Gene for altering flowering time and / or maturation of soybean plants and use thereof

Abstract

Compositions and methods for altering the flowering and / or maturing time of soybean plants are provided. Compositions include isolated and recombinant polynucleotides encoding polypeptides, expression cassettes, host cells, plants, plant parts that stabilize incorporation of these polynucleotides. Methods and kits for producing these plants via transgenic means, breeding, or genome editing methods and identifying plants with altered flowering and / or maturation times are provided.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of and priority to International Application No. PCT / CN2022 / 130366, filed on November 7, 2022. The entire contents of said application are incorporated herein by reference for all purposes. Technical Field

[0002] The present disclosure relates to the field of plant biotechnology. In particular, the present disclosure relates to genes, methods of use, and compositions for altering the flowering time and / or maturity time of photoperiodic plants to enable cultivation of these photoperiodic plants in multiple geographic locations with different day lengths. Sequence Listing

[0003] An official copy of the sequence listing is attached herewith, which is an XML formatted sequence listing, with the file name 109098-1412651.xml, created on October 25, 2023, with a size of 146,163 bytes, and filed simultaneously with the specification. The sequence listing contained in this XML formatted file is part of this specification and is incorporated herein by reference in its entirety. Background Art

[0004] According to the data of the United Nations, it is expected that the world population will reach 9.3 billion by the year 2050, and in view of the increasingly limited resources, producing enough protein and oil for human and livestock consumption constitutes a major challenge.Soybean is a valuable field crop that humans rely on as food.Soybean oil extracted from seeds is widely used in cooking oil, baked goods, margarine, etc.Soy flour and sour flour are components of many foods and animal feeds.Soy protein also provides a healthier and cheaper alternative to animal protein in meat and dairy products.

[0005] Most flowering plants react to the daily photoperiod cycle and are classified as short-day (SD) or long-day (LD) plants based on the photoperiod conditions required for inducing flowering. The photoperiod conditions experienced by plants change along with the geographical location (for example, latitude or longitude) of cultivating them. Soybean is a short-day (SD) plant and needs the number of days shorter than the critical value to induce flowering. According to the reaction of soybean varieties to the photoperiod, such as based on the number of days until flowering occurs, soybean varieties are divided into multiple maturity groups. For example, for most North American soybean varieties, the typical planting date is May 1, and the vegetative phase of soybean growth can continue 55-65 days, and begins to bloom around mid-July. In view of the seasonal variation (that is, photoperiod) sensitivity of soybean flowering and maturation time to day length, soybean cultivation is subject to the limitation of certain geographical ranges. Therefore, it is necessary to produce soybean plants with a changed flowering time and / or maturity time so that crops can be cultivated in a wide range of geographical locations. Summary of the Invention

[0006] In one aspect, disclosed herein is a plant having a genomic modification, wherein the genomic modification comprises knocking out one or more of the following genes: GmCOL2a; GmCOL2b; GmFT5a; GmFT5b; or GmFT4, wherein the plant has altered flowering time and / or maturity time relative to a control plant not comprising the genomic modification.

[0007] In another aspect, disclosed herein is a plant expressing both a mutant GmCOL2a polypeptide and a mutant GmCOL2b polypeptide, wherein the mutant GmCOL2a polypeptide comprises: (a) an amino acid sequence at least 85% identical to SEQ ID NO: 20, or (b) the amino acid sequence as shown in SEQ ID NO: 20, and wherein the mutant GmCOL2b polypeptide comprises an amino acid sequence at least 85% identical to SEQ ID NO: 26, or (b) the amino acid sequence as shown in SEQ ID NO: 26.

[0008] On the other hand, the present invention discloses a plant expressing both a mutant GmFT5a polypeptide and a mutant GmFT5b polypeptide, wherein the mutant GmFT5a polypeptide comprises: (a) an amino acid sequence that is at least 85% identical to SEQ ID NO:42, or (b) an amino acid sequence as shown in SEQ ID NO:42, and wherein the mutant GmFT5b polypeptide comprises an amino acid sequence that is at least 85% identical to SEQID NO:38, or (b) an amino acid sequence as shown in SEQ ID NO:38.

[0009] In another aspect, disclosed herein is a method for altering the flowering time and / or maturity time of a soybean plant, the method comprising editing one or more of the following genes in the genome of the soybean plant: GmCOL2a, GmCOL2b, GmFT5a, GmFT5b, or GmFT4, thereby forming a modified soybean plant, wherein the modified soybean plant has altered flowering time and / or maturity time relative to a control plant that does not comprise the edits in one or more of these genes.

[0010] In another aspect, disclosed herein is a plant comprising a genomic modification resulting in reduced expression and / or activity of a polypeptide comprising: (a) an amino acid sequence having at least 85%, 90%, 91%, 92%, 93%, 94, 95%, 96%, 97%, 98%, or 99% identity to at least one of SEQ ID NOs: 7, 23, 28, 36, or 40, or (b) an amino acid sequence as shown in at least one of SEQ ID NOs: 17, 23, 28, 36, or 40, wherein the modification is heterologous to the plant, and the reduced expression and / or activity in the plant results in the plant having altered flowering and / or maturity time compared to a control plant not comprising the genomic modification, and wherein the genomic modification is introduced via genome editing.

[0011] In another aspect, disclosed herein is a modified soybean plant, or plant part thereof, comprising one or more non-naturally occurring mutant alleles at one or more genetic loci, wherein the non-naturally occurring mutant alleles are introduced via genome modification using a site-directed nuclease, wherein the one or more genetic loci comprise GmFT4a, GmFT5a, GmFT5b, GmCOL2a, or GmCOL2b, and wherein the one or more mutant alleles result in altered flowering and / or maturity time in the plant relative to a control plant not comprising the mutant alleles. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] This application includes the following figures. These figures are intended to illustrate certain embodiments and / or features of the compositions and methods and to supplement any one or more of the descriptions of the compositions and methods. These figures do not limit the scope of the compositions and methods unless the written description clearly indicates otherwise.

[0013] Figure 1 The genetic structure of GmCOL2a is shown, with target sites for gene editing using, for example, CRISPR / Cas9, according to certain aspects of the present disclosure. Gray bars indicate the positions of exons, black lines indicate the positions of introns, and the end cap region on the right indicates the position of the untranslated region (UTR). The target sequence is named COL2a-SP1. Dashes indicate deletions. Arrows indicate the location of mutations. PAM: protospacer adjacent motif. Figure 1 Contains SEQ ID NOs: 75-78 from top to bottom.

[0014] Figure 2Comparison of flowering time of WT plants (left) and GmCOL2a mutant plants (right) under SD and LD conditions (SD 22 DAE, top panel; LD 34 DAE, bottom panel) according to certain aspects of the present disclosure. Magnified views of the contents of the two boxes in the bottom panel are shown in the upper left and right corners of the panels. DAE, days after emergence. Histogram of flowering time; flowering time values ​​are shown as mean ± 1 standard deviation. **, P < 0.01.

