Application of TaVRN1 protein and coding gene thereof in regulating heading stage and plant height of wheat

Abstract

The invention discloses application of a TaVRN1 protein and a coding gene thereof in regulating and controlling the heading stage and the plant height of wheat, and belongs to the technical field of biology. The technical problem to be solved by the invention is how to regulate and control the heading period and / or plant height of plants. The TaVRN1 protein disclosed by the invention is a protein of which the amino acid sequence is SEQ ID No.3, a protein of which the amino acid sequence is SEQ ID No.6 and / or a protein of which the amino acid sequence is SEQ ID No.9. Experiments prove that the TaVRN1 protein and the coding gene thereof can regulate and control the heading period and the plant height of a plant: overexpression of the TaVRN1 gene can shorten the heading period of the plant and improve the plant height of the plant; the knockout of the TaVRN1 gene can prolong the heading period of the plant and reduce the plant height of the plant. Therefore, the TaVRN1 protein and the coding gene thereof can be used for regulating the heading period and the plant height of the plant.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to the application of TaVRN1 protein and its coding gene in regulating the heading date and plant height of wheat. Background Art

[0002] Wheat ( Triticum aestivum L.) is an important food crop, and approximately 40% of the global population mainly relies on wheat as their staple food. With the continuous growth of the global population, the demand for high-yield wheat is also increasing. Appropriate heading dates and plant heights of wheat can enable it to maintain broad adaptability and high yields. By overexpressing genes or knocking out key regulatory genes such as plant height and heading date through gene editing technologies such as CRISPR / cas9, wheat materials with ideal plant heights and heading phenotypes that can be applied to wheat breeding can be created. Summary of the Invention

[0003] The technical problem to be solved by the present invention is how to regulate the heading date and / or plant height of plants.

[0004] To solve the above technical problem, the present invention first provides at least one of the following applications of a protein or a substance that regulates the content or activity of the protein: Y1) Regulating the heading date of plants; Y2) Preparing a product for regulating the heading date of plants; Y3) Cultivating plants with altered heading dates; Y4) Preparing a product for cultivating plants with altered heading dates; Y5) Regulating the plant height of plants; Y6) Preparing a product for regulating the plant height of plants; Y7) Cultivating plants with altered plant heights; Y8) Preparing a product for cultivating plants with altered plant heights; The protein is derived from wheat ( Triticum aestivum L.), and its name is TaVRN1. TaVRN1 is specifically TaVRN1-5A protein, TaVRN1-5B protein, and / or TaVRN1-5D protein; The TaVRN1-5A protein is as follows A1), A2), or A3): A1) A protein with an amino acid sequence of SEQ ID No. 3; A2) A protein that has 98% or more identity with A1) and has the same function after substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in SEQ ID No. 3 in the sequence listing; A3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of A1) or A2); The TaVRN1-5B protein is any of the following B1), B2), or B3): B1) a protein with an amino acid sequence of SEQ ID No. 6; B2) a protein with an amino acid sequence obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in SEQ ID No. 6 in the sequence listing, having an identity of more than 98% with B1) and having the same function; B3) a fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of B1) or B2). The TaVRN1-5D protein is any of the following C1), C2), or C3): C1) a protein with an amino acid sequence of SEQ ID No. 9; C2) a protein with an amino acid sequence obtained by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in SEQ ID No. 9 in the sequence listing, having an identity of more than 98% with C1) and having the same function; C3) a fusion protein obtained by linking a tag to the N-terminus and / or C-terminus of C1) or C2).

[0005] The TaVRN1-5A protein in the above A2) is a protein having an identity of 98% or more with the amino acid sequence of the protein shown in SEQ ID No. 3 and having the same function. The TaVRN1-5B protein in the above B2) is a protein having an identity of 98% or more with the amino acid sequence of the protein shown in SEQ ID No. 6 and having the same function. The TaVRN1-5D protein in the above C2) is a protein having an identity of 98% or more with the amino acid sequence of the protein shown in SEQ ID No. 9 and having the same function. Identity refers to the identity of amino acid sequences. The identity of amino acid sequences can be determined using homology search sites on the Internet, such as the BLAST web page on the NCBI homepage website. For example, in Advanced BLAST 2.1, by using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, and setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and then retrieving to calculate the identity of a pair of amino acid sequences, the identity value (%) can be obtained. The "having an identity of 98% or more" means having an identity of 98% or 99%.

[0006] The TaVRN1-5A protein in the above A2), the TaVRN1-5B protein in the above B2), and the TaVRN1-5D protein in the above C2) can be artificially synthesized, or their encoding genes can be synthesized first and then obtained by biological expression.

[0007] The coding gene of the TaVRN1-5A protein in A2) above can be obtained by deleting the codons of one or several amino acid residues in the DNA sequence shown in SEQ ID No. 2, and / or performing a missense mutation of one or several base pairs, and / or ligating the coding sequence of a tag at its 5′ end and / or 3′ end. Among them, the DNA molecule shown in SEQ ID No. 2 encodes the TaVRN1-5A protein shown in SEQ ID No. 3. The coding gene of the TaVRN1-5B protein in B2) above can be obtained by deleting the codons of one or several amino acid residues in the DNA sequence shown in SEQ ID No. 5, and / or performing a missense mutation of one or several base pairs, and / or ligating the coding sequence of a tag at its 5′ end and / or 3′ end. Among them, the DNA molecule shown in SEQ ID No. 5 encodes the TaVRN1-5B protein shown in SEQ ID No. 6. The coding gene of the TaVRN1-5D protein in C2) above can be obtained by deleting the codons of one or several amino acid residues in the DNA sequence shown in SEQ ID No. 8, and / or performing a missense mutation of one or several base pairs, and / or ligating the coding sequence of a tag at its 5′ end and / or 3′ end. Among them, the DNA molecule shown in SEQ ID No. 8 encodes the TaVRN1-5D protein shown in SEQ ID No. 9.

