Recombinant Zika virus and application thereof
By adding the motif of DRACH rules and m6A modification sites in the Zika virus genome, the problem of loss of antigenicity of attenuated vaccines in the prior art was solved, and a recombinant Zika virus with attenuated characteristics was obtained, which is suitable for the development of live attenuated vaccines and related drugs.
Patent Information
- Application Number
- CN202311863498.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-29
- Publication Date
- 2025-07-01
AI Technical Summary
It is difficult for the prior art to efficiently obtain alternative strains of attenuated Zika virus vaccine through genetic engineering, and the virus may lose its antigenicity after modification, affecting the immune response and immune memory.
Point mutations were performed by adding motifs that comply with DRACH rules in the Zika virus genome, introducing m6A modification sites, keeping the amino acid sequence and secondary structure unchanged, and an alternative live attenuated vaccine strain was obtained.
The obtained recombinant Zika virus retains antigenicity, significantly weakens the virulence of the virus, has the potential to prepare live attenuated vaccines, and provides good application prospects for the development of new animal models of infection and related drugs.
Smart Images

Figure CN120230760A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and particularly relates to a recombinant Zika virus and its application. Background Art
[0002] Zika virus is an arbovirus flavivirus. In adults, infection usually only shows mild influenza-like symptoms, but in a few cases, severe symptoms may occur, such as Guillain-Barré syndrome, etc. More seriously, infection in pregnant women or infants may lead to intrauterine growth restriction of the fetus and microcephaly in newborns, etc. Therefore, it is urgent to develop prophylactic or therapeutic drugs against Zika virus infection. However, currently, no Zika virus vaccine has been approved for marketing, and among the flaviviruses, only yellow fever virus and Japanese encephalitis virus vaccines are currently in clinical use, and their protective effects against currently prevalent strains are not satisfactory.
[0003] With the development of gene technology, using genetic engineering to artificially modify the viral genome to obtain attenuated strains has become one of the main means of vaccine research and development. However, the currently commonly used methods for modifying attenuated strains mainly involve knocking out or replacing the key protein-coding sequences in the viral genome, so that the obtained modified strains can exhibit obvious attenuated characteristics. However, this modification method greatly changes the amino acid sequence and even the structure of the proteins encoded by the viral genome, thus possibly having unpredictable effects on the host signal pathway, and it is very likely that the modified strains, although having attenuated characteristics, at the same time lose their antigenicity and are difficult to stimulate the body to produce immune responses and immune memories.
[0004] N6-adenosine methylation modification (abbreviated as m6A modification) is a newly emerging RNA epigenetic modification in recent years. It regulates life activities at the RNA level and can also affect host mRNA, tRNA, and rRNA, etc. at the transcriptome level of organisms, thus playing a very important role in diseases, tumors, embryonic development, etc. M6A modification does not change the amino acid sequence and structure of proteins, thus avoiding the influence of amino acid sequence changes on protein functions, especially avoiding the influence of amino acid sequence changes on the functions of other proteins other than the target function of the protein whose change is desired. However, there is currently no relevant report on the correlation between m6A modification sites and viral virulence. Summary of the Invention
[0005] The object of the present invention is to overcome the problems existing in the prior art, such as the lack of means for treating and / or preventing Zika virus and the difficulty in efficiently obtaining attenuated vaccine candidate strains by genetic engineering means, and to provide a recombinant Zika virus and its application. The recombinant Zika virus provided by the present invention is constructed based on motif site mutations, which only performs internal chemical modification on mRNA, but has no effect on the protein amino acid sequence and secondary structure, so as to effectively retain the antigenicity of the modified virus strain and improve the efficiency of obtaining attenuated vaccine candidate strains.
[0006] To achieve the above object, on the one hand, the present invention provides a method for changing the virulence of Zika virus by adding motifs conforming to the "DRACH" rule to the Zika virus genome. The way of adding motifs conforming to the "DRACH" rule includes mutating at least one base at positions 1442, 2411, 3011, 3566, 5036, 8105, 9176, 9272, 9503 and 9758 of the Zika virus genome. In the "DRACH" rule, D represents G or A, R represents G or A, and H represents A, C or U.
[0007] On the second aspect, the present invention provides a method for increasing the N6-adenosine methylation modification in Zika virus mRNA, which is characterized in that the method includes mutating at least one base at positions 1442, 3566, 8105 and 9176 of the Zika virus genome.
[0008] On the third aspect, the present invention provides a recombinant Zika virus. Compared with the wild type, at least one base at positions 1442, 2411, 3011, 3566, 5036, 8105, 9176, 9272, 9503 and 9758 of the genome of the recombinant virus mutates.
[0009] On the fourth aspect, the present invention provides the application of the recombinant Zika virus described in the third aspect in preparing an infected animal model, and / or, researching Zika virus and its related diseases, and / or, preparing drugs for treating and / or preventing Zika virus infection.
[0010] On the fifth aspect, the present invention provides a pharmaceutical composition, which includes the recombinant Zika virus described in the third aspect or a part thereof.
[0011] By the above technical solutions, the present invention can at least achieve the following beneficial effects:
[0012] (1) The present invention clarifies the influence of the addition of motifs conforming to the "DRACH" rule in the genome on the virulence of Zika virus, and based on this, an attenuated live vaccine candidate strain of Zika virus with obvious attenuation characteristics is obtained.
[0013] (2) In the recombinant mutant strain provided by the present invention, a nonsense mutation method is used to modify the wild-type Zika virus genome. The introduction of nonsense mutations does not change the amino acid sequence of the Zika virus and will not affect the host signaling pathway. While changing the virus virulence, the characteristics such as the antigenicity of the Zika virus are well retained. After detection, 4 new m6A modification sites are added in this recombinant mutant strain.
[0014] (3) Through experiments, it is found that the neurovirulence of the Zika virus recombinant mutant virus strain provided by the present invention in suckling mice is significantly weakened, and it has the potential to prepare live attenuated vaccines. In addition, the recombinant virus strain provided by the present invention also indicates that these mutation sites with increased m6A modifications it contains can be used as potential targets, and it also has good application prospects in the development of new Zika virus-infected animal models and the research and development of related drugs (such as antibodies, new antiviral drugs, vaccines, etc.). Description of the Drawings
[0015] Figure 1 Schematic diagram of the mutation site design of the recombinant Zika virus ZIKV-10M in Example 1.
