enhancing immunity, and anti-tumor. Therefore, using extractives as quality control can objectively measure the comprehensive pharmacological effects of Monascus products. Therefore, the content of extractives and the content of lovastatin compounds in Monascus products are the key to the quality of Monascus.

[0005] It was found that there were significant differences in the contents of leachates, lovastatin and lovastatin acid, citrinin, and aflatoxin in commercially available products, which are recorded in Table 1.

[0006] Table 1

[0007]

[0008] There are commercially available cut crude drug products with qualified leachates but without the contents of the active ingredients lovastatin and lovastatin acid, and with increased leachate content, increased contents of the toxic and harmful components citrinin and aflatoxin. Or they contain lovastatin but have unqualified leachate content.

[0009] In addition, the content of toxic components also affects the safety of red yeast rice and limits its application. Summary of the Invention

[0010] The present application provides a Monascus strain, red yeast rice, red yeast rice cut crude drug, a preparation method of red yeast rice, a red yeast rice extract, and a drug to increase the contents of lovastatin compounds and leachates in red yeast rice, red yeast rice cut crude drug or their products.

[0011] The first aspect of the present application provides a Monascus strain with the Latin scientific name Monascus purpureus and the deposit number CGMCC No. 40777.

[0012] The second aspect of the present application provides a red yeast rice fermented with the Monascus strain provided in the first aspect.

[0013] In any embodiment of the second aspect, based on the dry matter of red yeast rice, the content of lovastatin compounds in red yeast rice is 4 mg / g - 40 mg / g, preferably 6 mg / g - 30 mg / g, and more preferably 7.0 mg / g - 22 mg / g.

[0014] In any embodiment of the second aspect, preferably the lovastatin compounds include lovastatin and lovastatin acid. Based on the dry matter of red yeast rice, preferably the content of lovastatin in red yeast rice is 3.07 mg / g - 13.5 mg / g, further preferably 7.25 mg / g - 13.5 mg / g, and further preferably 8.5 mg / g - 13.5 mg / g; based on the dry matter of red yeast rice, preferably the content of lovastatin acid in red yeast rice is 2.0 mg / g - 5.0 mg / g, further preferably 2.3 mg / g - 4.25 mg / g, and further preferably 3.5 mg / g - 4.23 mg / g.

[0015] In any embodiment of the second aspect, it is further preferred that the lovastatin compounds further include lovastatin L, lovastatin M acid, and dehydro lovastatin. Based on the dry matter of red yeast rice, it is preferred that the content of lovastatin L in red yeast rice is 0.3 mg / g - 1.33 mg / g, preferably 1.12 mg / g - 1.33 mg / g; it is preferred that the content of lovastatin M acid in red yeast rice is 0.27 mg / g - 0.81 mg / g, preferably 0.72 mg / g - 0.81 mg / g; it is preferred that the content of dehydro lovastatin in red yeast rice is 0.2 mg / g - 0.78 mg / g, preferably 0.65 mg / g - 0.78 mg / g.

[0016] In any embodiment of the second aspect, it is more preferred that the lovastatin compounds further include lovastatin L acid, lovastatin J, and lovastatin J acid. Based on the dry matter of red yeast rice, it is preferred that the content of lovastatin L acid in red yeast rice is 0.29 mg / g - 0.46 mg / g, preferably 0.41 mg / g - 0.46 mg / g; it is preferred that the content of lovastatin J in red yeast rice is 0.11 mg / g - 0.43 mg / g, preferably 0.41 mg / g - 0.43 mg / g; it is preferred that the content of lovastatin J acid in red yeast rice is 0.16 mg / g - 0.28 mg / g, preferably 0.27 mg / g - 0.28 mg / g.

[0017] In any embodiment of the second aspect, based on the dry matter of red yeast rice, it is preferred that the content of the extract in red yeast rice is greater than 7%, preferably the extract content is 7.5% - 30%; preferably the extract content is 8% - 30%; preferably the extract content is 10% - 29%; preferably the extract content is 15% - 25%; preferably the extract content is 17.4% - 23.6%.

[0018] The third aspect of the present application provides a red yeast rice decoction piece prepared from the red yeast rice provided in any embodiment of the second aspect.

[0019] The fourth aspect of the present application provides a preparation method of red yeast rice. The preparation method includes fermenting to prepare red yeast rice by using the red yeast rice enzyme strain provided in the first aspect as the strain.

[0020] In any embodiment of the fourth aspect, the above preparation method includes: performing an enlarged culture on the red yeast mold strain by using a liquid medium to obtain a liquid strain; inoculating the liquid strain in a solid medium for fermentation to obtain a fermentation product containing red yeast rice.

[0021] In any embodiment of the fourth aspect, the liquid medium includes glucose, peptone, a phosphorus source, and trace elements.

[0022] In any embodiment of the fourth aspect, preferably, the content of glucose in the liquid medium is 30 g / L - 150 g / L; preferably, the content of peptone in the liquid medium is 2 g / L - 30 g / L; preferably, the content of phosphorus source in the liquid medium is 0.5 g / L - 7 g / L, and preferably, the phosphorus source includes NH4H2PO4 and (NH4)2HPO4.

[0023] In any embodiment of the fourth aspect, preferably, the trace elements include magnesium element and calcium element. Further preferably, MgSO4·7H2O is used to provide magnesium element, and the content of MgSO4·7H2O in the liquid medium is 0.01 g / L - 1.2 g / L. Further preferably, CaCl2 is used to provide calcium element, and the content of CaCl2 in the liquid medium is 0.01 g / L - 0.8 g / L.

[0024] In any embodiment of the fourth aspect, preferably, the liquid of the liquid medium includes starch aqueous solution.

[0025] In any embodiment of the fourth aspect, the solid medium includes rice, wheat bran, peptone, glucose and water.