[0008] A3), B3), and C3) The tag described above can be a polypeptide or protein that is fused and expressed with the target protein using in vitro DNA recombination technology to facilitate the expression, detection, tracing, and / or purification of the target protein. The tag can be Poly-Arg, Poly-His, FLAG, Strep-tag II, c-myc, MBP tag, HA tag, GST tag, and / or SUMO tag, etc.

[0009] In the above application, the substance that regulates the content or activity of TaVRN1 is the substance that regulates the content or activity of the TaVRN1-5A protein, the substance that regulates the content or activity of the TaVRN1-5B protein, and / or the substance that regulates the content or activity of the TaVRN1-5D protein; The substance for regulating the content or activity of the TaVRN1-5A protein is any one of the following D1) to D9): D1) a nucleic acid molecule encoding the TaVRN1-5A protein; D2) an expression cassette containing the nucleic acid molecule described in D1); D3) a recombinant vector containing the nucleic acid molecule described in D1), or a recombinant vector containing the expression cassette described in D2); D4) a recombinant microorganism containing the nucleic acid molecule described in D1), or a recombinant microorganism containing the expression cassette described in D2), or a recombinant microorganism containing the recombinant vector described in D3); D5) a transgenic plant cell line containing the nucleic acid molecule described in D1), or a transgenic plant cell line containing the expression cassette described in D2); D6) a transgenic plant tissue containing the nucleic acid molecule described in D1), or a transgenic plant tissue containing the expression cassette described in D2); D7) a transgenic plant organ containing the nucleic acid molecule described in D1), or a transgenic plant organ containing the expression cassette described in D2); D8) a nucleic acid molecule that reduces the content or activity of the TaVRN1-5A protein; D9) an expression cassette, recombinant vector, recombinant microorganism, transgenic plant cell line, transgenic plant tissue or transgenic plant organ containing the nucleic acid molecule described in D8); The substance for regulating the content or activity of the TaVRN1-5B protein is any one of the following E1) to E9): E1) a nucleic acid molecule encoding the TaVRN1-5B protein; E2) an expression cassette containing the nucleic acid molecule described in E1); E3) a recombinant vector containing the nucleic acid molecule described in E1), or a recombinant vector containing the expression cassette described in E2); E4) a recombinant microorganism containing the nucleic acid molecule described in E1), or a recombinant microorganism containing the expression cassette described in E2), or a recombinant microorganism containing the recombinant vector described in E3); E5) a transgenic plant cell line containing the nucleic acid molecule described in E1), or a transgenic plant cell line containing the expression cassette described in E2); E6) a transgenic plant tissue containing the nucleic acid molecule described in E1), or a transgenic plant tissue containing the expression cassette described in E2); E7) a transgenic plant organ containing the nucleic acid molecule described in E1), or a transgenic plant organ containing the expression cassette described in E2); E8) a nucleic acid molecule that reduces the content or activity of the TaVRN1-5B protein; E9) an expression cassette, recombinant vector, recombinant microorganism, transgenic plant cell line, transgenic plant tissue or transgenic plant organ containing the nucleic acid molecule described in E8); The substance for regulating the content or activity of the TaVRN1-5D protein is any one of the following F1) to F9): F1) a nucleic acid molecule encoding the TaVRN1-5D protein; F2) an expression cassette containing the nucleic acid molecule described in F1); F3) a recombinant vector containing the nucleic acid molecule described in F1), or a recombinant vector containing the expression cassette described in F2); F4) a recombinant microorganism containing the nucleic acid molecule described in F1), or a recombinant microorganism containing the expression cassette described in F2), or a recombinant microorganism containing the recombinant vector described in F3); F5) a transgenic plant cell line containing the nucleic acid molecule described in F1), or a transgenic plant cell line containing the expression cassette described in F2); F6) a transgenic plant tissue containing the nucleic acid molecule described in F1), or a transgenic plant tissue containing the expression cassette described in F2); F7) a transgenic plant organ containing the nucleic acid molecule described in F1), or a transgenic plant organ containing the expression cassette described in F2); F8) a nucleic acid molecule that reduces the content or activity of the TaVRN1-5D protein; F9) an expression cassette, recombinant vector, recombinant microorganism, transgenic plant cell line, transgenic plant tissue or transgenic plant organ containing the nucleic acid molecule described in F8).

[0010] Among them, the nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.

[0011] Those of ordinary skill in the art can easily mutate the nucleotide sequence encoding the TaVRN1 protein of the present invention by using known methods, such as directed evolution and point mutation methods. Those artificially modified nucleotides having 75% or higher identity with the nucleotide sequence of the TaVRN1 protein isolated from the present invention, as long as they encode the TaVRN1 protein and have the function of the TaVRN1 protein, are all derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention.