[0015] Figure 3 The gene structure of GmCOL2b and the target sites therein for gene editing using CRISPR / Cas9 according to certain aspects of the present disclosure are shown. Gray bars indicate the positions of exons, black lines indicate the positions of introns, and the end cap region on the right indicates the position of the untranslated region (UTR). The target sequence is named COL2b-SP1. PAM, protospacer adjacent motif. Dashes indicate deletions. Red arrows indicate the location of mutations. Figure 3 Contains SEQ ID NOs: 79-82 from top to bottom.

[0016] Figure 4 Comparison of flowering time of WT plants (left) and Gmcol2b mutant plants (right) under SD and LD conditions (SD 22 DAE, top panel; LD 32 DAE, bottom panel) according to certain aspects of the present disclosure. Magnified views of the contents of the two boxes in the bottom panel are shown in the upper left and upper right corners of the panel. DAE stands for "days after emergence." Flowering time values ​​are shown as mean ± one standard deviation. **, P < 0.01.

[0017] Figure 5 Comparison of flowering time of WT plants (left) and Gmcol2a / Gmcol2b double mutant plants (right) under SD and LD conditions (SD 22 DAE, top panel; LD 22 DAE, bottom panel) according to certain aspects of the present disclosure. A magnified view of the contents of the two boxes in the bottom panel is shown in the upper left and upper right corners of the panel. DAE stands for "days after emergence." Flowering time values ​​are shown as mean ± one standard deviation. **, P < 0.01.

[0018] Figure 6A Comparison of target sites for genome editing in the GmFT4 locus according to certain aspects of the present disclosure. The underlined sequences are target sites. Figure 6A Contains SEQ ID NO: 83 (top), SEQ ID NO: 84 (middle), and SEQ ID NO: 85 (bottom).

[0019] Figure 6BHomozygous targeted mutagenesis of GmFT4 induced by gene editing (e.g., CRISPR / Cas9) according to certain aspects of the present disclosure is shown. Sequences of wild type and exemplary mutation types induced at the target site GmFT4 are presented. Dashes represent deletions, and underscores represent insertions. Arrows indicate the positions of mutations. Figure 6B Contains SEQ ID NOs: 86-88 in order from upper left, upper right, and bottom.

[0020] Figure 7 The structure of the GmFT5b gene and the target sites therein for gene editing using gene editing (e.g., CRISPR / Cas9) according to certain aspects of the present disclosure are shown. GmFT5b has four exons and three introns represented by black stripes and lines, respectively. The gray stripes on the left and right represent non-translational regions. The PAM region (protospacer adjacent motif) is GGG. The rest of the underlined sequence is the target site sequence recognized by gene editing (e.g., CRISPR / Cas9). Figure 7 Contains SEQ ID NO: 89 (top) and SEQ ID NO: 90 (bottom).

[0021] Figure 8 Flowering phenotypes of WT plants (left) and Gmft5b mutant plants (right) under SD conditions (SD 26 days DAE) according to certain aspects of the present disclosure are shown. The upper panel shows a magnified region of the plant in the lower panel. DAE, days after emergence. Values ​​for flowering time, R7 time, plant height, and number of nodes are shown as mean ± one standard deviation. **, P < 0.01. Bars represent 30 cm.

[0022] Figure 9 Flowering phenotypes of WT plants (left) and Gmft5b mutant plants (right) under LD conditions (LD 45 days DAE) according to certain aspects of the present disclosure are shown. The upper panel shows a magnified region of the plant in the lower panel. DAE, days after emergence. Values ​​for flowering time, R7 time, plant height, and number of nodes are shown as mean ± 1 standard deviation. **, P < 0.01. Bars represent 30 cm.

[0023] Figure 10 The structure of the GmFT5a gene and target sites for gene editing according to certain aspects of the present disclosure, such as CRISPR / Cas9 target sites, are shown. The green stripes represent untranslated regions. GmFT5a has four exons and three introns represented by black stripes and lines, respectively. The gray stripes on the left and right represent non-translational regions. The PAM region (protospacer adjacent motif) is GGG. The rest of the underlined sequence is a target site for gene editing, such as CRISPR / Cas9 target site. Figure 10Contains SEQ ID NOs: 91-92 from top to bottom.

[0024] Figure 11 Flowering phenotypes of WT plants (left) and Gmft5a mutant plants (right) under SD conditions (SD 26 days DAE) according to certain aspects of the present disclosure are shown. The upper panel shows a magnified region of the plant in the lower panel. DAE, days after emergence. Values ​​for flowering time, R7 time, plant height, and node number are shown as mean ± one standard deviation. **, P < 0.01. Bars represent 30 cm.

[0025] Figure 12 Flowering phenotypes of WT plants (left) and Gmft5a mutant plants (right) under LD conditions (LD 45 days DAE) according to certain aspects of the present disclosure are shown. The upper panel shows a magnified region of the plant in the lower panel. DAE, days after emergence. Values ​​for flowering time, R7 time, plant height, and number of nodes are shown as mean ± 1 standard deviation. **, P < 0.01. Bars, bars represent 30 cm.

[0026] Figure 13 Flowering phenotypes of WT plants (left) and Gmft5a Gmft5b double mutant plants under SD conditions (SD 26 days DAE) according to certain aspects of the present disclosure are shown. The upper panel shows a magnified region of the plant in the lower panel. DAE, days after emergence. Values ​​for flowering time, R7 time, plant height, and number of nodes are shown as mean ± one standard deviation. **, P < 0.01. Bars represent 30 cm.

[0027] Figure 14 Comparison of flowering phenotypes of WT plants (left) and Gmft5a Gmft5b double mutant plants under LD conditions (LD 75 days DAE) according to certain aspects of the present disclosure. The upper panel shows a magnified region of the plant in the lower panel. DAE, days after emergence. Values ​​for flowering time, plant height, and R7 time are shown as mean ± 1 standard deviation. **, P < 0.01. Bars represent 30 cm.

[0028] Figure 15 Shown are phenotypes of soybean plants according to certain aspects of the present disclosure at various vegetative and reproductive stages. DETAILED DESCRIPTION I. Terminology

[0029] Unless otherwise defined below, all technical and scientific terms used herein are intended to have the same meaning as commonly understood by those of ordinary skill in the art. Reference to the techniques employed herein is intended to refer to techniques commonly understood in the art, including variations of those techniques and / or equivalent technical alternatives that are clear to those of ordinary skill in the art. Gene names cited in this disclosure are shown in italics, while normal text is used for the corresponding proteins.

[0030] Unless otherwise indicated, identity and similarity are calculated using the Needleman-Wunsch global alignment and scoring algorithm (Needleman and Wunsch (1970) J. Mol. Biol. 48(3):443-453) (as implemented by the "needle" program distributed as part of the EMBOSS software package (Rice, P., Longden, I., and Bleasby, A., EMBOSS: The European Molecular Biology Open Software Suite, 2000, Trends in Genetics 16, (6) pp. 276-277, version 6.3.1, available from EMBnet at embnet.org / resource / emboss and emboss.sourceforge.net and other sources)), using default gap penalties and scoring matrices (EBLOSUM62 for proteins and EDNAFULL for DNA). Equivalent programs may also be used. By "equivalent program" is meant any sequence comparison program which, for any two sequences in question, generates an alignment having identical nucleotide residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by needle of EMBOSS version 6.3.1.