[0026] In any embodiment of the fourth aspect, preferably, by weight, the solid medium includes 100 parts of rice, 6 parts - 9 parts of wheat bran, 2 parts - 8 parts of peptone, and 1.4 parts - 3.0 parts of glucose; preferably, the solid medium further includes ethanol. Further preferably, the mass content of ethanol relative to the dry matter of the solid medium is 0.2% - 1%, and more preferably 0.35% - 0.7%.

[0027] In any embodiment of the fourth aspect, preferably, the solid medium further includes soybean powder. Further preferably, the weight of the soybean powder is 2 parts - 8 parts, and further preferably, the soybean powder is selected from one or more of green soybean powder, mung bean powder, black soybean powder, red bean powder and yellow soybean powder.

[0028] In any embodiment of the fourth aspect, preferably, the rice is steamed, boiled or hot-dipped, and further preferably steamed or hot-dipped.

[0029] In any embodiment of the fourth aspect, preferably, the steaming temperature is 90°C - 120°C, and the steaming time is 25 min - 50 min, preferably 35 min - 45 min.

[0030] In any embodiment of the fourth aspect, preferably, the mass addition ratio of the added water relative to the rice during steaming is 30% - 70%, and more preferably 40% - 55%.

[0031] In any embodiment of the fourth aspect, preferably, during hot-dipping, the hot-dipping temperature is 90°C - 100°C, and the hot-dipping time is 6 h - 18 h, more preferably 10 h - 14 h.

[0032] In any embodiment of the fourth aspect, the process of inoculating liquid spawn into a solid medium for fermentation includes: after sterilizing the solid medium, inoculating the liquid spawn into the solid medium. Preferably, the temperature for sterilization is 120°C - 125°C and the time is 30 min - 90 min; culturing the inoculated solid medium at 30°C - 36°C and a relative humidity of 40% - 80% for 48 h - 120 h for primary culturing to obtain a primary culture; culturing the secondary culture at 18°C - 25°C and a relative humidity of 40% - 80% for 7 days - 30 days, preferably 7 days - 20 days, to obtain a fermented system.

[0033] In any embodiment of the fourth aspect, when the primary culturing lasts for 48 h - 120 h, water is added to the solid medium and the solid medium is stirred. The addition amount of water is 5% - 15% of the dry matter mass of the solid medium, preferably 6% - 10%.

[0034] The fifth aspect of the present application provides a red yeast rice extract, which is prepared by extracting the red yeast rice provided in any embodiment of the second aspect with water or ethanol.

[0035] The sixth aspect of the present application provides a drug, including red yeast rice or a red yeast rice extract. The red yeast rice includes the red yeast rice provided in any embodiment of the second aspect, or the red yeast rice decoction pieces provided in any embodiment of the third aspect. The red yeast rice extract includes the red yeast rice extract provided in any embodiment of the fifth aspect. The drug is selected from lipid-lowering drugs, antihypertensive drugs, hypoglycemic drugs, and / or anticancer drugs.

[0036] In the red yeast rice product prepared by fermenting with the Monascus purpureus strain provided by the present application, the contents of lovastatin compounds and extracts are both relatively high, and it contains polyhydroxy sterols and flavonoid components, and has good safety, thereby improving the pharmaceutical activity and quality of the red yeast rice product.

[0037] Biological material preservation information

[0038] The Monascus purpureus strain provided by the present invention was deposited at the China General Microbiological Culture Collection Center (CGMCC) on August 4, 2023. The deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, 100101. The deposit number is CGMCC No. 40777. The name of the culture is Monascus purpureus, and the Latin name is Monascus purpureus. Description of the drawings

[0039] To more clearly illustrate the technical solutions of the embodiments of the present application, the accompanying drawings required for the embodiments of the present application will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present application. For those of ordinary skill in the art, without creative efforts, other accompanying drawings can be obtained based on the accompanying drawings.

[0040] Figure 1 Shows the lethality rates at different chemical mutagenesis times during the screening process of the Monascus purpureus strain of the present application.

[0041] Figure 2 Shows the lethality rates at different ultraviolet mutagenesis times during the screening process of the Monascus purpureus strain of the present application.

[0042] Figure 3 Shows the colony morphology and microscopic feature diagrams of the Monascus purpureus of the present application.

[0043] Figure 4 Shows the fingerprint spectra of the Monascus purpureus tablets obtained at 15 days and 26 days in Example 5 of the present application.

[0044] Figure 5 Shows the liquid chromatography diagram of aflatoxin in the Monascus purpureus tablets obtained at 26 days in Example 5 of the present application.

[0045] Figure 6 Shows the liquid chromatography diagram of citrinin in the Monascus purpureus tablets obtained at 26 days in Example 5 of the present application. Detailed implementation manners

[0046] The following further describes the implementation manners of the present application in detail in conjunction with the accompanying drawings and embodiments. The detailed descriptions of the following embodiments are used to exemplarily illustrate the principles of the present application, but cannot be used to limit the scope of the present application, that is, the present application is not limited to the described embodiments.

[0047] As analyzed in the background technology of the present application, the contents of lovastatin compounds and extracts in existing Monascus products cannot be improved simultaneously. To solve this problem, the present application provides a Monascus purpureus strain, Monascus purpureus, Monascus purpureus tablets, and a preparation method of Monascus purpureus.

[0048] In the first implementation manner of the present application, a Monascus purpureus strain is provided. The Latin name of the Monascus purpureus strain is Monascus purpureus, and the preservation number is CGMCC No. 40777.

[0049] In the Monascus purpureus product fermented and prepared by using the Monascus purpureus strain provided by the present application, the contents of lovastatin compounds and extracts are both relatively high, and it contains polyhydroxy sterols and flavonoid components, and has good safety, thereby improving the pharmaceutical activity and quality of the Monascus purpureus product.