[0012] In the above application, D1) the nucleic acid molecule may be a DNA molecule whose coding sequence is SEQ ID No.2 in the sequence listing; E1) the nucleic acid molecule may be a DNA molecule whose coding sequence is SEQ ID No.5 in the sequence listing; F1) the nucleic acid molecule may be a DNA molecule whose coding sequence is SEQ ID No.8 in the sequence listing.

[0013] Specifically, D1) the nucleic acid molecule may be the DNA molecule shown in SEQ ID No.2 or SEQ ID No.1; E1) the nucleic acid molecule may be the DNA molecule shown in SEQ ID No.5 or SEQ ID No.4; F1) The nucleic acid molecule may be the DNA molecule shown in SEQ ID No. 8 or SEQ ID No. 7.

[0014] In the above applications, D2) The expression cassette containing the nucleic acid molecule encoding TaVRN1-5A protein (TaVRN1-5A gene expression cassette) refers to the DNA that can express TaVRN1-5A protein in a host cell. This DNA may not only include the promoter that initiates the transcription of the TaVRN1-5A gene, but also include the terminator that terminates the transcription of the TaVRN1-5A gene. E2) The expression cassette containing the nucleic acid molecule encoding TaVRN1-5B protein (TaVRN1-5B gene expression cassette) refers to the DNA that can express TaVRN1-5B protein in a host cell. This DNA may not only include the promoter that initiates the transcription of the TaVRN1-5B gene, but also include the terminator that terminates the transcription of the TaVRN1-5B gene. F2) The expression cassette containing the nucleic acid molecule encoding TaVRN1-5D protein (TaVRN1-5D gene expression cassette) refers to the DNA that can express TaVRN1-5D protein in a host cell. This DNA may not only include the promoter that initiates the transcription of the TaVRN1-5D gene, but also include the terminator that terminates the transcription of the TaVRN1-5D gene. Further, the expression cassette may also include enhancer sequences.

[0015] Existing expression vectors can be used to construct recombinant vectors containing the TaVRN1-5A gene, TaVRN1-5B gene, and TaVRN1-5D gene expression cassettes.

[0016] In the above applications, the vector may be a plasmid, cosmid, phage, or viral vector. Specifically, the plasmid may be pWMB110 vector.

[0017] In one embodiment of the present invention, B3) The recombinant vector is specifically pWMB110::TaVRN1-5A . The pWMB110::TaVRN1-5A is a recombinant vector obtained by inserting the TaVRN1-5A gene into the pWMB110 vector.

[0018] D8) The nucleic acid molecule for reducing the content of TaVRN1-5A may be an sgRNA targeting the coding gene of TaVRN1-5A. E8) The nucleic acid molecule for reducing the content of TaVRN1-5B may be an sgRNA targeting the coding gene of TaVRN1-5B. F8) The nucleic acid molecule for reducing the content of TaVRN1-5D may be an sgRNA targeting the coding gene of TaVRN1-5D.

[0019] D9) The recombinant vector may be a recombinant vector prepared using the crisper / cas9 system that can edit the TaVRN1-5A gene. The recombinant vector can express an sgRNA targeting the nucleic acid molecule of D1). The target sequence of the sgRNA may be positions 206-227 of SEQ ID No.1 in the sequence listing.

[0020] E9) The recombinant vector may be a recombinant vector prepared using the crisper / cas9 system that can edit the TaVRN1-5B gene. The recombinant vector can express an sgRNA targeting the nucleic acid molecule of E1). The target sequence of the sgRNA may be positions 197-218 of SEQ ID No.4 in the sequence listing.

[0021] F9) The recombinant vector may be a recombinant vector prepared using the crisper / cas9 system that can edit the TaVRN1-5D gene. The recombinant vector can express an sgRNA targeting the nucleic acid molecule of F1). The target sequence of the sgRNA may be positions 260-281 of SEQ ID No.7 in the sequence listing.

[0022] In the above applications, the microorganism may be yeast, bacteria, algae or fungi. Among them, the bacteria may be Agrobacterium, such as Agrobacterium EHA105.

[0023] In the above applications, the transgenic plant cell line, transgenic plant tissue and transgenic plant organ do not include propagation materials.

[0024] In the above applications, the substance that regulates the content or activity of TaVRN1 is a substance that increases the content or activity of TaVRN1. The regulation of the heading date of the plant is to shorten the heading date of the plant. The cultivation of a plant with a changed heading date is to cultivate a plant with a shortened heading date. The regulation of the plant height is to increase the plant height. The cultivation of a plant with a changed plant height is to cultivate a plant with an increased plant height; The substance that regulates the content or activity of TaVRN1 is a substance that decreases the content or activity of TaVRN1. The regulation of the heading date of the plant is to extend the heading date of the plant. The cultivation of a plant with a changed heading date is to cultivate a plant with an extended heading date. The regulation of the plant height is to decrease the plant height. The cultivation of a plant with a changed plant height is to cultivate a plant with a decreased plant height.

[0025] The present invention also provides any of the following methods: X1) A method for shortening the heading date of a plant and / or increasing the plant height, including: enabling the plant to express TaVRN1, or increasing the content or activity of TaVRN1, to achieve shortening of the heading date of the plant and / or increase in the plant height; X2) A method for cultivating plants with shortened heading date and / or increased plant height, comprising: causing the plant to express TaVRN1, or increasing the content or activity of TaVRN1, to obtain a plant with a shortened heading date and / or increased plant height; X3) A method for extending the heading date of plants and / or reducing the plant height, comprising: reducing the content or activity of TaVRN1 in the plant, or knocking out the coding gene of TaVRN1 in the plant, or reducing the expression level of the coding gene of TaVRN1 in the plant, to achieve the extension of the heading date of the plant and / or the reduction of the plant height; X4) A method for cultivating plants with an extended heading date and / or reduced plant height, comprising: reducing the content or activity of TaVRN1 in the plant, or knocking out the coding gene of TaVRN1 in the plant, or reducing the expression level of the coding gene of TaVRN1 in the plant, to obtain a plant with an extended heading date and / or reduced plant height.