[0031] Other mathematical algorithms are known in the art and can be used to compare two sequences. See, for example, the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264, which was modified in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873-5877. Such an algorithm is incorporated into the BLAST program of Altschul et al. (1990) J. Mol. Biol. 215:403. BLAST nucleotide searches can be performed using the BLASTN program (searching a nucleotide query against a nucleotide sequence) to obtain nucleotide sequences homologous to the nucleic acid molecules of the invention, or using the BLASTX program (searching a translated nucleotide query against a protein sequence) to obtain protein sequences homologous to the nucleic acid molecules of the invention. BLAST protein searches can be performed using the BLASTP program (searching protein queries against protein sequences) to obtain amino acid sequences homologous to protein molecules of the present invention, or using the TBLASTN program (searching protein queries against translated nucleotide sequences) to obtain nucleotide sequences homologous to protein molecules of the present invention. To obtain gapped alignments for comparison purposes, Gapped BLAST (in BLAST 2.0) as described in Altschul et al. (1997) Nucleic Acids Res. 25:3389 can be used. Alternatively, PSI-Blast can be used for an iterative search, which detects distant relationships between molecules. See Altschul et al. (1997) supra. When using BLAST, Gapped BLAST, and PSI-Blast programs, the default parameters of the corresponding programs (e.g., BLASTX and BLASTN) can be used. Alignments can also be performed manually by inspection.

[0032] Two sequences are "optimally aligned" when they are aligned for similarity scoring using a defined amino acid substitution matrix (e.g., BLOSUM62), a gap existence penalty, and a gap extension penalty to achieve the highest score possible for the pair of sequences. Amino acid substitution matrices and their use in quantifying the similarity between two sequences are well known in the art and are described, for example, in Dayhoff et al. (1978) ("A model of evolutionary change in proteins." "Atlas of Protein Sequence and Structure," Vol. 5, Supplement 3 (M.O. Dayhoff, ed.), pp. 345-352. Natl. Biomed. Res. Found., Washington, D.C., and Hemkoff et al. (1992) Proc. Natl. Acad. Sci. USA 89: 10915-10919). The BLOSUM62 matrix is ​​usually used as the default score substitution matrix in the sequence alignment scheme.For introducing a single amino acid room in one of the aligned sequences, a gap existence penalty is applied, and for each other empty amino acid position in the room opened for insertion, a gap extension penalty is applied. The comparison is limited by the amino acid position of each sequence at the beginning and end of the comparison, and optionally limited by inserting a room or multiple rooms in one or two sequences, so as to reach the highest possible score. Although the best comparison and scoring can be completed manually, the comparison algorithm implemented by using a computer is assisted in the process, and the comparison algorithm is for example the gapped BLAST 2.0 that is described in the people such as Altschul (1997) (Nucleic Acids Res. [nucleic acids research] 25:3389-3402) and the public can obtain at the National Center for Biotechnology Information website (www.ncbi.nlm.nih.gov). Optimal alignments, including multiple alignments, can be prepared using, for example, PSI-BLAST, available through www.ncbi.nlm.nih.gov and described by Altschul et al. (1997) (Nucleic Acids Res. 25:3389-3402).

[0033] As indicated, the mutant polypeptides disclosed herein are non-functional or have reduced function relative to the corresponding wild-type polypeptide. Reduced function can include any statistically significant reduction, such as a reduction of about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 85%, 90%, 95% relative to a control. Methods for determining the function of a polypeptide are known and are further described below.

[0034] "Endogenous" or "native" gene or protein sequence refers to a non-recombinant sequence of an organism, as it occurs in the organism prior to human-induced mutation of the sequence. A "mutated" or "mutant" sequence refers to a sequence that has been altered by humans. Examples of human-induced mutations include exposing an organism to high doses of chemical, radiological, or insertional mutagens for the purpose of selecting for mutants, as well as recombinantly altering the sequence. Examples of human-induced recombinant alterations can include, for example, fusions, insertions, deletions, and / or changes in sequence.

[0035] The term "promoter" refers to a region or sequence located upstream and / or downstream of the start of transcription and involved in the recognition and binding of RNA polymerase and other proteins to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells. A plant promoter can be, but is not necessarily, a nucleic acid sequence originally isolated from a plant.

[0036] The term "operably linked" refers to a functional linkage between a nucleic acid expression control sequence (such as a promoter or an array of transcription factor binding sites) and a second nucleic acid sequence, wherein the expression control sequence directs transcription of the nucleic acid corresponding to the second sequence.

[0037] A polynucleotide or polypeptide sequence is "heterologous" to an organism or a second sequence if it originates from a foreign species or if it originates from the same species and has been modified from its original form. For example, a promoter operably linked to a heterologous coding sequence refers to a coding sequence from a species different from the species from which the promoter is derived, or, if from the same species, a coding sequence not naturally associated with the promoter (e.g., a genetically engineered coding sequence or an allele from a different ecotype or variety).

[0038] "Recombination" refers to a copy or complementary sequence of a polynucleotide or polynucleotide manipulated by a person. For example, a recombinant expression cassette comprising a promoter operably connected to a second polynucleotide can include a promoter heterologous to the second polynucleotide as a result of human manipulation (for example, by the method described below: Sambrook et al., Molecular Cloning-A Laboratory Manual [Molecular Cloning-Laboratory Manual], Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (Cold Spring Harbor Laboratory, Cold Spring Harbor, New York), (1989) or Current Protocols in Molecular Biology [Contemporary Molecular Biology Program], Volumes 1-3, John Wiley & Sons, Inc. (1994-1998)). In another example, the recombinant expression cassette can include the polynucleotides combined in such a way that these polynucleotides are unlikely to occur in nature. For example, a restriction site or a plasmid vector sequence manipulated by a person can be located on the flank of the promoter or separate the promoter from the second polynucleotide. Polynucleotides can be manipulated in many ways and are not limited to the above examples.

[0039] "Transgenic" is a term understood in the art and refers to a heterologous nucleic acid introduced into a cell through molecular manipulation of the cell's genome (e.g., through molecular transformation). Thus, a "transgenic plant" is a plant that contains a transgene, i.e., a plant that has been genetically modified. A transgenic plant can be both the original plant into which the transgene was introduced and its progeny whose genome contains the transgene.

[0040] "Expression cassette," used interchangeably with "expression vector," refers to a recombinantly or synthetically produced nucleic acid construct having a series of defined nucleic acid elements that allow transcription of a specific nucleic acid in a host cell. An expression cassette can be part of a plasmid, a virus, or a nucleic acid fragment. Typically, an expression vector contains the nucleic acid to be transcribed, operably linked to a promoter.