[0050] In some embodiments, the sequence of the 18S rRNA of the above Monascus strain is as shown in SEQ ID No.1, including an 18S rRNA fragment, the full sequences of ITS I, 5.8S rRNA, ITS2, and a 28S rRNA region sequence fragment:

[0051] 5’-TCATTACCGAGTGCGGGTCCCCTTCGTGGGACCCAA CCTCCCACCCGTGATTATTGTACCTCCTGTTG TTCGGCGCGGCCCCCCGGGGCCCGCCGGAGACATCTTCTCGAACGCTGTCTTTGAAAAGGATTGCTGTCTGAGTAAACATACCAAATCGGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACTGCCCCTCAAGCGCGGCTTGTGTGTTGGGCCGCCGTCCCCTGCGCCTCCGGGCAAGGGGGACGGGCCCGAAAGGCAGTGGCGGCGCCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCAGTAGGTCGGGCCGGGGCCTTTGCCCTCTCCAACCTTTTTTTCCTTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAA-3’。

[0052] In the second embodiment of the present application, a Monascus is provided, which is fermented using the Monascus strain provided in the above first embodiment. The contents of lovastatin compounds and extracts in this Monascus are both relatively high. Moreover, the research of the present invention has found that when the content of the extract increases, no toxic and harmful components are detected, such as citrinin and aflatoxin are not detected.

[0053] In addition, this Monascus can be used as a raw material for functional Monascus or medicinal Monascus. This Monascus can be used as Monascus medicinal materials, decoction pieces, and various raw materials, either directly or after being processed.

[0054] In some embodiments, based on the dry matter of Monascus, the content of lovastatin compounds in Monascus is 4 mg / g - 40 mg / g, preferably 6 mg / g - 30 mg / g, and more preferably 7.0 mg / g - 22 mg / g.

[0055] In some embodiments, preferably, the lovastatin compounds include lovastatin and lovastatin acid. Based on the dry matter of Monascus, preferably, the content of lovastatin in Monascus is 3.07 mg / g - 13.5 mg / g, further preferably 7.25 mg / g - 13.5 mg / g, and further preferably 8.5 mg / g - 13.5 mg / g; preferably, the content of lovastatin acid in Monascus is 2.0 mg / g - 5.0 mg / g, further preferably 2.3 mg / g - 4.25 mg / g, and further preferably 3.5 mg / g - 4.23 mg / g.

[0056] In some embodiments, more preferably, the lovastatin compounds further include lovastatin L, lovastatin M acid, and dehydro lovastatin. Based on the dry matter of Monascus, preferably, the content of lovastatin L in Monascus is 0.3 mg / g - 1.33 mg / g, preferably 1.12 mg / g - 1.33 mg / g; preferably, the content of lovastatin M acid in Monascus is 0.27 mg / g - 0.81 mg / g, preferably 0.72 mg / g - 0.81 mg / g; preferably, the content of dehydro lovastatin in Monascus is 0.2 mg / g - 0.78 mg / g, preferably 0.65 mg / g - 0.78 mg / g; more preferably, the lovastatin compounds further include lovastatin L acid, lovastatin J, and lovastatin J acid. Preferably, the content of lovastatin L acid in Monascus is 0.29 mg / g - 0.46 mg / g, preferably 0.41 mg / g - 0.46 mg / g; preferably, the content of lovastatin J in Monascus is 0.11 mg / g - 0.43 mg / g, preferably 0.41 mg / g - 0.43 mg / g; preferably, the content of lovastatin J acid in Monascus is 0.16 mg / g - 0.28 mg / g, preferably 0.27 mg / g - 0.28 mg / g.

[0057] Many Monascus products do not contain or only contain trace amounts of lovastatin J acid and the content cannot be detected. The Monascus of the present invention contains a certain amount of this component.

[0058] In some embodiments, based on the dry matter of Monascus, preferably, the content of the extract in Monascus is greater than 7%, preferably the extract content is 7.5% - 30%; preferably the extract content is 8% - 30%; preferably the extract content is 10% - 29%; preferably the extract content is 15% - 25%; preferably the extract content is 17.4% - 23.6%

[0059] In the third embodiment of the present application, a red yeast rice slice is provided, which is prepared using any red yeast rice provided in the second embodiment.

[0060] In a fourth embodiment of the present application, a method for preparing red yeast rice is provided. The method comprises using the red yeast rice enzyme strain provided in the first embodiment as a strain to ferment and prepare red yeast rice.

[0061] In the red yeast rice product prepared by fermenting the red yeast rice strain provided in the present application, the content of lovastatin compounds and the content of extracts are both high, thereby improving the pharmaceutical activity of the red yeast rice product.

[0062] In some embodiments of the present application, the preparation method includes: using a liquid culture medium to expand the Monascus strain to obtain a liquid strain; inoculating the liquid strain into a solid culture medium for fermentation to obtain a fermentation product containing Monascus.

[0063] The Monascus strain is first expanded and cultured, and then fermented, thereby improving the fermentation efficiency.

[0064] When the Monascus strain is expanded, the composition of the liquid culture medium used can refer to the composition of the liquid culture medium for the expansion culture of the conventional Monascus strain. In some embodiments, the liquid culture medium includes glucose, peptone, a phosphorus source and trace elements; to improve the efficiency of the expansion culture. In some embodiments, preferably, the content of glucose in the liquid culture medium is 30g / L-150g / L; preferably, the content of peptone in the liquid culture medium is 2g / L-30g / L; preferably, the content of the phosphorus source in the liquid culture medium is 0.5g / L-7g / L, preferably, the phosphorus source includes NH4H2PO4, (NH4)2HPO4; preferably, the trace elements include magnesium and calcium, and it is further preferred that MgSO4·7H2O is used to provide magnesium, and the content of MgSO4·7H2O in the liquid culture medium is 0.01g / L-1.2g / L, and it is further preferred that CaCl2 is used to provide calcium, and the content of CaCl2 in the liquid culture medium is 0.01g / L-0.8g / L; to improve the utilization rate of the liquid culture medium. Preferably, the liquid of the liquid culture medium comprises an aqueous starch solution, such as potato boiled water or an aqueous solution of potato starch.