[0016] Figure 2 IFA detection results of the recombinant Zika virus ZIKV-10M in Test Example 2.
[0017] Figure 3 shows the plaque comparison results between the wild-type FSS13025 and the recombinant Zika virus ZIKV-10M in Test Example 3, where (A) is the plaque morphology of FSS13025; (B) is the plaque morphology of ZIKV-10M.
[0018] Figure 4 Comparison result diagram of the m6A-seq sequencing maps between the wild-type FSS13025 and the recombinant Zika virus ZIKV-10M in Test Example 4.
[0019] Figure 5 Test result diagram of the m6A modification situation of each mutation site of the recombinant Zika virus ZIKV-10M in Test Example 4.
[0020] Figure 6 Proliferation characteristic result diagram of the recombinant Zika virus ZIKV-10M in the human hepatoma cell line HuH-7 and human neural progenitor cells hNPC in Test Example 5.
[0021] Figure 7 Test results of the recombinant Zika virus ZIKV-10M in the C57BL / 6J mouse infection model in Test Example 6, and the results show that ZIKV-10M exhibits obvious characteristics of weakened neurovirulence in suckling mice. Detailed Implementation Modes
[0022] The endpoints and any values in the ranges disclosed herein are not limited to the exact ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, the endpoint values of each range, between the endpoint values of each range and individual point values, and between individual point values can be combined with each other to obtain one or more new numerical ranges, and these numerical ranges should be considered to be specifically disclosed herein.
[0023] In the present invention, "m6A modification" is an abbreviation of "N6-adenosine methylation modification", and the two have the same meaning. It is a common internal chemical modification form of mRNA, mainly affecting the metabolism and biological functions of mRNA, and does not affect the amino acid sequence (primary structure) of the encoded protein and the spatial structure (secondary structure) of the protein, and has no effect on the function of the encoded protein. The main sites of m6A modification are concentrated in the 5'-UTR, coding sequence and 3'-UTR of mRNA, especially near the stop codon. In addition, m6A mainly appears in the DRACH motif (G / A-G / A-A-C-A / C / U).
[0024] mRNA with m6A modification can be recognized by specific recognition proteins (Readers), thereby regulating processes such as the stability / transcription / translation of mRNA. It is considered that most steps of a virus completing a life cycle in a cell are affected by m6A modification. However, current research shows that the effects of m6A modification on different viruses are different, and no consistent rule has been found yet.
[0025] The inventors of the present invention found in the research that by performing silent mutations (also known as "nonsense mutations", that is, the amino acid sequences encoded by the genome before and after the mutation are the same) on the Zika virus genome, recombinant viruses with an increased number of motifs conforming to the "DRACH" rule can be obtained without changing the amino acid sequence. And through m6A-seq sequencing and single-point m6A modification kit verification, it is determined that recombinant viruses with increased m6A modification are obtained through this mutation design. Through further research, the inventors found that this recombinant virus has obvious attenuation characteristics. And since the amino acid sequence of this recombinant virus strain has not changed, the antigenicity and other characteristics of the virus strain will not be changed, so that the obtained mutant strain can retain the same or similar immune stimulation as the wild type, thereby efficiently obtaining mutant strains with altered virulence, and having broad application prospects in the preparation of attenuated vaccines, the construction of new infection animal models, and the research related to Zika virus.
[0026] Based on this, the first aspect of the present invention provides a method for altering the virulence of Zika virus by adding motifs conforming to the "DRACH" rule to the Zika virus genome. Among them, the method of adding motifs conforming to the "DRACH" rule includes mutating at least one base at positions 1442, 2411, 3011, 3566, 5036, 8105, 9176, 9272, 9503, and 9758 in the Zika virus genome. In the "DRACH" rule, D represents G or A, R represents G or A, and H represents A, C, or U. A motif conforming to the "DRACH" rule is a nucleic acid fragment composed of five nucleotides, and each nucleotide in this nucleic acid fragment meets the aforementioned requirements. Adding motifs conforming to the "DRACH" rule to the Zika virus genome provides the possibility of increasing the m6A modification sites in the virus genome.
[0027] It should be noted here that although the present invention genetically engineers the wild-type Zika virus by means of point mutations to increase the motifs conforming to the "DRACH" rule in its genome, this does not mean that m6A modification will increase at each site after mutation. For example, in the technical solution provided by the present invention, when mutating the Zika virus (wild-type) according to the above positions, the m6A modification at the above sites in the mutant virus strain can increase, or can remain unchanged, and when the mutant strain has mutations at multiple sites relative to the wild-type, whether m6A modification can be produced after each site mutation is independent of each other.
[0028] According to some preferred embodiments of the present invention, the method of adding motifs conforming to the "DRACH" rule includes mutating at least one base at positions 1442, 3566, 8105, and 9176 in the Zika virus genome.
[0029] Preferably, the method of adding motifs conforming to the "DRACH" rule includes mutating the bases at positions 1442, 3566, 8105, and 9176 in the Zika virus genome.
[0030] Preferably, relative to the wild-type, in the mutant Zika virus, the base at position 1442 is mutated to C, the base at position 3566 is mutated to C, the base at position 8105 is mutated to C, and the base at position 9176 is mutated to C. In the mutant strain obtained by the above mutation method, the m6A modification at these sites increases relative to the wild-type.
[0031] According to some preferred embodiments of the present invention, the method for increasing the motif conforming to the "DRACH" rule includes mutating the bases at positions 1442, 2411, 3011, 3566, 5036, 8105, 9176, 9272, 9503, and 9758 in the Zika virus genome.