[0026] In the above methods, the methods described in X1) and X2) can be achieved by introducing the coding gene of TaVRN1 into the plant and causing the coding gene to be expressed; The methods described in X3) and X4) are achieved by inhibiting the expression of the coding gene of TaVRN1 in the plant, or knocking out the coding gene of the protein in the plant.

[0027] In the above methods, the coding gene can be the nucleic acid molecule described in D1), E1) and / or F1).

[0028] The coding gene of TaVRN1 can be introduced into the recipient plant by using a recombinant expression vector containing the coding gene of TaVRN1. The recombinant expression vector can specifically be the pWMB110::TaVRN1-5A .

[0029] In the above methods, the methods described in X3) and X4) are achieved by editing the coding gene of TaVRN1, such as the CRISPR / Cas9 method.

[0030] Gene editing of the coding gene by the CRISPR / Cas9 method can be achieved by introducing an editing vector (such as pBUE413-TaVRN1 ) encoding Cas9 and capable of transcribing and targeting the coding gene into the plant and screening to obtain the target plant with the edited coding gene.

[0031] In one embodiment of the present invention, the target plants are KO#1, KO#2, KO#3, and KO#4; in KO#1, an A is inserted between positions 221 and 222 of SEQ ID No.1; in KO#2, an A is inserted between positions 212 and 213 of SEQ ID No.4; in KO#3, an A is inserted between positions 275 and 276 of SEQ ID No.7; in KO#4, a T is inserted between positions 221 and 222 of SEQ ID No.1, the C at position 212 of SEQ ID No.4 is deleted, and an A is inserted between positions 275 and 276 of SEQ ID No.7.

[0032] The recombinant expression vector and the editing vector can be introduced into plant cells by conventional biotechnological methods such as using Ti plasmids, plant virus vectors, direct DNA transformation, microinjection, electroporation, etc. (Weissbach, 1998, Method for Plant Molecular Biology VIII, Academy Press, New York, pp.411 - 463; Geiserson and Corey, 1998, Plant Molecular Biology (2nd Edition).).

[0033] The target plants are understood to include not only the first - generation plants in which the TaVRN1 protein or its encoding gene is altered, but also their progeny. For the target plants, the gene can be propagated in this species, or transferred into other varieties of the same species, especially including commercial varieties, by conventional breeding techniques. The target plants include seeds, callus, whole plants, and cells.

[0034] In the present invention, the plant can be M1) or M2) or M3): M1) monocotyledonous plants; M2) gramineous plants; M3) wheat.

[0035] TaVRN1 or the substance that regulates the content or activity of TaVRN1 also belongs to the protection scope of the present invention.

[0036] Experimental results have shown that TaVRN1 protein and its encoding gene can regulate the heading date and plant height of plants: overexpression of the TaVRN1 gene can shorten the heading date of plants and increase their plant height; knockout of the TaVRN1 gene can prolong the heading date of plants and reduce their plant height. This indicates that TaVRN1 protein and its encoding gene can be used to regulate the heading date and plant height of plants. The plants with altered agronomic traits generated in the present invention can be used as breeding resources to accelerate the cultivation process of plants with shortened heading dates and reduced plant heights. The plants with altered agronomic traits generated in the present invention are used to study which other genes are involved in the response of heading date and plant height after overexpression or silencing of the TaVRN1 gene. The present invention provides new germplasm resources for genetic breeding work, provides new materials for plant variety breeding, and has a positive effect on accelerating the improvement of plant varieties.

[0037] The present invention will be further described in detail below in conjunction with specific embodiments. The provided embodiments are only for clarifying the present invention and not for limiting the scope of the present invention. The following embodiments can be used as a guide for those of ordinary skill in the art to make further improvements and do not constitute any limitation to the present invention in any way. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 For TaVRN1 Results of gene knockout, overexpression, and phenotype identification. Figure A shows TaVRN1 Schematic diagram of gene structure and sgRNA target sites and TaVRN1 Genotypes of the gene in KO#1, KO#2, KO#3, and KO#4 lines. Red letters indicate PAM sites, blue letters indicate mutation situations, "+" indicates nucleotide insertion, black dashed lines indicate nucleotide deletion, and the number of inserted and deleted bases is shown on the right. Figures B-C show the heading date phenotypes and statistical analyses of wild-type Fielder and TaVRN1 gene knockout lines KO#1, KO#2, KO#3, and KO#4, Bar = 15 cm. Figures D-E show the plant height phenotypes and statistical analyses of wild-type Fielder and TaVRN1 gene knockout lines KO#1, KO#2, KO#3, and KO#4, Bar = 15 cm. Figures F-G show the heading date phenotypes and statistics of wild-type Fielder and TaVRN1 gene overexpression lines #1 and #2, Bar = 20 cm. Figures H-I show the plant height phenotypes and statistics of wild-type Fielder and TaVRN1 gene overexpression lines #1 and #2, Bar = 20 cm. In Figures F-I, #1 and #2 represent OE-1 and OE-2 respectively. Among them, the error bars represent SD. * indicates significant difference analysis P <0.05, ** indicates significant difference analysis P< 0.01, *** indicates the significance analysis of differences P <0.001, Student’s t test. Specific implementation manners

[0039] The following examples perform gene editing on the genes in the A, B, and D genomes of the wheat variety Fielder (denoted as TaVRN1 gene, TaVRN1-5A gene, TaVRN1-5B gene, TaVRN1-5D gene) respectively. Compared with Fielder, the heading date and maturity date of the plants after gene editing are postponed, and the plant height is reduced. Overexpression of TaVRN1-5A gene in wheat Fielder shortens the heading date and increases the plant height.