[0065] When fermenting and culturing liquid spawn, the composition of its solid medium can also refer to the solid medium used in conventional Monascus fermentation culture. In some embodiments, the above solid medium includes rice, wheat bran, peptone, glucose and water. To optimize the nutritional component composition of the solid medium and further increase the yield and extract content of lovastatin compounds, in some embodiments, preferably by weight, the solid medium includes 100 parts of rice, 6-9 parts of wheat bran, 2-8 parts of peptone, and 1.4-3.0 parts of glucose.

[0066] In some embodiments, the solid medium further includes ethanol. Further preferably, the mass content of ethanol relative to the dry matter of the solid medium is 0.2%-1%, preferably 0.35%-0.7%. Among them, ethanol is used to inhibit miscellaneous bacteria and the role of trace alcoholic metabolic factors.

[0067] In some embodiments of the present application, the solid medium further includes soybean powder. Preferably, the weight of the soybean powder is 2-8 parts. Further preferably, the soybean powder is selected from one or more of green soybean powder, mung bean powder, black soybean powder, red bean powder, and yellow soybean powder to further increase the content of lovastatin compounds and the extract content.

[0068] The above rice can be selected as rice flour or rice grains. In some embodiments, to improve the fermentation efficiency of rice, preferably, the rice is steamed, boiled, hot-soaked or cold-soaked, and further preferably steamed or hot-soaked. The rice in the above form is more easily utilized by Monascus after being cooked, so it is more beneficial to improve the fermentation efficiency.

[0069] For example, rice and water are mixed in a ratio of (30-120):100 by mass of water to rice (the mass percentage of rice in the above solid medium is calculated based on the dry weight of rice), and then steamed, boiled, hot-soaked or cold-soaked. After boiling, hot-soaking or cold-soaking, drain the water and use.

[0070] In some embodiments, when the rice is steamed, boiled or hot-soaked, the weight ratio of water to rice is (30-70):100. For example, when steaming, the mass addition ratio of water to rice is 30%-70%.

[0071] In some embodiments, the steaming temperature is 90°C-120°C (such as 90°C, 100°C, 110°C, 120°C), the mass addition ratio of water to rice is 30%-70%, more preferably 40%-55% (such as 40%, 45%, 50% or 55%), and the steaming time is 25 min-50 min (such as 25 min, 30 min, 35 min, 40 min, 45 min or 50 min), preferably 35 min-45 min.

[0072] In some embodiments, the preferred hot-dip temperature is 50°C - 100°C (such as 60°C, 70°C, 80°C, 85°C, 90°C, 95°C), more preferably 90°C - 100°C, and the hot-dip time is 6h - 18h, preferably 10h - 14h.

[0073] In some embodiments, the process of inoculating liquid spawn into a solid medium for fermentation includes: after sterilizing the solid medium, inoculating the liquid spawn into the solid medium. Preferably, the sterilization temperature is 120°C - 125°C and the time is 30min - 90min; culturing the inoculated solid medium at 30°C - 36°C and relative humidity of 40% - 80% for 48h - 120h for primary culture to obtain a primary culture; culturing the primary culture at 18°C - 25°C and relative humidity of 40% - 80% for 7 days - 30 days, preferably 7 days - 20 days, more preferably 10 days - 20 days, to obtain a fermented system. Through the cultivation of the above fermentation process, the content of lovastatin compounds and extracts can be fully increased, and the production of citrinin and aflatoxin B1 can be reduced, improving the comprehensive quality of red yeast rice.

[0074] After testing, in some embodiments, when the primary culture lasts for 72h - 120h, water is added to the solid medium to supplement the moisture during the fermentation process, and the addition amount of water is 5% - 15% of the dry matter mass of the solid medium. Adding water during or at the end of the high-temperature culture process further increases the content of lovastatin substances and extracts in red yeast rice.

[0075] In some embodiments, the above preparation method after fermentation further includes a process of drying the fermentation product. This process is not only a process of removing moisture, but also a balance process in which some acid components such as lovastatin acid are converted into lactone-type lovastatin. If the conditions are severe, that is, the drying temperature is too high, the acid type and lactone type will degrade or be converted into irreversible dehydrated lovastatin, which will affect the content. The changes of other paired statin components are similar. Therefore, in some embodiments, the drying temperature is 50°C - 100°C, preferably 60 - 70°C, and the drying time is 6h - 15h.

[0076] In some embodiments, the above red yeast rice slices are prepared by the preparation method provided in the second embodiment above.

[0077] The fifth embodiment of the present application provides a red yeast rice extract, which is prepared by extracting any red yeast rice provided in the second embodiment with water or ethanol.

[0078] The sixth embodiment of the present application provides a drug, including red yeast rice or red yeast rice extract. The red yeast rice includes the red yeast rice provided by the second embodiment, or the red yeast rice decoction pieces provided by the third embodiment. The red yeast rice extract includes the red yeast rice extract provided by the fifth embodiment. The drug is selected from lipid-lowering drugs, antihypertensive drugs, hypoglycemic drugs, and / or anti-cancer drugs.

[0079] Since both the leaching content and lovastatin content in the red yeast rice of the present application are relatively high, it has relatively high lipid-lowering, hypoglycemic, and / or antihypertensive effects.

[0080] The beneficial effects of the present application will be further described below in conjunction with examples, but the scope of the present invention is not limited to these examples.