[0041] The term "plant" includes whole plants, bud vegetative organs / structures (e.g., leaves, stems, and tubers), roots, flowers and floral organs / structures (e.g., bracts, sepals, petals, stamens, carpels, anthers, and ovules), seeds (including embryos, endosperms, and seed coats), and fruits (mature ovaries), plant tissues (e.g., vascular tissues, ground tissues, etc.), and cells (e.g., guard cells, egg cells, trichomes, etc.), and their progeny. The plant species that can be used in the methods of the present invention are generally as broad as the higher and lower plant species suitable for transformation techniques, including angiosperms (monocots and dicots), gymnosperms, ferns, and multicellular algae. It includes plants of various ploidy levels, including aneuploids, polyploids, diploids, haploids, and hemizygotes.

[0042] A "subject plant or plant cell" is a plant or plant cell that has been genetically modified for a polynucleotide of interest or is a plant or plant cell that is inherited from a plant or cell so modified and contains the modification. A "control" or "control plant" or "control plant cell" is a plant or plant cell that provides a reference for measuring phenotypic changes in the subject plant or plant cell. The control plant or plant cell can be, for example: (a) a wild-type plant or plant cell, i.e., having the same genotype as the starting material used to cause the genetic modification of the subject plant or cell; (b) a plant or plant cell that has the same genotype as the wild-type plant or plant cell but has been transformed with a null construct (i.e., a construct that has no known effect on the trait of interest, such as a construct containing a marker gene); (c) a plant or plant cell that is a non-transformed isolate from a progeny of the subject plant or plant cell; (d) a plant or plant cell that is genetically identical to the subject plant or plant cell but has not / has not been exposed to conditions or stimuli that would induce expression of the gene of interest; or (e) the subject plant or plant cell itself under conditions where the gene of interest is not expressed.

[0043] An "elite" plant is any plant from an elite line, and thus an elite plant is a representative plant from an elite variety. In some embodiments, a soybean plant comprising a polynucleotide encoding any one of the polypeptides disclosed herein is an elite soybean plant. Non-limiting examples of superior soybean varieties commercially available to farmers or soybean breeders include: AG00802, A0868, AG0902, A1923, AG2403, A2824, A3704, A4324, A5404, AG5903, AG6202, AG0934; AG1435; AG2031; AG2035; AG2433; AG2733; AG2933; AG3334; AG3832; AG4135; AG4632; AG4934; AG5831; AG6534; and AG7231 (Asgrow Seeds, Des Moines, Iowa, USA); BPR0144RR, BPR 4077NRR, and BPR 4390NRR (BioPlant Research, Camp Point, Ill., USA); DKB 17-51 and DKB37-51 (DeKalb Genetics, DeKalb, Ill., USA); DP4546RR and DP 7870RR (Delta & Pine Land Company, Lubbock, Tex., USA); JG 03R501, JG 32R606C ADD and JG 55R503C (JGL Inc., Greencastle, Ind., USA)., USA); NKS13-K2 (NK Division of Syngenta Seeds, Golden Valley, Minnesota, USA); 90M01, 91M30, 92M33, 93M11, 94M30, 95M30, 97B52, P008T22R2; P16T17R2; P22T69R; P25T51R; P34T07R2; P35T58R; P39T67R; P47T36R; P46T21R; and P56T03R2 (Pioneer Hi-Bred International, Inc. International, Johnston, Iowa, USA); SG4771NRR and SG5161NRR / STS (Soygenetics, LLC, Lafayette, Indiana, USA); S00-K5, S11-L2, S28-Y2, S43-B1, S53-A1, S76-L9, S78-G6, S0009-M2; S007-Y4 ; S04-D3; S14-A6; S20-T6; S21-M7; S26-P3; S28-N6; S30-V6; S35-C3; S36-Y6; S39-C4; S47-K5; S48-D9; S52-Y2; S58-Z4; S67-R6; S73-S8; and S78-G6 (Syngenta Seeds, Henderson, Ky., USA); Richer (Northstar Seeds, LLC). Seed Ltd., Alberta, Canada); 14RD62 (Stine Seed Co., Iowa, USA); or Armor4744 (Armor Seed, LLC, Alaska, USA).

[0044] As used herein, the term "allele" refers to a variant or alternative nucleotide sequence at a gene or a specific genetic locus. Such an allele can be considered to be (i) wild type or (ii) mutant if there is one or more mutations or editing in the nucleotide sequence of the mutant allele relative to the wild-type allele. In diploids, the single allele at each locus is inherited by the offspring individual from each parent, respectively. Although one of ordinary skill in the art understands that the alleles in any particular individual do not necessarily represent all alleles present in the species, the two alleles present in a given locus in a diploid organism occupy corresponding positions on a pair of homologous chromosomes.

[0045] In some embodiments, the mutant allele of gene can have the gene activity or expression level that reduces or eliminates with respect to wild-type allelotrope.For diploid organism (such as corn and soybean), the first allelotrope can appear on a chromosome, and the second allelotrope can appear at the same locus place on the second homologous chromosome.If an allelotrope at the locus place on a chromosome of plant is mutant allelotrope, and another corresponding allelotrope on the homologous chromosome of plant is wild-type, then plant is described as heterozygous to mutant allelotrope.But if two allelotropes at the locus place are mutant allelotrope, then plant is described as homozygous to mutant allelotrope.To the mutant allelotrope at the locus place, be that the plant of homozygous can comprise identical mutant allelotrope or different mutant allelotrope (if different allele or double allele).

[0046] "Allelic variation" refers to the variation phenomenon of allelic sequence forms on a given genetic locus. Allelic variation results in the production of two or more allelic variants. Variant can be naturally occurring and reflects the genetic differences between individuals of the same species. Such natural variation may occur due to natural breeding patterns. Alternatively, variant can be non-naturally occurring and artificially produced (e.g., by breeders or scientists), such as using mutagenesis and / or gene editing techniques. In an embodiment of the present invention, the allelic variant of a soybean gene (e.g., any one of GmCOL2a, GmCOL2b, GmFT4, GmFT5a, and / or GmFT5b) is produced by a gene editing method that results in the introduction of a mutation. In another or alternative embodiment of the present invention, the allelic variant of soybean GmCOL2a, GmCOL2b, GmFT4, GmFT5a, and / or GmFT5b genes can be produced by chemical mutagenesis, transposon insertion or excision, or any other known mutagenesis techniques.

[0047] In an exemplary embodiment, the sudden change introduced into one or more GmCOL2a, GmCOL2b, GmFT4, GmFT5a and / or GmFT5b loci is an allele replacement, one or more base pair insertions or one or more base pair deletions. Base pair insertions or base pair deletions can include 3n base mutations, wherein a multiple of 3 base pairs is deleted or inserted (e.g., an insertion or deletion of 3bp, 6bp, 9bp, 12bp, 15bp, 18bp, etc.) so as not to affect the reading frame of the gene. Alternatively, a multiple of 3 base pairs is deleted or inserted (e.g., an insertion or deletion of 2bp, 4bp, 5bp, 7bp, 11bp, etc.) so as not to affect the reading frame of the gene.