[0032] Preferably, in the mutated Zika virus relative to the wild type, at position 1442 of the genome, it is mutated to C; at position 2411, it is mutated to C; at position 3011, it is mutated to C; at position 3566, it is mutated to C; at position 5036, it is mutated to C; at position 8105, it is mutated to C; at position 9176, it is mutated to C; at position 9272, it is mutated to C; at position 9503, it is mutated to C; at position 9758, it is mutated to A. The mutant strain obtained by the above mutation method has obvious attenuation characteristics and has the potential to be used in the preparation of live attenuated vaccines. In this mutant strain, at least some of the above sites have the characteristic that the m6A modification is increased relative to the wild type.
[0033] More preferably, the wild type is Zika virus FSS13025 (GenBank Accession No. KU955593).
[0034] According to the preferred embodiments of the present invention, in the mutated Zika virus, except for the above sites, no other sites are mutated.
[0035] According to the preferred embodiments of the present invention, changing the virulence of the virus includes increasing or decreasing the virulence of the virus. Preferably, it is to decrease the virulence of the virus. This mutant strain has obvious attenuation characteristics and retains the (entire) antigenicity of the wild type, thus having the potential to be used as an alternative strain for the research and development of live attenuated vaccines.
[0036] According to a particularly preferred embodiment of the present invention, the nucleotide sequence of the genome of the mutated Zika virus (the sequence generated by changing U to T in the viral RNA) is as shown in SEQ ID NO: 1. Among them, the underlined nucleotides are the mutation sites, and the bold characters are the motifs conforming to the "DRACH" rule formed by the mutation.
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044] The second aspect of the present invention provides a method for increasing the N6-adenosine methylation modification in Zika virus mRNA, and the method includes mutating at least one base among the 1442nd, 3566th, 8105th, and 9176th positions of the Zika virus genome.
[0045] Preferably, relative to the wild type, in the mutated Zika virus, the base at the 1442nd position of the genome is mutated to C, the base at the 3566th position is mutated to C, the base at the 8105th position is mutated to C, and the base at the 9176th position is mutated to C. Preferably, the wild type is Zika virus FSS13025.
[0046] Furthermore, the present invention also provides the application of the above method in altering the virulence of Zika virus, especially in reducing the virulence of Zika virus.
[0047] According to the preferred embodiment of the present invention, in the above application, it may further include mutating other sites in the Zika virus genome. Preferably, the bases at the 1442nd, 2411th, 3011th, 3566th, 5036th, 8105th, 9176th, 9272nd, 9503rd, and 9758th positions of the Zika virus genome can be mutated.
[0048] Preferably, relative to the wild type, in the mutated Zika virus, the base at the 1442nd position of the genome is mutated to C, the base at the 2411th position is mutated to C, the base at the 3011th position is mutated to C, the base at the 3566th position is mutated to C, the base at the 5036th position is mutated to C, the base at the 8105th position is mutated to C, the base at the 9176th position is mutated to C, the base at the 9272nd position is mutated to C, the base at the 9503rd position is mutated to C, and the base at the 9758th position is mutated to A.
[0049] Furthermore, the present invention also provides the application of the above method in preparing a Zika virus vaccine, especially a live attenuated vaccine.
[0050] According to the preferred embodiment of the present invention, in the above application, it may further include mutating other sites in the Zika virus genome. Preferably, the bases at the 1442nd, 2411th, 3011th, 3566th, 5036th, 8105th, 9176th, 9272nd, 9503rd, and 9758th positions of the Zika virus genome can be mutated.
[0051] Preferably, compared with the wild type, in the mutated Zika virus, the 1442nd base in the genome is mutated to C, the 2411th base is mutated to C, the 3011th base is mutated to C, the 3566th base is mutated to C, the 5036th base is mutated to C, the 8105th base is mutated to C, the 9176th base is mutated to C, the 9272nd base is mutated to C, the 9503rd base is mutated to C, and the 9758th base is mutated to A.
[0052] The third aspect of the present invention provides a recombinant Zika virus. Compared with the wild type, at least one base among the 1442nd, 2411th, 3011th, 3566th, 5036th, 8105th, 9176th, 9272nd, 9503rd, and 9758th bases in the genome of the recombinant virus is mutated.
[0053] According to a preferred embodiment of the present invention, compared with the wild type, at least the bases at the 1442nd, 3566th, 8105th, and 9176th positions in the genome of the recombinant virus are mutated. Preferably, the mutation can increase the m6A modification at the corresponding site of the viral genome.
[0054] According to a preferred embodiment of the present invention, the 1442nd base in the genome of the recombinant virus is mutated to C, the 3566th base is mutated to C, the 8105th base is mutated to C, and the 9176th base is mutated to C.
[0055] According to a preferred embodiment of the present invention, compared with the wild type, the bases at the 1442nd, 2411th, 3011th, 3566th, 5036th, 8105th, 9176th, 9272nd, 9503rd, and 9758th positions in the genome of the recombinant virus are mutated.
[0056] Preferably, the 1442nd base in the genome of the recombinant virus is mutated to C, the 2411th base is mutated to C, the 3011th base is mutated to C, the 3566th base is mutated to C, the 5036th base is mutated to C, the 8105th base is mutated to C, the 9176th base is mutated to C, the 9272nd base is mutated to C, the 9503rd base is mutated to C, and the 9758th base is mutated to A.
[0057] According to a preferred embodiment of the present invention, the wild type is Zika virus FSS13025.
[0058] According to a particularly preferred embodiment of the present invention, the nucleotide sequence of the genome of the recombinant Zika virus is as shown in SEQ ID NO:1.
[0059] In the fourth aspect of the present invention, there is provided the use of the recombinant Zika virus described in the third aspect in the preparation of an animal infection model, and / or in the research on Zika virus and its related diseases, and / or in the preparation of a drug for treating and / or preventing Zika virus infection.
[0060] According to a preferred embodiment of the present invention, the drug includes at least one of a vaccine, an antibody, and an antiviral drug for treating and / or preventing Zika virus infection and its related diseases. Preferably, the vaccine is a live attenuated vaccine.
[0061] In the fifth aspect of the present invention, there is provided a pharmaceutical composition, which includes the recombinant Zika virus described in the third aspect or a part thereof.