[0040] In Fielder, TaVRN1-5A the genomic sequence of the gene is shown in SEQ ID No.1, the CDS sequence is shown in SEQ ID No.2, and it encodes the TaVRN1-5A protein shown in SEQ ID No.3; TaVRN1-5B the genomic sequence of the gene is shown in SEQ ID No.4 (N in SEQ ID No.4 represents undetermined nucleotides), the CDS sequence is shown in SEQ ID No.5, and it encodes the TaVRN1-5B protein shown in SEQ ID No.6; TaVRN1-5D the genomic sequence of the gene is shown in SEQ ID No.7, the CDS sequence is shown in SEQ ID No.8, and it encodes the TaVRN1-5D protein shown in SEQ ID No.9.

[0041] The experimental methods in the following examples are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, instruments, etc. used in the following examples can be obtained from commercial channels unless otherwise specified. In the quantitative tests in the following examples, at least three repeated experiments are set, and the results are averaged. In the following examples, unless otherwise specified, the first position of each nucleotide sequence in the sequence listing is the 5'-terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3'-terminal nucleotide of the corresponding DNA / RNA.

[0042] The CRISPR / cas9 gene editing vector pBUE413 in the following examples is described in the literature "Wang Zhiping (2017) Doctoral Thesis, Creation and Functional Verification of Plant Genomes and Base Editing Toolkits, Doctoral Thesis of China Agricultural University, P40-41, 2017". The public can obtain it from the Institute of Crop Science, Chinese Academy of Agricultural Sciences. This biological material is only used for repeating the relevant experiments of the present invention and cannot be used for other purposes.

[0043] In the following examples, Bsa The I endonuclease and T4 ligase are products of NEB company, and the product catalog numbers are R3535 and M0202V respectively.

[0044] Example 1. Overexpression TaVRN1-5A The wheat with the overexpressed gene can regulate the heading date and plant height of wheat and increase wheat yield I. Construction of TaVRN1-5A the overexpression vector of the gene Use the restriction endonuclease BamHⅠ and SpeⅠ to digest pWMB110 the vector to obtain the vector backbone fragment; use the In-Fusion enzyme to ligate the target fragment with the linker into the vector backbone fragment, and the resulting recombinant vector is TaVRN1 the overexpression vector of the gene. The specific steps are as follows: (I) PCR amplification Using the cDNA of wheat Fielder as a template, and using pWMB110-TaVRN1-5A-BamHⅠ-Fw / pWMB110- TaVRN1-5A-SpeI-Rv as primers for PCR amplification to obtain the PCR amplification product (the underlined sequence is the In-Fusion linker sequence).

[0045] pWMB110-TaVRN1-5A-BamHⅠ-Fw : 5′- AGGTCGACTCTAGAGGATCC ATGGGGCGGGGGAAGG -3′; pWMB110-TaVRN1-5A-SpeI-Rv : 5′- ATGAATTCCGGCTCGAGACTAGT CCCGTTGATGTGGCTC-3′; (II) Plasmid digestion Use the restriction endonuclease BamHⅠ and SpeI to digest pWMB110 the vector to obtain the vector backbone fragment.

[0046] (III) Ligation with In-Fusion enzyme Use the In-Fusion enzyme to ligate the PCR amplification product obtained in step (I) into the vector backbone fragment obtained in step (II), and the correctly sequenced recombinant vector is denoted as pWMB110::TaVRN1-5A . This recombinant vector can express the fusion protein formed by the TaVRN1-5A protein shown in SEQ ID No. 3 and the 3×flag tag. TaVRN1-5A The expression of the gene is driven by the maize ubiquitin promoter Ubiquitin (abbreviated as Ubi) promoter.

[0047] II. Obtaining of recombinant Agrobacterium The above recombinant plasmid pWMB110::TaVRN1-5A was introduced into Agrobacterium tumefaciens EHA105 to obtain the recombinant strain EHA105 / pWMB110::TaVRN1-5A .

[0048] III. Obtaining of T0 transgenic wheat Using wheat Fielder as the recipient plant, genetic transformation was carried out by the Agrobacterium-mediated genetic transformation method using the recombinant strain EHA105 / pWMB110::TaVRN1-5A obtained in Step II, and 22 T0 transgenic wheat plants were obtained.

[0049] IV. Identification of transgenic plants 1. Identification with Bar test strip The transgenic wheat obtained in Step III was detected using the PAT / Bar rapid test strip produced by Shanghai Youlong Biotechnology, and the positive transgenic wheat OE-1 and OE-2 were screened out.

[0050] 2. Phenotypic identification The plants to be tested were OE-1, OE-2 of the T2 generation and wild-type wheat (Fielder), and no less than 8 individual plants were selected for each line.