[0048] In particular embodiments, the mutation is a truncating mutation, wherein the mutation can result in the introduction of a stop codon into a gene at an earlier position than expected. Transcription of the resulting mutant allele terminates at an earlier position than the expected stop codon, thereby producing a truncated protein that is shorter than the corresponding wild-type protein.

[0049] As used herein, "allelic combination" refers to a specific combination of alleles present at more than one unique position or locus. Exemplary embodiments of the present invention include multiple allele combinations at the GmCOL2a and GmCOL2b loci or at the GmFT5a and GmFT5b loci.

[0050] In embodiments of the present invention, the allelic combination of a plant at a combined locus (e.g., at the loci of GmCOL2a and GmCOL2b) can be determined via molecular marker-based assays, such as a first assay of the plant's DNA indicating the type of mutation introduced at the GmCOL2a locus and a second assay of the plant's DNA indicating the type of mutation introduced at the GmCOL2b locus. In embodiments, the allelic combination indicates a change in the plant's flowering time relative to a control plant that does not contain the allelic combination (e.g., a control plant containing one or more wild-type alleles or a ninth allelic combination containing wild-type alleles at both loci).

[0051] A "dominant maturity allele" is an allele that affects the maturity of a plant when present in a single copy (heterozygous) or in two copies (homozygous). A "recessive maturity allele" is an allele that affects the maturity of a plant only when present in two copies (homozygous), but does not affect the maturity of a plant when present in a single copy (heterozygous).

[0052] As used herein, a modified plant that flowers or matures "slightly earlier" (or has "slightly accelerated" flowering or maturation, or has slightly reduced flowering time and / or maturity) compared to a control plant has a flowering time and / or maturity time that is between 1 and 10 days shorter (e.g., at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, or 10 days shorter than a control plant). In embodiments, a modified plant has a slightly earlier flowering time compared to a control plant if the flowering time of the modified plant is shorter by 1-2 days, 1-3 days, 1-4 days, 1-5 days, 1-6 days, 1-7 days, 1-8 days, 1-9 days, or 1-10 days compared to a control plant.

[0053] As used herein, a modified plant that flowers or matures "slightly later" than a control plant (or has "slightly delayed" flowering and / or maturity, or has slightly increased flowering time and / or maturity) has a flowering time and / or maturity time that is between 1 and 10 days longer than the control plant (e.g., at least 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, or 10 days shorter than the control plant). In embodiments, a modified plant has a slightly later flowering time than a control plant if the flowering time of the modified plant is shorter by 1-2 days, 1-3 days, 1-4 days, 1-5 days, 1-6 days, 1-7 days, 1-8 days, 1-9 days, or 1-10 days compared to the control plant.

[0054] As used herein, modified plants that flower and / or mature "significantly earlier" (or have "significantly accelerated" flowering or maturation, or have a significantly reduced flowering time and / or maturity time) compared to control plants have a flowering time and / or maturity time that is at least 10 days shorter than the control plants, such as between 10-100 days shorter than the control plants (e.g., at least 10 days, 10-20 days, 10-30 days, 10-40 days, 10-50 days, 10-60 days, 10-70 days, 10-80 days, 10-90 days, or 10-100 days or any range therebetween, such as 20-30 days, 20-40 days, 30-40 days, 40-50 days, 50-60 days, 70-80 days, 80-90 days, 90-100 days, etc., shorter than the control plants).

[0055] In contrast, modified plants that flower or mature "significantly later" (or have "significantly delayed" flowering and / or maturity, or have a significantly increased flowering time and / or maturity time) compared to control plants have a flowering time and / or maturity time that is at least 10 days longer than the control plants, such as between 10-100 days longer than the control plants (e.g., at least 10 days, 10-20 days, 10-30 days, 10-40 days, 10-50 days, 10-60 days, 10-70 days, 10-80 days, 10-90 days or 10-100 days longer than the control plants, or any range therebetween, such as 20-30 days, 20-40 days, 30-40 days, 40-50 days, 50-60 days, 70-80 days, 80-90 days, 90-100 days, etc., longer than the control plants).

[0056] As used herein, the term "photoperiod response" or "photoperiodism" refers to the physiological response of a plant to the relative lengths of light and dark cycles. Photoperiod-responsive plants can be "short-day," "long-day," or "intermediate-day" plants. Photoperiodism affects flowering by inducing shoots to produce floral buds rather than leaves and lateral buds. For example, soybeans are short-day (SD) plants. In an embodiment of the present invention, soybean flowering time was evaluated. Short-day plants bloom when the length of the night exceeds their critical photoperiod and cannot bloom under short nights. They require a continuous dark period before flower development can begin. Natural nighttime light (such as moonlight or lightning) does not have sufficient brightness or duration to interrupt flowering. Typically, short-day (i.e., long-night) plants bloom when the days become shorter (e.g., late summer and autumn in the Northern Hemisphere). The length of the dark period required to induce flowering varies between species and varieties of species. Long-day plants bloom when the length of the night is below their critical photoperiod. These plants typically flower as the days become longer (eg, late spring and early summer in the Northern Hemisphere).

[0057] As used herein, "flowering time" or "flowering days" is an estimate of the duration (e.g., in hours, days, weeks, etc.) that elapses between the onset of first flowering and seed emergence. In embodiments of the present invention, the flowering time of soybean plants is modified or altered relative to control plants by introducing novel non-naturally occurring alleles in genes involved in soybean maturation (particularly the GmCOL2a, GmCOL2b, GmFT4, GmFT5a, and / or GmFT5b genes). In particular embodiments, flowering time is defined as the number of days it takes for soybean plants to transition from the VE stage (e.g., seed emergence, where cotyledons have broken through the soil surface for at least 50% of the seeds) to the R1 stage (e.g., the onset of flowering, where at least 50% of the plants have at least one flower at any node).

[0058] As used herein, time to maturity or time after flowering is defined as the number of days it takes for a soybean plant to transition from the R1 stage (e.g., the start of flowering, where one open flower is present at any node on the main stem) to the R7 stage (where any pod has reached its mature pod color) or from the R1 stage to the R8 stage (where 95% of the pods have reached their mature pod color). Descriptions of the different developmental stages of soybean plants and mature pod colors are provided in Figure 15 Provided as a reference. II. Introduction

[0059] May wish to change the flowering time and / or the ripening time of photoperiod responsiveness and agronomically important plant (such as soybean), to realize wider cultivation geographical scope.In some instances, may wish to accelerate or advance or shorten the flowering time and / or the ripening time of soybean, make it possible to produce and gather in the crops seed earlier, and / or in higher latitudes (comprising the longer zone of daylight), produce and gather in the crops seed.In other instances, may wish to postpone or prolong the flowering time and / or the ripening time in soybean, make it possible to produce and gather in the crops seed in lower altitudes (comprising the shorter zone of daylight).Present disclosure provides useful compositions and methods for flowering and / or the ripening time that can be used to change soybean.