[0062] In the pharmaceutical composition provided by the present invention, the "recombinant Zika virus or a part thereof" means that in the pharmaceutical composition, the complete structure of the recombinant Zika virus provided in the second aspect of the present invention is used as the (main) active component of the pharmaceutical composition, or a part of the structure or component in the recombinant Zika virus (such as one or some of its structural proteins and / or non-structural proteins, or a fragment of the protein, and for another example, the genomic RNA of the recombinant Zika virus or its corresponding cDNA or a fragment of the RNA / cDNA, etc.) is used as one of the (main) active components of the pharmaceutical composition.
[0063] According to a preferred embodiment of the present invention, the pharmaceutical composition further includes pharmaceutically acceptable excipients. The "pharmaceutically acceptable excipients" refer to components that do not have or basically do not have a negative impact on the efficacy of the active component of the pharmaceutical composition, and at the same time do not have or basically do not have a negative impact on the body functions of the subject (such as humans, etc.). For example, they can be commonly used excipients in the field of pharmaceutical compositions, such as buffers, sustained-release agents, preservatives, stabilizers, etc.
[0064] According to some preferred embodiments of the present invention, the pharmaceutical composition further includes other active ingredients that can be used for the treatment and / or prevention of Zika virus infection. For example, the pharmaceutical composition can contain existing drugs, vaccine components (such as existing vaccine strains or parts thereof, etc.) in the field for the treatment and / or prevention of Zika virus infection, as long as they do not produce or basically do not produce an adverse effect on its preventive and / or therapeutic effect and the body functions of the subject when used in combination with the recombinant Zika virus provided by the present invention.
[0065] The present invention will be described in detail below through examples. It should be understood that the following examples are only used to further explain and illustrate the content of the present invention by way of example, and are not used to limit the present invention.
[0066] In the following examples, unless otherwise specified, the reagents and materials used are commercially available products purchased from regular biological or chemical reagent / material suppliers, and the reagents are all of analytical grade.
[0067] Example 1
[0068] This example is used to illustrate the construction, identification, and rescue of the full-length clone of the Zika virus recombinant mutant strain provided by the present invention.
[0069] Reference Figure 1 , using the full-length infectious clone plasmid of FSS13025 (the construction method can refer to Shan et al., 2016, Cell Host & Microbe 19, 891–900) as a template, 10 nonsense mutations with added motifs were designed, located at positions 1442, 2411, 3011, 3566, 5036, 8105, 9176, 9272, 9503, and 9758 of the genome, and these 10 positions were transformed into motif sites conforming to the "DRACH" motif.
[0070] The full length of the modified mutant virus sequence was evenly divided into four segments (named 1A, 1B, 1C, and 1D in sequence), entrusted to Sangon Biotech Co., Ltd. for synthesis and the DNA fragments were inserted into the pUC57 plasmid to obtain the expression plasmids pUC57-1A, pUC57-1B, pUC57-1C, and pUC57-1D respectively. Using the templates and primers in Table 1 and the PCR system and reaction program in Table 2, fragments 1A, 1B, 1C, 1D, and fragment 2 were amplified. The five obtained fragments were subjected to gel cutting and purification.
[0071] Table 1
[0072]
[0073] Table 2
[0074]
[0075] Using Gibson Master Mix seamless cloning kit (NEB), the five purified DNA fragments were phosphorylated, the phosphate groups were ligated to achieve DNA fragment ligation and circularization, and template removal was performed by specifically recognizing Escherichia coli methylation, and finally the recombinant mutant virus plasmid (named ZIKV-10M) was obtained. The Gibson reaction system and conditions are shown in Table 3 for details.
[0076] Table 3
[0077]
[0078] The Gibson product was diluted 10-fold. 10 μl was taken and transformed into competent Escherichia coli HB101 (TaKaRa). Monoclonal colonies were picked and sent to Novogene for sequencing. The sequencing results were aligned with the FSS13025 genome sequence. It was found that compared with the FSS13025 genome sequence, at the 1442nd base of ZIKV-10M, T mutated to C; at the 2411th base, T mutated to C; at the 3011th base, T mutated to C; at the 3566th base, T mutated to C; at the 5036th base, T mutated to C; at the 8105th base, T mutated to C; at the 9176th base, T mutated to C; at the 9272nd base, T mutated to C; at the 9503rd base, T mutated to C; at the 9758th base, G mutated to A, which was consistent with the expected target. No mutations were found at the remaining positions of the genome. This clone was named pACNR-ZIKV-10M.
[0079] The following method was used to rescue recombinant Zika virus ZIKV-10M:
[0080] 1. In vitro transcription of the full-length infectious clone of recombinant Zika virus ZIKV-10M
[0081] The plasmid pACNR-10M, the full-length infectious clone plasmid of the virus, was extracted using a plasmid large-scale extraction kit (Invitrogen). It was digested with ClaI, then extracted with phenol-chloroform. The linearized plasmid was quantified and aliquoted, and then stored at -20 °C for later use. Using the linearized full-length infectious clone plasmid of the virus as a template, in vitro transcription was carried out using the Ribo MAX Large Scale RNA Production System-T7 Ribo MAX (Promega). The reaction system and conditions are shown in Table 4 in detail.
[0082] Table 4
[0083]
[0084] 2. Rescue of recombinant Zika virus ZIKV-10M
[0085] Transfect monolayer BHK-21 cells (purchased from ATCC, product catalog number CCL-10) with transcript RNA using Lipofectamine 3000 (purchased from Invitrogen) as follows: First, mix 50 μL of OPTI-MEM with 4 μL of liposome, let it stand at room temperature for 5 min, and then mix it with 10 μL of RNA (5 μg) and 50 μL of OPTI-MEM, and let it stand at room temperature for 20 min. Add the above mixture to one well of a 6-well plate, and supplement with 450 μL of OPTI-MEM. Incubate at 37 °C under 5% CO2 for 6 h. After incubation, remove the supernatant, supplement with DMEM maintenance solution containing 2% FBS, and continue to culture in an incubator at 37 °C and 5% CO2. After cytopathic effect appears in the cells, centrifuge to collect the culture supernatant. Re-inoculate the supernatant onto BHK-21 cells. After cytopathic effect appears in the cells, centrifuge to collect the supernatant and store it at -80 °C as the recombinant Zika virus seed solution.