[0081] Experimental instruments and equipment: ZHWY-2102 constant temperature culture oscillator: Shanghai Zhicheng Co., Ltd.; LRH-250-HSE constant temperature and humidity incubator: Pearl River Taihongjun Instrument; BXM-110VE vertical pressure steam sterilizer: Boxun; WGL-230B electric blast drying oven: Tianjin Test Instrument Co., Ltd.; FW80 high-speed universal grinder: Tianjin Test Instrument Co., Ltd.

[0082] Liquid chromatograph: Model LC20AT, Shimadzu Corporation, Japan, UV detector. Chromatographic column: Octadecylsilyl silica gel as filler (Waters Symmetry C18, 3.9×150mm, 5μm). Electronic balance: XS205DU, METTLER; Ultra-pure water instrument: PALL CascadaIX; Ultrasonic cleaner: KH-500DB Kunshan Hechuang Ultrasonic Instrument Co., Ltd.; Rapid moisture analyzer, model MA50, Sartorius.

[0083] Experimental materials and reagents: Acetonitrile: Chromatographic grade, Fisher Company (Lot 211921); Trifluoroacetic acid: Chromatographic grade, Fisher (Lot 145624); 95% ethanol: AR, Sinopharm Chemical Reagent Co., Ltd.; Purified water: Self-made; Methanol: Chromatographic pure, Fisher (Batch No. 157751). Reference substance lovastatin (Monacolin K, National Institutes for Food and Drug Control, purity greater than 99%, batch number: 100600). 1-Methyl-3-nitro-1-nitrosoguanidine (MNNG): Sigma Company, USA.

[0084] Screening process of Monascus strains

[0085] Method for preparing bacterial suspension: The initial strain (No. WP03) was inoculated on PDA medium. After culturing at 29 °C for 7 days, the mycelium and spores were scraped off with an inoculation loop and transferred to a triangular flask containing 20 mL of sterile water. The bottom of the triangular flask was covered with glass beads, and it was shaken at 180 r / min for 20 min. Then, it was filtered to prepare a spore bacterial suspension, and diluted to make the spore concentration 10 6 CFU / mL of bacterial suspension.

[0086] Chemical mutagenesis: Preparation of MNNG solution. Weigh 50 mg of MNNG, place it in a volumetric flask, add acetone to 5 mL to prepare a stock solution with a concentration of 1%. Take 0.9 mL and 0.8 mL of the spore suspension with a concentration of 10 6 CFU / mL, add 0.1 mL and 0.2 mL of the 1% MNNG stock solution (concentrations are 0.1% and 0.2% respectively), and after treating for 10, 30, 60, and 90 min respectively, dilute it in gradients. Take 0.1 mL of the bacterial suspension and spread it on a plate, and culture it at 29 °C for 3 d - 5 d for spore counting. Calculate the lethality rate with the untreated as the control (the lethality rate is shown in Figure 1 ). Take the strain treated with 0.2% MNNG for 90 min under the optimal lethal conditions for the following UV mutagenesis.

[0087] Lethality rate / % = (Number of colonies grown on the control plate - Number of colonies grown on the mutagenized plate) / Number of colonies on the control plate.

[0088] UV mutagenesis: Take the strain mutagenized by MNNG and prepare a spore bacterial suspension of 10 6 CFU / mL according to the above method. Take 5 mL of the spore suspension and place it 20 cm away from a 20 W UV lamp, and irradiate it for 0 s, 30 s, 60 s, 90 s, 120 s, and 180 s respectively. Spread it on a plate in the same way as above, and calculate the lethality rate with the untreated as the control (the lethality rate is shown in Figure 2 ). The final optimal UV irradiation time is 120 s.

[0089] Results After the above repeated chemical and UV mutagenesis, the Monascus mutant strain of the present invention was finally obtained. The Monascus mutant strain is deposited with the China General Microbiological Culture Collection Center (CGMCC), and its deposit number is CGMCC No. 40777.

[0090] The sequence of 18S rRNA of the above Monascus strain is shown in SEQ ID No. 1, including the 18S rRNA fragment, the full sequences of ITS1, 5.8S rRNA, ITS2, and the sequence fragment of the 28S rRNA region:

[0091] 5’-TCATTACCGAGTGCGGGTCCCCTTCGTGGGACCCAA CCTCCCACCCGTGATTATTGTACCTCCTGTTG TTCGGCGCGGCCCCCCGGGGCCCGCCGGAGACATCTTCTCGAACGCTGTCTTTGAAAAGGATTGCTGTCTGAGTAAACATACCAAATCGGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAG AATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTACTGCCCCTCAAGCGCGGCTTGTGTGTTGGGCCGCCGTCCCCTGCGCCTCCGGGCAAGGGGGACGGGCCCGAAAGGCAGTGGCGGCGCCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCAGTAGGTCGGGCCGGGGCCTTTGCCCTCTCCAACCTTTTTTTCCTTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAA-3’。

[0092] The colony morphology and microscopic characteristics of this Monascus are as Figure 3 shown.

[0093] The submitted strain grows relatively fast on the wort agar medium. After culturing for 10 days under dark conditions at 25°C, the colony diameter is 40 - 45 mm. The aerial hyphae are lush. In the initial stage, the color is light (such as Figure 3 the upper left figure of

[0094] ), and later it is orange - red; the back of the colony is dark orange, and the pigment dissolves in the medium. Figure 3 the upper right figure, lower left figure and lower right figure of

[0095] Study on the stability of the strain

[0096] After this strain was subcultured 20 times, the contents of lovastatin and lovastatin acid in the obtained Monascus tablets basically remained unchanged, as shown in Table 2 specifically, indicating that the inventive strain has good stability (using the fermentation conditions of Example 5, the culture period is 23 days).