[0060] In some embodiments, provided herein are maturity genes, such as GmCOL2a, GmCOL2b, GmFT4, GmFT5a, and / or GmFT5b genes, that can confer phenotypic traits, including one or more or a combination of flowering time, time after flowering, relative maturity stage, maturity time, maturity stage group, and the number of days from flowering to the onset of maturity in soybean plants. In particular embodiments, the phenotypic trait measured is flowering time, and includes the time to flowering at VE and R1 stages (for different stages, see SEQ ID NO: 10) of the modified soybean plant relative to the control plant. Figure 15 In another embodiment, the phenotypic trait measured is time to maturity and includes the time between R1 and R7 or R1 and R8 stages (for different stages, see Figure 15 ) The number of days can vary based on the plant's particular allele combination relative to a control plant comprising wild-type alleles at both loci.

[0061] In some embodiments, the methods and compositions disclosed herein comprise genomic modification of one or more or a combination of the following genes: GmCOL2a, GmCOL2b, GmFT4, GmFT5a, and / or GmFT5b. The genomic sequence, cDNA sequence, and protein sequence corresponding to each of the above genes are listed in Table 1. Table 1. Sequences Genome cDNA protein GmCOL2a SEQ ID NO:15 SEQ ID NO:16 SEQ ID NO: 17 GmCOL2b SEQ ID NO:21 SEQ ID NO:22 SEQ ID NO:23 GmFT4 SEQ ID NO:27 SEQ ID NO:56 SEQ ID NO:28 GmFT5a SEQ ID NO:52 SEQ ID NO:39 SEQ ID NO:40 GmFT5b SEQ ID NO:54 SEQ ID NO:35 SEQ ID NO:36

[0062] Provided herein are methods for modifying the genome of a plant to alter flowering and / or maturation time. In certain embodiments, the plant is knocked out of one or more of the GmCOL2a, GmCOL2b, GmFT4, GmFT5a, and / or GmFT5b genes. In certain embodiments, the plant is edited to express one or more mutant polypeptides expressed by these genes, which have a reduced function or reduced expression compared to their corresponding wild-type polypeptides. In these embodiments, the plant does not express the corresponding one or more wild-type polypeptides.

[0063] Also provided herein is a method for changing flowering and / or ripening time by reducing or inhibiting the expression or activity of one or more of GmCOL2a, GmCOL2b, GmFT4, GmFT5a, and / or GmFT5b genes. Many methods can be used to inhibit or silence the gene expression of the above reference genes in soybean plants. In certain embodiments, the reduction or inhibition of gene expression is achieved by introducing an expression cassette encoding RNAi (e.g., siRNA, miRNA), which comprises a polynucleotide sequence at least substantially identical to the target gene that is connected to a complementary polynucleotide sequence. The transcribed RNAi molecule hybridizes with the target gene and silences its expression. Other gene silencing methods can also be used, such as microRNA (miRNA), antisense, co-suppression, viral inhibition, hairpin inhibition, stem-loop inhibition, etc.

[0064] In some embodiments, the mutant polypeptide expressed by the plant comprising the genomic modification shares less than 20%, less than 15%, or less than 10% identity with the corresponding wild-type polypeptide. For example, the mutant GmCOL2a polypeptide shares less than 20% identity with the corresponding wild-type GmCOL2a polypeptide (SEQ ID NO: 17); the mutant GmCOL2b polypeptide shares less than 20% identity with the corresponding wild-type GmCOL2b polypeptide (SEQ ID NO: 23); the mutant GmFT4 polypeptide shares less than 20% identity with the corresponding wild-type GmFT4 polypeptide (SEQ ID NO: 28); the mutant GmFT5a polypeptide shares less than 20% identity with the corresponding wild-type GmFT5a polypeptide (SEQ ID NO: 40); and the mutant GmFT5b polypeptide shares less than 20% identity with the corresponding wild-type GmFT5b polypeptide (SEQ ID NO: 36).

[0065] In some embodiments, the mutant GmCOL2a polypeptide shares at least 70%, at least 80%, at least 90%, or at least 95% amino acid sequence identity with the mutant GmCOL2a polypeptide (SEQ ID NO: 20). In some embodiments, the mutant GmCOL2b polypeptide has at least 70%, at least 80%, at least 90%, or at least 95% amino acid sequence identity with the mutant GmCOL2b polypeptide (SEQ ID NO: 26). In some embodiments, the mutant GmFT4 polypeptide has at least 70%, at least 80%, at least 90%, or at least 95% amino acid sequence identity with the mutant GmFT4 polypeptide (SEQ ID NO: 30 or 32). In some embodiments, the mutant GmFT5a polypeptide has at least 70%, at least 80%, at least 90%, or at least 95% amino acid sequence identity with the mutant GmFT5a polypeptide (SEQ ID NO: 42). In some embodiments, the mutant GmFT5b polypeptide has at least 70%, at least 80%, at least 90%, or at least 95% amino acid sequence identity to the mutant GmFT5b polypeptide (SEQ ID NO: 38).

[0066] The genome modification methods as discussed herein can also be used to generate combinations of mutant alleles in individual plants. For example, the genome of a soybean plant can be modified to include any one, two, or three of (i) a mutant GmCOL2a allele, (ii) a mutant GmCOL2b allele, (iii) a mutant GmFT4 allele, (iv) a mutant GmFT5a allele, and (v) a mutant GmFT5b allele. In some embodiments, the modified plant expresses one, two, or three of the mutant proteins: (i) a mutant GmCOL2a allele, (ii) a mutant GmCOL2b allele, (iii) a mutant GmFT4 allele, (iv) a mutant GmFT5a allele, and (v) a mutant GmFT5b allele.

[0067] In some embodiments, the soybean plant is a double mutant, comprising, for example, a soybean plant whose genome has been modified to include both a mutant GmCOL2a allele and a mutant GmCOL2b allele. In some exemplary embodiments, the mutant GmCOL2a allele comprises a 398-bp deletion and encodes a mutant polypeptide having the amino acid sequence set forth in SEQ ID NO:20, and the mutant GmCOL2b allele comprises a 1-bp deletion and encodes a mutant polypeptide having the amino acid sequence set forth in SEQ ID NO:26. In some embodiments, the double mutant soybean plant has a genome modified to include both a mutant Gmft5a allele and a mutant Gmft5b allele. In some exemplary embodiments, the mutant Gmft5a allele comprises a 1-bp insertion and encodes a mutant polypeptide having the amino acid sequence set forth in SEQ ID NO:42, and the mutant Gmft5b allele comprises an 8-bp deletion and encodes a mutant polypeptide having the amino acid sequence set forth in SEQ ID NO:38.

[0068] In some embodiments, the acceleration of flowering and / or maturation time is carried out by reducing the expression of one or more of GmCOL2a, GmCOL2b, and GmFT4 (e.g., knocking out or knocking down). In some embodiments, the delay of flowering and / or maturation time is carried out by reducing the expression of one or more of GmFT5a and / or GmFT5b (e.g., knocking out or knocking down).