[0086] Test Example 1
[0087] This test example is used to illustrate the results of the whole-genome sequence determination and analysis of the recombinant mutant strain of Zika virus of the present invention.
[0088] Use Pure Link TM Extract the RNA of the virus supernatant using PureLink RNA minikit (Thermo Fisher), and then amplify the fragments where each mutation site is located using a one-step reverse transcription kit (TaKaRa). The reaction system (25 μL) is shown in Table 5.
[0089] Table 5
[0090] Component Dosage / μL Prime Script1 Step Enzyme Mix 1 2×1Step Buffer 12.5 Template RNA 2 Forward Primer F 1 Reverse Primer R 1 Nuclease-free Water 7
[0091] Using the genomic RNA of the pACNR-ZIKV-10M recombinant mutant virus as a template, amplify the genome in 7 segments with primer pairs F1(+) / R2(-), F3(+) / R4(-), F4(+) / R6(-), F7(+) / R8(-), F9(+) / R9(-), F10(+) / R12(-), F13(+) / R14(-). The relevant primer sequences are shown in Table 6 (the primers are used for both amplification and sequencing), and the reaction system and procedures are shown in Table 7 for details.
[0092] Table 6
[0093] Primer Name Sequence (5′-3′) Position SEQ ID NO F1(+) AGTTGTTGATCTGTGTGAATCAG 1-23 12 F3(+) GGTTTTGGAAGCCTAGGACTT 1521-1541 13 F4(+) GGAGCAGCTTTCAAATCATTGTTTG 2325-2349 14 F7(+) GACTCGTAGACTGCTAGGTTCAACAC 4691-4716 15 F9(+) TGGCCTATCAGGTTGCATCTGCCGG 6247-6271 16 F10(+) CGATGGCCACGCAAGCTGGAGTGTTGTT 7120-7147 17 F13(+) GTGGTGCAGCTCATTCGGAATATG 9519-9542 18 F14(+) GTGGTGTGGGTCTCTCATAGGGCA 10208-10231 19 R2(-) TGGAACCACTCCTTGTGAACCAA 1611-1633 20 R3(-) GGGAAATAGATCCATTCTTTGTATTCAG 2406-2433 21 R6(-) GCTTGACATCTCCCCAGTATGGAT 4810-4833 22 R8(-) CCTCTTTTCCCAGCGGCAAACTC 6444-6466 23 R9(-) CTATTAGGGTCAGGGGTGTTAAT 7223-7245 24 R12(-) CCACTGACTGCCATTCGTTTGAGCCTA 8632-8658 25 R14(-) AGAAACCATGGATTTCCCCACACCGG 10783-10808 26
[0094] Table 7
[0095]
[0096] The results of PCR amplification showed that the target fragments with sizes consistent with expectations could be amplified by all 7 pairs of primers; the results of sequence determination also showed that the obtained fragments were specific sequences of the FSS13025 virus strain. Except for the mutations of base T to C at position 1442, base T to C at position 2411, base T to C at position 3011, base T to C at position 3566, base T to C at position 5036, base T to C at position 8105, base T to C at position 9176, base T to C at position 9272, base T to C at position 9503, and base G to A at position 9758 (consistent with expectations), the remaining nucleotide sequences of the genome were identical to those of the parental strain virus.
[0097] Test Example 2
[0098] This test example is used to illustrate the cell infection rate of the Zika virus recombinant mutant strain provided by the present invention.
[0099] The following steps were used to observe whether the recombinant rescued virus could express Zika virus proteins in infected cells and to determine the infection rate of the rescued virus on cells:
[0100] 1. Preparation of BHK-21 cell plates infected with recombinant rescued virus
[0101] Equal amounts of recombinant rescued virus and parental strain virus were used to infect monolayer BHK-21 cells respectively. The cells were fixed with acetone-methanol fixative (acetone: methanol = 3:7) at 24, 48, and 72 hours after infection respectively, and then the cell plates were placed at -20°C for 30 - 60 minutes for fixation.
[0102] 2. Detection of the infection rate of the recombinant rescued virus on cells
[0103] The monoclonal antibody against Zika virus envelope E protein (purchased from Abcam) was used to detect the virus-specific proteins in BHK-21 cells infected with the rescued virus by indirect immunofluorescence (IFA). The method was as follows: The above antibody was diluted at an appropriate ratio and incubated with BHK-21 cells in the fixed cell plates at 37°C for 1 - 2 hours. Then, it was washed 3 times with PBS buffer (10 mM K2HPO4, 2 mM KH2PO4, 135 mM NaCl, 2.7 mM KCl, pH 7.4) with shaking, 10 minutes each time, and air-dried at room temperature. After that, the FITC-labeled goat anti-mouse IgG antibody diluted 200 times with PBS solution was added and incubated at 37°C for 60 minutes. Then, it was washed 3 times with PBS buffer with shaking, 10 minutes each time. After DAPI staining for 5 minutes, the results were observed under a fluorescence microscope.
[0104] The results of indirect immunofluorescence were as Figure 2As shown in the figure, it can be seen that the recombinant Zika virus can express E protein in BHK-21 cells, and the protein expression level increases with time.
[0105] Test Example 3
[0106] This test example is used to illustrate the plaque characteristics of the Zika virus recombinant mutant strain provided by the present invention.
[0107] In order to observe the plaque morphology of the recombinant mutant virus, the recombinant mutant virus was diluted 10 times to 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 and 10 -7 , 400 μL / well was inoculated into a monolayer of BHK-21 cells laid on a 12-well plate. After adsorption for 1-2 hours, the virus solution was discarded, and a 1% agar cap containing DMEM medium (2% FBS) was added and placed in an incubator at 37°C and 5% CO2 for culture. After 4 days of culture, the cells were fixed with 4% formaldehyde at room temperature for 1 hour, the agar cap was discarded, and crystal violet was stained at room temperature for 10 minutes, the plaque morphology was observed, and the plaque forming units (PFU) were calculated. The plaques of the parent strain FSS13025 were measured and analyzed in the same way.