[0097] Table 2

[0098] Sample type MK (mg / g) MKA (mg / g) New strain, 1st generation 7.98 1.83 After 20 passages 7.92 1.85

[0099] Example 1

[0100] The Monascus strain (with the preservation number of CGMCC No. 40777, hereinafter referred to as Monascus strain 1) and the initial strain (WP03) were inoculated into the liquid fermentation medium at 5% (the volume of the slant bacterial suspension of the strain / the volume of the liquid medium). The liquid fermentation medium was glucose 85 g / L, peptone 15 g / L, NH4H2PO4 1.5 g / L, MgSO4·7H2O 0.8 g / L, CaCl2 0.2 g / L; it was formulated into the fermentation medium with distilled water. The fermentation temperature was 30 °C; the fermentation time was 40 - 48 hours, and it was cultured on a shaker at 30 °C for 2 days.

[0101] The liquid seeds were sucked into the solid medium and stirred evenly. Solid medium: rice, soaked at room temperature (20 °C - 25 °C) for 14 hours, the mass ratio of water to rice was 120:100, the water was drained, and after adding nutrients in proportion (the composition was 100 parts of rice (before adding water), 8 parts of bran, 2 parts of peptone, and 2 parts of glucose), it was stirred evenly; it was subjected to primary culture for 5 days in an environment with a fermentation temperature of 30 °C - 36 °C and a relative humidity of 40% - 80%, and starting from the 6th day, it was subjected to secondary culture in an environment with a temperature of 18 °C - 25 °C and a relative humidity of 40% - 80% until the 25th day to obtain the fermented product. It was dried at 70 °C to obtain red yeast rice. The determination of lovastatin content was carried out with reference to the records in the Pharmacopoeia 2020 Edition.

[0102] The method for determining the extract was carried out by the hot extraction method under the alcohol-soluble extract determination method (General Rule 2201 of the Chinese Pharmacopoeia 2020 Edition), and 70% ethanol was used as the solvent.

[0103] For the detection of citrinin (detection limit 5 ppb), the content of citrinin (same as "citrinin") was detected by referring to the first method (immunoaffinity column purification - high performance liquid chromatography) in the national standard - GB 5009.222 - 2016 "Determination of Citrinin in Foods".

[0104] Among them, the method for detecting aflatoxin was referred to the aflatoxin determination method in the Pharmacopoeia (General Rule 2351, Volume IV of the Chinese Pharmacopoeia 2020 Edition - liquid chromatography / photochemical derivatization method).

[0105] The contents of various statins were detected by high performance liquid chromatography, and the detection method was as follows: Liquid chromatography conditions: Acetonitrile was used as mobile phase A, and 0.1% (volume fraction) trifluoroacetic acid (TFA) aqueous solution was used as mobile phase B. Gradient elution was carried out. From 0 to 28 min, mobile phase A was 35% and mobile phase B was 65% (volume fraction, the same below); from 28 to 30 min, the linear gradient was that mobile phase A decreased from 75% to 35%, and mobile phase B increased from 25% to 65%; from 30 to 35 min, it returned to the initial conditions where mobile phase A was 35% and mobile phase B was 65%. The flow rate was 1.0 mL / min, the column temperature was 30 °C, the injection volume was 20 μL, the PDA was set at 200 - 350, and the detection wavelength was 237 nm.).

[0106] The test results were recorded in Table 3.

[0107] Table 3

[0108]

[0109] The lovastatin content of the strain of the present invention was about 2.14 times that of the initial strain, and it did not contain citrinin and aflatoxin.

[0110] The following uses Monascus strain 1 for fermentation, and examines the treatment method of the rice used in the solid medium, the prescription of the solid medium, and the culture process.

[0111] Example 2

[0112] The rice for the solid medium was as follows:

[0113] Hot-soaked rice: The rice was mixed with high-temperature water (80 °C) and soaked for 4 h, 12 h, and 18 h respectively, maintaining the temperature above 70 °C, and the mass ratio of water to rice was 120:100.

[0114] Boiled rice: The rice was mixed with 100 °C hot water and continuously heated, maintaining the temperature at 90 °C - 100 °C for 2 min, and the mass ratio of water to rice was 120:100.

[0115] Low-temperature soaking: Water at 20 - 25 °C was added and soaked for 14 h, and the mass ratio of water to rice was 120:100.

[0116] Fermentation was carried out according to the fermentation conditions of Example 1, and the extract and lovastatin content in Monascus after fermentation were compared. See Table 4 for details.

[0117] Table 4

[0118]

[0119] It can be seen that hot soaking and boiling the rice have good effects and can significantly increase the content of lovastatin. In particular, the content of lovastatin in the red yeast rice obtained from the solid medium containing boiled rice under the same fermentation conditions is 3.33 times that of the rice soaked at room temperature, and the content of the leachate is increased by 4.5 times. However, it was found in the experiment that the rice was sticky during the boiling process, agglomerated during fermentation, and the fermentation was uneven. Therefore, the treatment method of the rice mainly considered boiling water immersion or steaming.

[0120] Example 3

[0121] Using the hot-soaked rice soaked for 18 hours in Example 2 above as the rice for the solid medium, the effect of alcohol in the solid medium and the process of adding water during the 5-day primary culture process were investigated. The content of peptone and ethanol, as well as the amount of water added (the percentage of water added is the content of the added water based on the dry matter mass of the solid medium) are shown in Table 5.

[0122] Fermentation was carried out according to the fermentation conditions of Example 1, and the content of the leachate and lovastatin in the red yeast rice after fermentation was compared. See Table 5 for details.

[0123] Table 5

[0124]

[0125]

[0126] The results show that when using ethanol or adding water during the primary culture process, the content of lovastatin, lovastatin acid, and the leachate can all be increased.