[0069] Also provided are various methods for editing genes in plants. In some embodiments, the wild-type alleles of one or more of the GmCOL2a, GmCOL2b, GmFT4, GmFT5a, and / or GmFT5b genes are deleted from the genome. In some embodiments, the wild-type gene has been modified to produce a mutant allele encoding a non-functional polypeptide or a polypeptide with reduced function. Exemplary mutant alleles of these genes are also provided at SEQ ID NO: 18, 24, 29, 31, 55, and 53. If the activity of the polypeptide is reduced to less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, or less than 10% of the activity of the wild-type protein when compared to the corresponding wild-type polypeptide, the polypeptide is considered to have reduced function.

[0070] In some embodiments, the wild-type GmCOL2a, GmCOL2b, GmFT4, GmFT5a, and / or GmFT5b genes have been modified to produce mutant alleles encoding non-functional polypeptides or polypeptides with reduced expression. Exemplary mutant alleles of these genes are also provided in SEQ ID NOs: 18, 24, 29, 31, 55, and 53. A polypeptide is considered to have reduced expression if, when compared to the corresponding wild-type polypeptide, expression of the polypeptide is reduced to less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, or less than 10% of the expression of the wild-type protein when assayed under the same assay conditions. A gene is considered to have reduced expression if transcript levels or transcript protein levels are reduced to less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, or less than 10% compared to the corresponding wild-type gene or allele.

[0071] In some embodiments, the plant is genomically modified to have a genomic DNA sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to at least one of SEQ ID NOs: 15, 21, 27, 52, and / or 54. In some embodiments, the plant is genomically modified to have a genomic DNA sequence that is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to at least one of SEQ ID NOs: 16, 22, 56, 35, and / or 39. In some embodiments, the genomic DNA sequence comprises the nucleic acid sequence set forth in any one of SEQ ID NOs: 1, 6, 43, 49, and / or 46.

[0072] In some embodiments, the genomic modifications result in a plant with reduced expression and / or activity of a polypeptide comprising: (a) an amino acid sequence at least 85%, 90%, 91%, 92%, 93%, 94, 95%, 96%, 97%, 98%, or 99% identical to at least one of SEQ ID NOs: 17, 23, 28, 36, and / or 40, or (b) an amino acid sequence set forth in at least one of SEQ ID NOs: 17, 23, 28, 36, and / or 40. In some embodiments, expression is reduced by at least 80%, at least 90%, or at least 95% compared to a control plant.

[0073] In some embodiments, the mutant polypeptide expressed by the plant comprising the genomic modification lacks one or more conserved domains of the wild-type polypeptide or contains an inactivating mutation therein (i.e., a mutation that substantially or completely eliminates the function of the domain). The conserved domains of GmCOL2a, GmCOL2b, GmFT4, GmFT5a, and / or GmFT5b polypeptides are known and are also described in Part III of the present disclosure. In some embodiments, gene editing methods targeting sequences in the conserved domains of one or more of the GmCOL2a (SEQ ID NO: 17), GmCOL2b (SEQ ID NO: 23), GmFT4 (SEQ ID NO: 28), GmFT5a (SEQ ID NO: 40), and / or GmFT5b (SEQ ID NO: 36) polypeptides can be used to produce these mutant polypeptides. See, Part V, Subsection I. One of ordinary skill in the art will be able to modulate plant flowering and development by gene editing one or more target sequences within the conserved domains of one or more of the GmCOL2a (SEQ ID NO: 17), GmCOL2b (SEQ ID NO: 23), GmFT4 (SEQ ID NO: 28), GmFT5a (SEQ ID NO: 40), and / or GmFT5b (SEQ ID NO: 36) polypeptides. Phases and long-day (LD) and short-day (SD) conditions

[0074] There are two distinct growth stages in soybean development: the vegetative (V) stage, which includes emergence to flowering, and the reproductive (R) stage, which includes flowering to maturity. These stages are identified by classifying leaf, flower, pod, and / or seed development. A brief description of the various plant stages shown is provided in Table 2 and is shown in Table 2. Figure 15 This information is also available at extension.umn.edu / growing-soybean / soybean-growth-stages#reproductive-phase-%28table-2%29-539861, the contents of which are expressly incorporated herein by reference. Table 2. Plant stages

[0075] In many plant species, the time of flowering is related to the photoperiod (also known as the length of daylight). Some plants prefer long-day (LD) conditions, that is, more than 12 hours of daylight or less than 12 hours of uninterrupted darkness per day, to flower. These plants are referred to as long-day (LD) plants. Exemplary LD plants include but are not limited to carrots, lettuce, potatoes, spinach, and turnips. Some plants prefer short-day (SD) conditions, that is, less than 12 hours of daylight or more than 12 hours of uninterrupted darkness per day, to flower. These plants are referred to as short-day (SD) plants. Exemplary SD plants include but are not limited to soybeans. It is worth noting that although soybeans are referred to as short-day plant species, soybean plants can still flower under long-day (LD) conditions, although much later than under SD conditions (Cai et al., Plant Biotechnology J. [Plant Biotechnology Journal] January 2020; 18 (1): 298-309). Other plants do not begin to flower based on the length of daylight; these plants are referred to as day-neutral (DN) plants. Exemplary DN plants include, but are not limited to, cabbage, corn, cucumber, and kale. In an exemplary embodiment, the plant is grown under LD conditions (16 h light / 8 h dark in a 24-hour period). In an exemplary embodiment, the plant is grown under SD conditions (12 h light / 12 h dark in a 24-hour period). In the context of this disclosure, it is understood that reference to "day" includes any 24-hour period. Changing flowering times

[0076] The methods and compositions discussed herein can be used to alter flowering time of soybean. For the purposes of this application, flowering time of a soybean plant reflects the time at which the soybean plant begins to flower. Flowering time is typically determined by counting the number of days between the VE stage and the R1 stage ( Figure 15 ). The number of days from the VE stage to a particular stage in plant development is referred to as the day after emergence (DAE). The flowering time of wild-type soybean is typically 38 to 42 DAE under LD conditions and 20 to 23 DAE under SD conditions. As used herein, the term "altered flowering" means that the flowering time (DAE) has increased or decreased compared to a control plant. If the flowering time of a soybean plant is longer than that of a control plant, it flowers later than the control plant. Conversely, if the flowering time of a soybean plant is shorter than that of a control plant, it flowers earlier than the control plant. Ripe time for change

[0077] The maturity of soybean plants is indicated by the formation of pods. The maturity time reflects the speed at which the plant forms mature pods on the main stem. Unless otherwise stated for the purposes of this application, the maturity time of soybean plants is measured by the number of days between the VE stage and the R7 stage (the time when the first pod on the main stem reaches mature color). The maturity time of wild-type soybean plants is typically 136 to 142 DAE under LD conditions and 70 to 73 DAE under SD conditions. If the maturity time of soybean plants is longer than that of control plants, then their maturity is later than that of control plants. On the contrary, if the maturity time of soybean plants is shorter than that of control plants, then their maturity time is earlier than that of control plants. As used herein, the term "altered maturity time" refers to that the maturity time (DAE) has increased or decreased compared to control plants. III. Polynucleotides and Polypeptides Conferring Accelerated Flowering A. GmCOL2a and GmCOL2b