[0108] The plaque test results are shown in Figure 3, where Figure 3 (A) shows the plaque test results of FSS13025, and Figure 3 (B) shows the plaque test results of ZIKA-10M. It can be seen from the figure that the ZIKV-10M recombinant mutant virus can form plaques with relatively uniform size and clear edges, which are basically the same size as the FSS13025 parent strain.
[0109] Test Example 4
[0110] This test example is used to illustrate the m6A modification of the Zika virus recombinant mutant strain provided by the present invention.
[0111] (I) m6A-seq sequencing comparison
[0112] According to the following method, sequencing samples of Huh-7 cells infected with FSS13025 and ZIKV-10M Zika virus were prepared, and the m6A modification maps of FSS13025 and ZIKV-10M Zika virus were identified and compared.
[0113] HuH-7 cells were cultured in high-glucose DMEM medium containing 15% FBS. When the cells were in good condition and nearly confluent monolayer after attachment, virus inoculation and propagation were carried out. The original medium was discarded and replaced with 15 mL of maintenance medium containing high-glucose DMEM (containing 2% FBS). According to the titers of each virus stock, an appropriate amount of virus stock solution was added, and the cells were cultured in a 37 °C cell incubator containing 5% CO2. After 72 h, the supernatant was transferred to a 15 mL centrifuge tube or a 50 mL centrifuge tube for centrifugation at 8000 rpm for 10 - 15 min at 4 °C in a centrifuge. After centrifugation, the supernatant was discarded and the precipitate was retained. TRIzol method was selected to extract RNA. The concentration and purity (A260 / A280) of total RNA extracted by the TRIzol method were measured using a NanoDrop ND-1000 Spectrophotometer. ND-1000 Spectrophotometer)
[0114] The samples were sent to Novogene Co., Ltd. in Beijing for MeRIP-seq RNA methylation immunoprecipitation sequencing. The sequencing process was approximately as follows: for the total RNA extracted and sent for testing, mRNA enrichment was performed (using the RiboMinus Eukaryote Kit v2 produced by Thermo Fisher Scientific), and then the enriched mRNA was fragmented. At this time, a part of the fragmented mRNA was retained as Input. Then, the obtained mRNA fragments were immunoprecipitated (IP) with an m6A antibody to construct a MeRIP-seq library. After library construction, the RNA fragments that were not immunoprecipitated by IP were used as Input RNA, and the RNA fragments pulled down by IP were the fragments that could bind specifically to the m6A antibody. High-throughput second-generation sequencing was performed on both of them on the Illumina HiSeq 2000 sequencing platform with a read length of PE100. The measured region range was processed, filtered, spliced, and analyzed to export the final feedback data from the company.
[0115] After organizing the high-throughput sequencing data after filtration, the exomePeak R package version 2.16.0 was used. Each strain was used as a control group with the Input group data, and the IP-identified sequencing data was used as the experimental impact group. Statistics were performed on the number, width, distribution, etc. of m6A modification peak peaks by comparing with the control. And the motif in the reads corresponding to the peak map was analyzed according to the peak identification results.
[0116] The detection results are as Figure 4As shown, where the yellow peak is the peak determined by the program. For the epidemic strain FSS13025 Zika virus, a total of 5 peak peaks were identified by m6A-seq sequencing (the specific peak positions can be seen in the following table). A total of 8 peak peaks were detected by m6A-seq sequencing of the ZIKV-10M mutant Zika virus (the specific peak positions can be seen in Table 3-18). Through this discovery, the m6A modification peaks of the ZIKV-10M mutant Zika virus have changed significantly compared with the parental strain, with 4 increases, 1 broadening, 1 decrease, and 1 position shift. Seven mutation sites fall into the m6A modification peaks of the ZIKV-10M mutant Zika virus, which means that m6A modification may have occurred. The seven sites are the 1442nd, 3556th, 8105th, 9176th, 9272nd, 9503rd, and 9758th bases of the genome.
[0117] (2) m6A modification detection
[0118] Using Epi-SELECT TM m6A site identification (with FTO-assisted step) kit for single-point detection of these 7 changed m6A modification sites of the ZIKV-10M mutant recombinant virus by the SELECT qPCR method. The same batch of samples identified by m6A-seq were treated with FTO. Configure the reaction system according to the following system. After the reaction, add 4 μL of 0.5 M EDTA to the FTO treatment group, at 95 °C for 5 min. The FTO treatment group and the FTO control group recover RNA by the column method and elute with 10 μl of water. Add 100 μL of binding buffer and 150 μL of absolute ethanol to the reaction solution, mix well and add all to the EPI-Spin Column, centrifuge at 12000 rcf for 1 min, discard the waste liquid, add 750 μL of wash buffer, centrifuge at 12000 rcf for 1 min, discard the waste liquid and then centrifuge at 16000 rcf for 2 min. Add 12 μL of RNase-free water, let stand at room temperature for 3 min, and then centrifuge at 12000 rcf for 1 min to recover the product.