[0127] Example 4

[0128] The solid medium contains 0.7% ethanol (by weight relative to the dry matter), and experiments were carried out on soaked rice and steamed rice using a process without adding water.

[0129] Among them, the soaking conditions for the soaked rice: soaking temperature 90°C, adding 1.2 times the amount of water, and time 18 hours.

[0130] The conditions for steaming the rice are as follows:

[0131] Condition 1: temperature 110°C, water addition 45% of the weight of the rice, time 40 minutes;

[0132] Condition 2: temperature 90°C, water addition 45% of the weight of the rice, time 50 minutes;

[0133] Condition 3: temperature 120°C, water addition 45% of the weight of the rice, time 25 minutes;

[0134] Condition 4: temperature 110°C, water addition 30% of the weight of the rice, time 40 minutes;

[0135] Condition 5: Temperature is 110°C, the water addition is 70% of the weight of the rice, and the time is 40 minutes.

[0136] In addition, the steamed rice is carried out using the initial strain and Condition 1.

[0137] Fermentation is carried out according to the fermentation conditions of Example 1, and the contents of extractives and lovastatin in the red yeast rice after fermentation are compared. See Table 6 for details.

[0138] Table 6

[0139]

[0140] The result shows that the steamed rice method is more stable than the soaking process, and the lovastatin content is higher.

[0141] In addition, the contents of statins in the red yeast rice obtained by fermenting under Test Conditions 4, Condition 5 and the initial strain are recorded in Table 7 below.

[0142] Table 7

[0143]

[0144] Example 5

[0145] The treatment method of rice in the solid medium is Condition 1 of Example 4. On the basis of fermenting according to the fermentation conditions of Example 1, the process of supplementing 8% of water during the first-stage culture process is adopted, and the culture days are investigated. Starting from 15 days, the appearance, content, extractives, citrinin, aflatoxin B1 and other items all meet the requirements of the strictest pharmaceutical regulations in each province. The contents of extractives and lovastatin in the red yeast rice after fermentation are compared. The results are recorded in Table 8.

[0146] Table 8

[0147]

[0148] It can be seen that the red yeast rice strain 1 of the present application can significantly shorten the fermentation cycle to 15 days, and the contents of components such as lovastatin are already relatively high. For red yeast rice used for different purposes, the fermentation days can be shorter.

[0149] In addition, the fingerprint spectra of the red yeast rice slices obtained in 15 days and 26 days above are recorded in Figure 4 and detected by using the fingerprint spectrum determination method of red yeast rice in the 2020 edition of the Pharmacopoeia. It is found that the red yeast rice of the present invention contains more components, including not only statin compounds, but also flavonoid compounds, sterol compounds, amide compounds, pigments and other components.

[0150] Moreover, Figure 5 and Figure 6The liquid chromatograms of aflatoxin and citrinin in the Monascus prepared slices obtained in 26 days are shown. The Monascus test solution is the test solution of the Monascus prepared slices to be measured, and no peaks appear at the positions corresponding to aflatoxin and citrinin, indicating that their respective contents are 0.

[0151] Example 6

[0152] The treatment method of the rice in the solid medium is Condition 1 of Example 4. On the basis of fermenting according to the fermentation conditions of Example 1, the first-stage culture process uses a water replenishment process (sterilized water is added to the culture container and stirred) to replenish 8% of water, and the culture time is 30 days. Adjust the addition amounts of peptone, green bean powder or mung bean powder in the solid medium (see Table 9 for details).

[0153] Compare the extract and lovastatin contents in the Monascus prepared slices after fermentation. See Table 9 for details.

[0154] Table 9

[0155]

[0156] The results show that when the amount of green bean powder in the solid medium prescription is 5 parts and the amount of peptone is 5 parts, the lovastatin content is 3.19 times that when peptone is used alone, and the lovastatin acid is 1.53 times that when peptone is used alone. In addition, black beans, red beans, and soybeans can also be used in combination or replaced alone.

[0157] In addition, detect the contents of 9 kinds of lovastatin in the Monascus prepared slices obtained in Group 3 and Group 6 in Table 9 and record them in Table 10.

[0158] Table 10

[0159]

[0160]

[0161] It should be noted that this application is not limited to the above embodiments. The above embodiments are only examples, and embodiments with the same structure and the same function and effect as the technical idea within the technical solution scope of this application are all included in the technical scope of this application. In addition, within the scope not departing from the gist of this application, various modifications that can be thought of by those skilled in the art to the embodiments, and other ways constructed by combining some constituent elements in the embodiments are also included in the scope of this application.

Claims

1. A Monascus strain, characterized in that, The Latin name of the Monascus strain is Monascus purpureus, and the preservation number is CGMCC No. 40777.