[0051] The plant heights at the heading stage and maturity stage of wheat were statistically analyzed. The results showed that compared with Fielder, the heading stage of the positive transgenic wheat was advanced by 6 - 8 days, significantly lower than that of the wild-type wheat, and the plant height was significantly higher than that of the wild-type wheat. It is shown that TaVRN1-5A the gene is involved in regulating the heading stage and plant height of wheat.

[0052] Example 2. Knockout of the TaVRN1 gene in wheat can affect the plant height and heading stage of wheat and regulate wheat yield In this example, CRISPR / Cas9-mediated gene editing was carried out on three orthologous genes ( TaVRN1 of TaVRN1-5A , TaVRN1-5B and TaVRN1-5D ) in the background of Fielder. A target site was designed at the position of the first exon of TaVRN1 , and the sequence of the target site was: 5′-GATCGAGAACAAGATCAACCGG-3′ (i.e., positions 206 - 227 of SEQ ID No.1, positions 197 - 218 of SEQ ID No.4, positions 260 - 281 of SEQ ID No.7).

[0053] I. Construction of recombinant plasmid pBUE413-TaVRN1 of 1. Using the intermediate vector pCBC-MT1T2Using [[template]], PCR amplification was performed with the primer pair consisting of primer VRN1-MT1T2-F0: 5′-GGATCGAGAACAAGATCAACGTTTTAGAGCTAGAAATAGC-3′ and primer VRN1-MT1T2-R0: 5′-TGGTGGAGAAGATGATGAGCGCTTCTTGGTGCC-3′, and a DNA fragment of approximately 964 bp was recovered.

[0054] 2. Prepare the enzyme digestion and ligation reaction system. The reaction system was 15 μL, consisting of 2 μL of the DNA fragment obtained by PCR amplification in step 1, 2 μL of pBUE413 vector, 1.5 μL of 10×NEB T4 Buffer, 1.5 μL of 10×BSA, 1 μL of restriction endonuclease Bsa I, 1 μL of T4 DNA ligase, and 6 μL of ddH2O.

[0055] 3. Take the reaction system prepared in step 2 and perform the reaction (reaction program: 37°C for 5 h, 50°C for 5 min, 80°C for 10 min), then transform Escherichia coli TOP10 competent cells, select positive clones, send them to Beijing Qingke Xinyi Biotechnology Co., Ltd. for sequencing, and the sequencing primers are pBUE413-SeqF: 5′-TTTCCCAGTCACGACGTTGT-3′ and pBUE413-SeqR: 5′-ATCTCTAGAGAGGGGCACGA-3′. Select positive clones with the target site sequences correctly constructed on the pBUE413 vector, extract the plasmid to obtain the recombinant plasmid with the correct sequence, denoted as pBUE413-TaVRN1 . pBUE413-TaVRN1 It can transcribe the sgRNA targeting TaVRN1-5A , TaVRN1-5B and TaVRN1-5D genes and can express Cas protein.

[0056] II. Obtaining recombinant Agrobacterium The recombinant plasmid pBUE413-TaVRN1 was introduced into Agrobacterium EHA105 to obtain recombinant Agrobacterium, named EHA105 / pBUE413-TaVRN1 .

[0057] III. Obtaining T0 generation transgenic wheat Using wheat Fielder as the recipient plant, genetic transformation was carried out by the Agrobacterium-mediated genetic transformation method using the recombinant bacterium EHA105 / pBUE413-TaVRN1 obtained in step 2, and 19 T0 generation transgenic wheat plants were obtained.

[0058] IV. Molecular identification and phenotypic identification of transgenic wheat mutation types 1. PCR molecular identification Using the genomic DNA (gDNA) of the T0 generation transgenic wheat obtained in Step 3 as a template, PCR amplification was performed to identify gene-edited transgenic lines. The primers used were as follows: TaVRN1-5A Gene: F1A: 5′-TGGCCTGGCCATCCTCACCTCACG-3′; R1A: 5′-TCGCCAGCACCAACAAATATCACG-3′.

[0059] TaVRN1-5B Gene: F1B: 5′-CTTCCGCCTCACCCAACCACCT-3′; R1B: 5′-GGTATTGTAGCGTCTAGTAAGATTCT-3′.

[0060] TaVRN1-5D Gene: F1D: 5′-TCTCGCCTTCCATTCCATTTC-3′; R1D: 5′-TTTGATGAGGCAGACAACCA-3′.

[0061] 2. The PCR amplification products were respectively recovered, purified, and sent to Beijing Tsingke New Industry Biotechnology Co., Ltd. for sequencing.

[0062] 3. Use SeqMan to analyze the sequencing results and count the mutation types.

[0063] 4. Phenotypic identification of transgenic wheat A total of 19 individual plants were obtained in the T0 generation, among which 19 all had homozygous or biallelic heterozygous mutations. Sequencing and phenotypic identification in the T1 generation showed that the lines with different mutations at the target site all showed the phenotype of late heading. Sequencing and phenotypic identification were performed on the homozygous lines with different mutation types in the T2 generation.

[0064] The plants with positive PCR identification of different mutations at the target site are TaVRN1 edited plants. For a certain T1 generation plant, if all the T2 generation plants obtained by self-crossing this plant are identified as positive by PCR, then this plant is a homozygous TaVRN1 edited plant, and this plant and its offspring are one TaVRN1 edited line.