[0119] The product was annealed and extended, single-base extension ligation was performed using the FSS13025_up and FSS13025_down primer pairs, and then PCR was performed on the cDNA template using the RR820A qPCR kit from TaKaRa. Whether there was m6A modification at the two mutation sites of 9176 and 9272 was determined based on whether there was a significant difference in the CT values before and after the FTO treatment group and it was greater than 0.5; single-base extension ligation was performed using the FSS13025_860_up and FSS13025_860_down primer pairs, and then PCR was performed on the cDNA template using the RR820A qPCR kit from TaKaRa. Whether there was m6A modification at the mutation site of 1442 was determined based on whether there was a significant difference in the CT values before and after the FTO treatment group and it was greater than 0.5; single-base extension ligation was performed using the FSS13025_3026_up and FSS13025_3026_down primer pairs, and then PCR was performed on the cDNA template using the RR820A qPCR kit from TaKaRa. Whether there was m6A modification at the mutation site of 3566 was determined based on whether there was a significant difference in the CT values before and after the FTO treatment group and it was greater than 0.5; single-base extension ligation was performed using the FSS13025_7728_up and FSS13025_7728_down primer pairs, and then PCR was performed on the cDNA template using the RR820A qPCR kit from TaKaRa. Whether there was m6A modification at the mutation site of 8105 was determined based on whether there was a significant difference in the CT values before and after the FTO treatment group and it was greater than 0.5; single-base extension ligation was performed using the FSS13025_8701_1_up and FSS13025_8701_1_down primer pairs, and then PCR was performed on the cDNA template using the TaKaRa RR820A qPCR kit. Whether there was m6A modification at the mutation site of 9503 was determined based on whether there was a significant difference in the CT values before and after the FTO treatment group and it was greater than 0.5; single-base extension ligation was performed using the FSS13025_8701_2_up and FSS13025_8701_2_down primer pairs, and then PCR was performed on the cDNA template using the RR820A qPCR kit from TaKaRa. Whether there was m6A modification at the mutation site of 9758 was determined based on whether there was a significant difference in the CT values before and after the FTO treatment group and it was greater than 0.5.
[0120] The specific reaction system and conditions for FTO treatment are shown in Table 8, the reaction system and conditions for annealing and extension are shown in Table 9, the reaction system and conditions for single-base extension ligation are shown in Table 10, the primer sequences are shown in Table 11, and the reaction system and conditions for qPCR are shown in Table 12.
[0121] Table 8
[0122]
[0123] Table 9
[0124]
[0125] *After the reaction, the system was maintained at 4 °C.
[0126] Table 10
[0127]
[0128] Table 11
[0129]
[0130] Table 12
[0131]
[0132] The experimental results of qPCR are as Figure 5 shown. It can be seen from the figure that for the mutations at positions 1442T to C, 3566T to C, 8105T to C, and 9176T to C of ZIKV-10M, there are significant differences in the CT values between the FTO treatment group and the control group, and the differences are close to or greater than 0.5. These four sites were found to have increased m6A modification. By designing a recombinant Zika virus with 10 additional motif mutations, it was determined by m6A-seq sequencing and the SELECT site-directed detection kit that at least four mutant sites had increased m6A modification.
[0133] Test Example 5
[0134] This test example is used to illustrate the proliferation characteristics of the recombinant mutant Zika virus provided by the present invention on the human hepatocellular carcinoma cell line HuH-7 and human neural progenitor cells hNPC.
[0135] (I) Human hepatocellular carcinoma cell line HuH-7
[0136] Both the recombinant mutant virus and the parental strain virus (wild type) were inoculated into the human hepatocellular carcinoma cell line HuH-7 in a 24-well plate at an MOI of 0.01. After adsorption in an incubator at 37 °C and 5% CO2 for 1 h, the virus solution was discarded, and DMEM containing 2% FBS was added. The cells were cultured in an incubator at 37 °C and 5% CO2. The cell supernatants were collected at 6 h, 24 h, 48 h, and 72 h after inoculation and used for nucleic acid extraction and fluorescence quantitative RT-qRCR to measure the virus load and plaque titration to measure the virus titer; at the same time, the cell wells were fixed with 4% paraformaldehyde for indirect immunofluorescence (IFA) to observe the expression of the virus protein on the cells. Take 200 μL of PureLink produced by Thermo Fisher TMLyse cells with Lysis Buffer containing 1% β-mercaptoethanol in the RNA Mini Kit, extract total RNA using the GeneRotex series of fully automatic nucleic acid extractors produced by Xi'an Tianlong Technology Co., Ltd. and its supporting automatic nucleic acid extraction kit, and perform qRT-PCR amplification using the RR064A qRT-PCR kit from TaKaRa and the primer probe for Zika virus E protein designed by the laboratory to measure the RNA copy number at different time points and draw a one-step growth curve (see Figure 6 ).
[0137] The results of the one-step growth curve showed that the recombinant mutant virus could replicate effectively in the human hepatoma cell line HuH-7. Similar to the parental strain, both reached the peak of proliferation at 48 h post-infection, but there was no significant difference. The results of the IFA experiment showed that the positive cell infection rates of both were roughly the same, indicating that in the human hepatoma cell line HuH-7, the replication and proliferation ability of the recombinant mutant virus ZIKV-10M did not change significantly compared with the parental strain.
[0138] (2) Human neural progenitor cells hNPC
[0139] Inoculate the recombinant mutant virus and the parental strain virus into human neural progenitor cells hNPC in a 24-well plate at an MOI of 1. After adsorbing for 1 h in an incubator at 37°C and 5% CO2, discard the virus solution, supplement with DMEM containing 2% FBS, and culture in an incubator at 37°C and 5% CO2. Collect the cell supernatant at 6 h, 24 h, 48 h, and 72 h after inoculation for nucleic acid extraction and fluorescence quantitative RT-qRCR to measure the virus load and plaque titration to measure the virus titer; at the same time, fix the cell wells with 4% paraformaldehyde for indirect immunofluorescence (IFA) to observe the expression of the virus protein on the cells. Take 200 μL of PureLink TM Lyse cells with Lysis Buffer containing 1% β-mercaptoethanol in the RNA Mini Kit, extract total RNA using the GeneRotex series of fully automatic nucleic acid extractors produced by Xi'an Tianlong Technology Co., Ltd. and its supporting automatic nucleic acid extraction kit, and perform qRT-PCR amplification using the RR064A qRT-PCR kit from TaKaRa and the primer probe for Zika virus E protein designed by the laboratory to measure the RNA copy number at different time points and draw a one-step growth curve (see Figure 6 ).
[0140] The results of the one-step growth curve showed that the recombinant mutant virus had a weaker replication ability in human neural progenitor cells (hNPC cells), which was weaker than that of the parental strain. Both the mutant virus and the parental strain reached the replication peak at 24 h post-infection in hNPC cells, but the intracellular virus accumulation of the mutant virus decreased to about 20% of that of the parental strain. This indicates that the replication and proliferation ability of the recombinant mutant virus is limited in hNPC cells.