2. A Monascus, characterized in that, It is obtained by fermenting with the Monascus strain described in claim 1.

3. The monascus according to claim 2, characterized in that, Based on the dry matter of the red yeast rice, the content of lovastatin compounds in the red yeast rice is 4 mg / g - 40 mg / g, preferably 6 mg / g - 30 mg / g, more preferably 7.0 mg / g - 22 mg / g; Preferably, the lovastatin compounds include lovastatin and lovastatin acid. Based on the dry matter of the red yeast rice, preferably the content of lovastatin in the red yeast rice is 3.07 mg / g - 13.5 mg / g, further preferably 7.25 mg / g - 13.5 mg / g, and further preferably 8.5 mg / g - 13.5 mg / g; Based on the dry matter of the red yeast rice, preferably the content of lovastatin acid in the red yeast rice is 2.0 mg / g - 5.0 mg / g, further preferably 2.3 mg / g - 4.25 mg / g, and further preferably 3.5 mg / g - 4.23 mg / g; More preferably, the lovastatin compounds further include lovastatin L, lovastatin M acid, and dehydrolovastatin. Based on the dry matter of the red yeast rice, preferably the content of lovastatin L in the red yeast rice is 0.3 mg / g - 1.33 mg / g, preferably 1.12 mg / g - 1.33 mg / g, preferably the content of lovastatin M acid in the red yeast rice is 0.27 mg / g - 0.81 mg / g, preferably 0.72 mg / g - 0.81 mg / g, preferably the content of dehydrolovastatin in the red yeast rice is 0.2 mg / g - 0.78 mg / g, preferably 0.65 mg / g - 0.78 mg / g; Even more preferably, the lovastatin compounds further include lovastatin L acid, lovastatin J, and lovastatin J acid. Based on the dry matter of the red yeast rice, preferably the content of lovastatin L acid in the red yeast rice is 0.29 mg / g - 0.46 mg / g, preferably 0.41 mg / g - 0.46 mg / g; preferably the content of lovastatin J in the red yeast rice is 0.11 mg / g - 0.43 mg / g, preferably 0.41 mg / g - 0.43 mg / g; preferably the content of lovastatin J acid in the red yeast rice is 0.16 mg / g - 0.28 mg / g, preferably 0.27 mg / g - 0.28 mg / g.

4. The monascus according to claim 2 or 3, characterized in that, Based on the dry matter of the red yeast rice, preferably the content of the extract in the red yeast rice is greater than 7%, preferably the extract content is 7.5% - 30%; preferably the extract content is 8% - 30%; preferably the extract content is 10% - 29%; preferably the extract content is 15% - 25%; Preferably, the extract content is 17.4% - 23.6%.

5. A Monascus prepared slice, characterized in that, It is prepared from the red yeast rice described in any one of claims 2 to 4.

6. A method for preparing red yeast rice, the preparation method includes using the Monascus enzyme strain described in claim 1 as a strain for fermentation to prepare red yeast rice.

7. The preparation method according to claim 6, characterized in that, The preparation method includes: The Monascus strain is enlarged and cultured using a liquid medium to obtain a liquid strain; The liquid strain is inoculated into a solid medium for fermentation to obtain a fermentation product containing Monascus.

8. The preparation method according to claim 7, characterized in that, The liquid medium includes glucose, peptone, a phosphorus source, and trace elements; Preferably, the content of glucose in the liquid medium is 30 g / L - 150 g / L; preferably, the content of peptone in the liquid medium is 2 g / L - 30 g / L; preferably, the content of the phosphorus source in the liquid medium is 0.5 g / L - 7 g / L, and preferably, the phosphorus source includes NH4H2PO4, (NH4)2HPO4; Preferably, the trace elements include magnesium and calcium. Further preferably, MgSO4·7H2O is used to provide magnesium, and the content of MgSO4·7H2O in the liquid medium is 0.01 g / L - 1.2 g / L. Further preferably, CaCl2 is used to provide calcium, and the content of CaCl2 in the liquid medium is 0.01 g / L - 0.8 g / L; Preferably, the liquid of the liquid medium includes a starch aqueous solution.

9. The preparation method according to claim 7 or 8, characterized in that, The solid medium includes rice, bran, peptone, glucose, and water; Preferably, by weight, the solid medium includes 100 parts of rice, 6 - 9 parts of bran, 2 - 8 parts of peptone, and 1.4 - 3.0 parts of glucose; preferably, the solid medium further includes ethanol. More preferably, the mass content of ethanol relative to the dry matter of the solid medium is 0.2% - 1%, and more preferably 0.35% - 0.7%; Preferably, the solid medium further includes soybean powder. More preferably, the weight of the soybean powder is 2 - 8 parts, and more preferably, the soybean powder is selected from one or more of green soybean powder, mung bean powder, black soybean powder, red bean powder, and yellow soybean powder; Preferably, the rice is steamed, boiled, or hot - soaked, and further preferably steamed or hot - soaked; Preferably, the steaming temperature is 90°C - 120°C, and the steaming time is 25 min - 50 min, preferably 35 min - 45 min; Preferably, the mass addition ratio of the water added during steaming relative to the rice is 30% - 70%, and more preferably 40% - 55%; Preferably, during hot - soaking, the hot - soaking temperature is 90°C - 100°C, and the hot - soaking time is 6 h - 18 h, more preferably 10 h - 14 h.

10. The preparation method according to any one of claims 7 to 9, characterized in that, The process of inoculating the liquid strain into the solid medium for fermentation includes: After the solid medium is sterilized, the liquid strain is inoculated into the solid medium. Preferably, the temperature of the sterilization treatment is 120°C - 125°C, and the time is 30 min - 90 min; The inoculated solid medium is subjected to primary culture for 48 h - 120 h in an environment of 30°C - 36°C and relative humidity of 40% - 80% to obtain a primary culture; The secondary culture is subjected to secondary culture for 7 days - 30 days, preferably 7 days - 20 days, in an environment of 18°C - 25°C and relative humidity of 40% - 80% to obtain a post - fermentation system.

11. The preparation method according to claim 10, characterized in that, When the primary culture lasts for 48 h - 120 h, water is added to the solid medium and the solid medium is subjected to stirring treatment. The added amount of water is 5% - 15%, preferably 6% - 10%, of the dry matter mass of the solid medium.

12. A monascus extract, characterized in that, It is prepared by extracting the Monascus purpureus Went described in any one of claims 2 to 4 with water or ethanol.

13. A drug, comprising red yeast rice or red yeast rice extract, characterized in that, The Monascus purpureus Went includes the Monascus purpureus Went described in any one of claims 2 to 4, or the Monascus purpureus Went pieces described in claim 5. The Monascus purpureus Went extract includes the Monascus purpureus Went extract described in claim 12. The drug is selected from lipid-lowering drugs, antihypertensive drugs, hypoglycemic drugs, and / or anticancer drugs.

Images