[0065] After the above identification experiments, four TaVRN1 edited wheat homozygous lines KO#1 、 KO#2 、 KO#3 and KO#4 ( Figure 1 in A).

[0066] KO#1 is Figure 1 in vrn1-aa and its editing situation is: ForTaVRN1-5A For the gene, an A is inserted between positions 221 and 222 of SEQ ID No.1, and TaVRN1-5B 、 TaVRN1-5D the genome is not edited.

[0067] KO#2 is Figure 1 in vrn1-bb and its editing situation is: for the TaVRN1-5B gene, an A is inserted between positions 212 and 213 of SEQ ID No.4, and TaVRN1-5A 、 TaVRN1-5D the genome is not edited.

[0068] KO#3 is Figure 1 in vrn1-dd and its editing situation is: for the TaVRN1-5D gene, an A is inserted between positions 275 and 276 of SEQ ID No.7, and TaVRN1-5A 、 TaVRN1-5B the genome is not edited.

[0069] KO#4 is Figure 1 in vrn1-aabbdd and its editing situation is: for the TaVRN1-5A gene, a T is inserted between positions 221 and 222 of SEQ ID No.1; for the TaVRN1-5B gene, the C at position 212 of SEQ ID No.4 is deleted; for the TaVRN1- 5D gene, an A is inserted between positions 275 and 276 of SEQ ID No.7.

[0070] The above molecular identification was performed on the T1 and T2 generation plants of the control group, and the results were all negative.

[0071] Compared with wheat Fielder, vrn1-aa 、 vrn1-bb 、 vrn1-dd and vrn1-aabbdd all showed a significant increase in heading date and a significant decrease in plant height. It is shown that TaVRN1-5A 、 TaVRN1-5B 、 TaVRN1-5D genes are all involved in regulating the heading date and plant height of wheat.

[0072] The above has described the present invention in detail. For those skilled in the art, without departing from the gist and scope of the present invention and without the need for unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to cover any modifications, uses, or improvements to the present invention, including those that depart from the scope disclosed in this application and are made using conventional techniques known in the art. The application of some basic features can be made within the scope of the appended claims below.

Claims

1. At least one of the following uses of a protein or a substance for regulating the content or activity of the protein: Y1) regulates the heading period of plants; Y2) preparing products for regulating the heading period of plants; Y3) Cultivating plants with altered heading date; Y4) preparing products for breeding plants with altered heading date; Y5) Regulate plant height; Y6) Preparation of products for regulating plant height; Y7) Cultivating plants with altered plant height; Y8) preparing products for breeding plants with altered plant height; The protein is TaVRN1-5A protein, TaVRN1-5B protein and / or TaVRN1-5D protein; The TaVRN1-5A protein is as follows: A1), A2) or A3): A1) a protein having an amino acid sequence of SEQ ID No. 3; A2) a protein having 98% or more identity with A1) and having the same function as the amino acid sequence shown in SEQ ID No. 3 in the sequence list, after substitution and / or deletion and / or addition of amino acid residues; A3) A fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of A1) or A2); The TaVRN1-5B protein is as follows (B1), B2) or B3): B1) a protein whose amino acid sequence is SEQ ID No. 6; B2) a protein having 98% or more identity with B1) and having the same function as B1) by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in SEQ ID No. 6 in the sequence list; B3) A fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of B1) or B2); The TaVRN1-5D protein is as follows: C1), C2) or C3): C1) a protein whose amino acid sequence is SEQ ID No. 9; C2) a protein having 98% or more identity with C1) and having the same function as C1) by substitution and / or deletion and / or addition of amino acid residues in the amino acid sequence shown in SEQ ID No. 9 in the sequence list; C3) A fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of C1) or C2).