[0141] Test Example 6
[0142] This test example is used to illustrate the characteristic of attenuated neurovirulence of the Zika virus recombinant mutant strain provided by the present invention.
[0143] The recombinant mutant virus ZIKV-10M and the parental strain FSS13025 were intracranially injected into 1-day-old CD-1 suckling mice at different dose gradients of 10, 100, and 1000 PFU. After inoculation, the viral loads in the mouse brain tissues were detected at 3 d, 6 d, and 9 d, and the survival rates of the mice were observed from 0 to 21 days after injection. The results are shown in Table 13 and Figure 7 .
[0144] Table 13
[0145]
[0146] It can be seen from Figure 7 that at 3 d, there was a trend of attenuation in the viral loads of the recombinant mutant virus and the parental strain in the brain tissue. The difference was significant at 6 d, and the viral load of the recombinant mutant virus in the brain tissue was lower than that of the parental strain. At the same time, through calculation, it was found that the LD50 of the parental strain FSS13025 was 32.3 PFU, and the LD50 of ZIKV-10M was 453.1 PFU, which was attenuated by 14-fold. The above results indicate that compared with the parental strain FSS13025, the replication of ZIKV-10M in the brain tissue was significantly weakened, indicating that the neurotropism of the recombinant mutant virus was reduced and the neurovirulence was reduced.
[0147] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited thereto. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solutions of the present invention, including any other suitable combination of each technical feature. These simple modifications and combinations should also be regarded as the content disclosed by the present invention and fall within the protection scope of the present invention.
Claims
1. A method for altering the virulence of Zika virus by adding motifs conforming to the "DRACH" rule to the Zika virus genome, characterized in that, The ways to increase the motif conforming to the "DRACH" rule include mutating at least one base among the 1442nd, 2411th, 3011th, 3566th, 5036th, 8105th, 9176th, 9272nd, 9503rd, and 9758th positions of the Zika virus genome. In the "DRACH" rule, D represents G or A, R represents G or A, and H represents A, C, or U.
2. The method according to claim 1, wherein The ways to increase the motif conforming to the "DRACH" rule include mutating at least one base among the 1442nd, 3566th, 8105th, and 9176th positions of the Zika virus genome. Preferably, mutate the bases at the 1442nd, 3566th, 8105th, and 9176th positions of the Zika virus genome; Preferably, relative to the wild type, in the mutated Zika virus, the base at the 1442nd position of the genome mutates to C, the base at the 3566th position mutates to C, the base at the 8105th position mutates to C, and the base at the 9176th position mutates to C; And / or, the ways to increase the motif conforming to the "DRACH" rule include mutating the bases at the 1442nd, 2411th, 3011th, 3566th, 5036th, 8105th, 9176th, 9272nd, 9503rd, and 9758th positions of the Zika virus genome; Preferably, relative to the wild type, in the mutated Zika virus, the base at the 1442nd position of the genome mutates to C, the base at the 2411th position mutates to C, the base at the 3011th position mutates to C, the base at the 3566th position mutates to C, the base at the 5036th position mutates to C, the base at the 8105th position mutates to C, the base at the 9176th position mutates to C, the base at the 9272nd position mutates to C, the base at the 9503rd position mutates to C, and the base at the 9758th position mutates to A; More preferably, the wild type is Zika virus FSS13025.
3. The method according to claim 1 or 2, wherein The alteration of virus virulence includes increasing or decreasing virus virulence, preferably decreasing virus virulence.
4. A method for increasing the N6-adenosine methylation modification in Zika virus mRNA, characterized in that, The method includes mutating at least one base among the 1442nd, 3566th, 8105th, and 9176th positions of the Zika virus genome; Preferably, relative to the wild type, in the mutated Zika virus, the base at the 1442nd position of the genome mutates to C, the base at the 3566th position mutates to C, the base at the 8105th position mutates to C, the base at the 9176th position mutates to C. Preferably, the wild type is Zika virus FSS13025.
5. A recombinant Zika virus, characterized in that, Relative to the wild type, at least one base among the 1442nd, 2411th, 3011th, 3566th, 5036th, 8105th, 9176th, 9272nd, 9503rd, and 9758th positions of the genome of the recombinant virus mutates.
6. The recombinant Zika virus according to claim 5, wherein, Relative to the wild type, at least the bases at the 1442nd, 3566th, 8105th, and 9176th positions of the genome of the recombinant virus mutate; Preferably, the base at the 1442nd position of the genome of the recombinant virus mutates to C, the base at the 3566th position mutates to C, the base at the 8105th position mutates to C, and the base at the 9176th position mutates to C; and / or, compared with the wild type, the bases at positions 1442, 2411, 3011, 3566, 5036, 8105, 9176, 9272, 9503 and 9758 of the genome of the recombinant virus are mutated; Preferably, the base at position 1442 of the genome of the recombinant virus is mutated to C, the base at position 2411 is mutated to C, the base at position 3011 is mutated to C, the base at position 3566 is mutated to C, the base at position 5036 is mutated to C, the base at position 8105 is mutated to C, the base at position 9176 is mutated to C, the base at position 9272 is mutated to C, the base at position 9503 is mutated to C, and the base at position 9758 is mutated to A; More preferably, the wild type is Zika virus FSS13025.
7. Use of the recombinant Zika virus according to claim 5 or 6 in the preparation of an infected animal model, and / or, in the research on Zika virus and its related diseases, and / or, in the preparation of a drug for treating and / or preventing Zika virus infection.
8. The application according to claim 7, wherein, The drug includes at least one of a vaccine, an antibody, and an antiviral drug for treating and / or preventing Zika virus infection and related diseases caused thereby; Preferably, the vaccine is selected from live attenuated vaccines.
9. A pharmaceutical composition, characterized in that, The pharmaceutical composition includes the recombinant Zika virus or a part thereof according to any one of claims 4-6.
10. The pharmaceutical composition according to claim 9, wherein, The pharmaceutical composition further includes a pharmaceutically acceptable excipient; and / or, the pharmaceutical composition further includes other active ingredients useful for the treatment and / or prevention of Zika virus infection.