2. The use according to claim 1, characterized in that: The substance that regulates the protein content or activity is a substance that regulates the TaVRN1-5A protein content or activity, a substance that regulates the TaVRN1-5B protein content or activity, and / or a substance that regulates the TaVRN1-5D protein content or activity; The substance that regulates the content or activity of the TaVRN1-5A protein is any one of the following D1) to D9): D1) a nucleic acid molecule encoding the TaVRN1-5A protein; D2) an expression cassette containing the nucleic acid molecule described in D1); D3) a recombinant vector containing the nucleic acid molecule described in D1), or a recombinant vector containing the expression cassette described in D2); D4) a recombinant microorganism containing the nucleic acid molecule described in D1), or a recombinant microorganism containing the expression cassette described in D2), or a recombinant microorganism containing the recombinant vector described in D3); D5) a transgenic plant cell line containing the nucleic acid molecule described in D1), or a transgenic plant cell line containing the expression cassette described in D2); D6) transgenic plant tissue containing the nucleic acid molecule described in D1), or transgenic plant tissue containing the expression cassette described in D2); D7) a transgenic plant organ containing the nucleic acid molecule described in D1) or a transgenic plant organ containing the expression cassette described in D2); D8) a nucleic acid molecule that reduces the content or activity of the TaVRN1-5A protein; D9) an expression cassette, a recombinant vector, a recombinant microorganism, a transgenic plant cell line, a transgenic plant tissue or a transgenic plant organ containing the nucleic acid molecule described in D8); The substance that regulates the content or activity of the TaVRN1-5B protein is any one of the following E1) to E9): E1) a nucleic acid molecule encoding the TaVRN1-5B protein; E2) an expression cassette containing the nucleic acid molecule described in E1); E3) a recombinant vector containing the nucleic acid molecule described in E1), or a recombinant vector containing the expression cassette described in E2); E4) a recombinant microorganism containing the nucleic acid molecule described in E1), or a recombinant microorganism containing the expression cassette described in E2), or a recombinant microorganism containing the recombinant vector described in E3); E5) a transgenic plant cell line containing the nucleic acid molecule described in E1), or a transgenic plant cell line containing the expression cassette described in E2); E6) transgenic plant tissue containing the nucleic acid molecule described in E1), or transgenic plant tissue containing the expression cassette described in E2); E7) a transgenic plant organ containing the nucleic acid molecule described in E1), or a transgenic plant organ containing the expression cassette described in E2); E8) a nucleic acid molecule that reduces the content or activity of the TaVRN1-5B protein; E9) an expression cassette, a recombinant vector, a recombinant microorganism, a transgenic plant cell line, a transgenic plant tissue or a transgenic plant organ containing the nucleic acid molecule described in E8); The substance that regulates the content or activity of the TaVRN1-5D protein is any one of the following F1) to F9): F1) a nucleic acid molecule encoding the TaVRN1-5D protein; F2) an expression cassette containing the nucleic acid molecule described in F1); F3) a recombinant vector containing the nucleic acid molecule described in F1), or a recombinant vector containing the expression cassette described in F2); F4) a recombinant microorganism containing the nucleic acid molecule described in F1), or a recombinant microorganism containing the expression cassette described in F2), or a recombinant microorganism containing the recombinant vector described in F3); F5) a transgenic plant cell line containing the nucleic acid molecule described in F1), or a transgenic plant cell line containing the expression cassette described in F2); F6) transgenic plant tissue containing the nucleic acid molecule described in F1), or transgenic plant tissue containing the expression cassette described in F2); F7) a transgenic plant organ containing the nucleic acid molecule described in F1), or a transgenic plant organ containing the expression cassette described in F2); F8) a nucleic acid molecule that reduces the content or activity of the TaVRN1-5D protein; F9) An expression cassette, a recombinant vector, a recombinant microorganism, a transgenic plant cell line, a transgenic plant tissue or a transgenic plant organ containing the nucleic acid molecule described in F8).

3. The use according to claim 2, characterized in that: D1) the nucleic acid molecule is a DNA molecule whose coding sequence is SEQ ID No. 2 in the sequence list; E1) the nucleic acid molecule is a DNA molecule whose coding sequence is SEQ ID No. 5 in the sequence list; F1) The nucleic acid molecule is a DNA molecule whose coding sequence is SEQ ID No. 8 in the sequence list.

4. The use according to any one of claims 1 to 3, characterized in that: The substance for regulating the protein content or activity is a substance for increasing the protein content or activity, the substance for regulating the heading period of a plant is a substance for shortening the heading period of a plant, and the substance for cultivating plants with a changed heading period is a substance for cultivating plants with a shortened heading period, the substance for regulating the plant height is a substance for increasing the plant height, and the substance for cultivating plants with a changed plant height is a substance for cultivating plants with increased plant height; The substance for regulating the protein content or activity is a substance for reducing the protein content or activity, the substance for regulating the heading period of the plant is for extending the heading period of the plant, the substance for cultivating plants with a changed heading period is for cultivating plants with a prolonged heading period, the substance for regulating the plant height is for reducing the plant height, and the substance for cultivating plants with a changed plant height is for cultivating plants with reduced plant height.

5. The use according to any one of claims 1 to 4, characterized in that: The plant is M1) or M2) or M3): M1) Monocots; M2) Gramineae; M3) Wheat.

6. Any of the following methods: X1) A method for shortening the heading period of a plant and / or increasing the height of a plant, comprising: Allowing a plant to express the protein described in claim 1, or increasing the content or activity of the protein described in claim 1, to achieve a shortened heading period and / or increased plant height; X2) A method for cultivating a plant with a shortened heading period and / or increased plant height, comprising: causing the plant to express the protein of claim 1, or increasing the content or activity of the protein of claim 1, to obtain a plant with a shortened heading period and / or increased plant height; X3) A method for extending the heading period of a plant and / or reducing the height of a plant, comprising: reducing the content or activity of the protein of claim 1 in a plant, or knocking out the gene encoding the protein of claim 1 in a plant, or reducing the expression level of the gene encoding the protein of claim 1 in a plant, so as to extend the heading period of a plant and / or reduce the height of the plant; X4) A method for cultivating plants with prolonged heading period and / or reduced plant height, comprising: reducing the content or activity of the protein described in claim 1 in the plant, or knocking out the gene encoding the protein described in claim 1 in the plant, or reducing the expression level of the gene encoding the protein described in claim 1 in the plant, to obtain plants with prolonged heading period and / or reduced plant height.

7. The method according to claim 6, characterized in that: The methods X1) and X2) are achieved by introducing a gene encoding the protein into the plant and allowing the gene to be expressed; The methods X3) and X4) are achieved by inhibiting the expression of the gene encoding the protein in the plant, or knocking out the gene encoding the protein in the plant.

8. The method according to claim 7, characterized in that: The methods X3) and X4) are achieved by editing the gene encoding the protein.

9. The method according to any one of claims 6 to 8, characterized in that: The plant is M1) or M2) or M3): M1) Monocots; M2) Gramineae; M3) Wheat.

10. The protein according to claim 1 or the substance for regulating the content or activity of the protein according to any one of claims 1 to 3.

Images