[0078] GmCOL2a / GmCOL2b are soybean orthologs belonging to the same family as the Arabidopsis CONSTANS (CO) protein. CO plays a central role in photoperiodic flowering control in Arabidopsis. GmCOL2a and GmCOL2b can complement the late flowering effect of the CO mutant in Arabidopsis. (Wu, F. et al., PLoS One, 9(1):e85754, January 21, 2014, doi.org / 10.1371 / journal.pone.0085754). GmCOL2a and GmCOL2b show circadian expression rhythms under SD conditions, but their rhythmic expression patterns are less clear under LD conditions. For example, under SD conditions, expression of GmCOL2a and GmCOL2b peaks after dusk (T4: 18:30) and declines during the night; however, under LD conditions, expression appears to peak at two time points: T4 (18:30) and T6 (2:30). It has also been reported that cold temperatures may upregulate GmCOL2b expression, particularly during the fourth, three-leaf leaf stage in soybeans. (Zhang, J. et al., Front. Plant Sci., Vol. 11, Art. 429, April 15, 2020, doi.org / 10.3389 / fpls.2020.00429). GmCOL2a and GmCOL2b share 83.78% amino acid similarity in the coding region. Wild-type GmCOL2a has a genomic sequence of SEQ ID NO: 15 and a coding sequence of SEQ ID NO: 16. It encodes a protein with the amino acid sequence of SEQ ID NO: 17. Wild-type GmCOL2b has a genomic sequence of SEQ ID NO: 21 and a coding sequence of SEQ ID NO: 22, which encodes a polypeptide having a sequence of SEQ ID NO: 23.

[0079] The GmCOL2a gene or its alleles are referenced as GLYMA_08G255200 (soybase.org). The GmCOL2a gene is located on chromosome 8 and encodes a polypeptide homologous to the Arabidopsis CONSTANS (CO) protein. The GmCOL2 polypeptide contains a B-box zinc finger domain and a CCT motif and inhibits photoperiodic flowering in soybean under long-day conditions (Cao et al., Plant Cell Physiol. 56(12), 2409-2422 (2015)).

[0080] The GmCOL2b gene or its alleles are referenced as GLYMA_18G278100 (soybase.org) and are involved in the flowering transition in soybean. GmCOL2b is also known as CONSTANCE-like 2b and is located on chromosome 18. It encodes a polypeptide homologous to the Arabidopsis CONSTANS (CO) protein. The GmCOL2b polypeptide contains a B-box zinc finger domain and a CCT motif and belongs to the GATA-4 / 5 / 6 transcription factor family (Zhang et al. Front Plant Sci. 2020 Apr 15:11:429, doi:10.3389 / fpls.2020.00429).

[0081] The inventors of the present disclosure have surprisingly discovered that knocking out GmCOL2a and GmCOL2b, alone or together, can significantly accelerate the flowering and / or maturation time of soybean plants (i.e., reduce the flowering time relative to control plants). When both genes are knocked out in the same plant, the accelerated effect on flowering and / or maturation time is even more significant. In some cases, soybean plants in which GmCOL2a and / or GmCOL2b are knocked out bloom and / or mature 2-40 days earlier than control plants, such as 3-30 days, 4-25 days, 5-20 days, or 5-17 days earlier. In some cases, soybean plants in which GmCOL2a and / or GmCOL2b are knocked out bloom 2, 3, 4, 5, 6, 7, 8, 9, 10, or more days earlier than control plants. In some cases, soybean plants in which both GmCOL2a and GmCOL2b are knocked out flower significantly earlier than control plants, such as 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 days or more earlier than control plants.

[0082] For the purposes of this disclosure, knockout refers to a plant or plant cell in which the wild-type gene is completely removed / deleted or mutated to form a mutant allele (null mutant) encoding a non-functional protein. In certain embodiments, the plant or plant cell is edited to express a protein that has a reduced function relative to the corresponding wild-type protein. The methods and compositions disclosed herein can be used to reduce the expression and / or activity of one or more polypeptides disclosed herein (e.g., GmCOL2a, GmCOL2b, GmFT4, GmFT5a, and / or GmFT5b) (e.g., knocking down or knocking out), as further described in Section V below.

[0083] Methods for introducing genomic modifications into plants are known, and exemplary methods are also described in Section V of this application entitled "Methods for Producing Plant Varieties with Altered Flowering and / or Maturation Time." In some embodiments, genomic modification is performed by CRISPR / Cas9-mediated targeted mutagenesis using sgRNAs that target sequences in GmCOL2a and / or GmCOL2b. In an exemplary method, one or more vectors encoding Cas9 and sgRNAs containing target binding sequences are introduced into soybean plants. Plants expressing Cas9 and sgRNAs can be selected based on the selection marker in the vector and verified by PCR or sequencing. The resulting mutant GmCOL2a or GmCOL2b allele can be determined by sequencing. In one illustrative example, editing of GmCOL2a uses the reagents in Table 3. In one illustrative example, editing of GmCOL2b uses the reagents in Table 4. Table 3. Reagents used to knock out GmCOL2a Table 4. Reagents used to knock out GmCOL2b

[0084] In some embodiments, the mutant alleles generated by gene editing are non-naturally occurring mutant alleles. In some embodiments, one or more mutant GmCOL2a and / or GmCOL2b alleles comprise one or more of the following: nonsense mutations, in-frame deletion mutations, missense mutations, frameshift mutations, splice site mutations, or any combination thereof. In some embodiments, editing of GmCOL2a and / or GmCOL2b produces plants having one or more of the following: protein truncations, non-functional proteins, or proteins with reduced function relative to the protein expressed by the corresponding wild-type alleles.

[0085] In some embodiments, genome editing of a plant results in a modified plant expressing a mutant GmCOL2a polypeptide comprising: (a) an amino acid sequence at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to SEQ ID NO: 20; or (b) the amino acid sequence set forth in SEQ ID NO: 20. In some embodiments, the modified plant comprises a mutant GmCOL2a allele that is SEQ ID NO: 18 or 19. In some embodiments, the modified plant comprises a mutant GmCOL2a allele having a nucleic acid sequence at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to SEQ ID NO: 18 or 19.

[0086] In some embodiments, soybean plants comprising a mutant GmCOL2a allele disclosed herein flower earlier than control plants comprising a wild-type GmCOL2a allele. In some embodiments, the GmCOL2a mutant allele comprises a 398-bp deletion and encodes a mutant polypeptide GmCOL2a having the amino acid sequence of SEQ ID NO: 20. In one illustrative embodiment, under LD conditions, plants expressing this mutant polypeptide flower earlier (e.g., five days) than control plants comprising wild-type GmCOL2a, as shown, for example, in Example 1.

[0087] In some embodiments, genome editing of a plant results in a modified plant expressing a mutant GmCOL2b polypeptide comprising: (a) an amino acid sequence at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to SEQ ID NO: 26; or (b) the amino acid sequence set forth in SEQ ID NO: 26. In some embodiments, the modified plant comprises a polynucleotide that is SEQ ID NO: 24 or 25. In some embodiments, the modified plant comprises a mutant GmCOL2b allele that is at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to SEQ ID NO: 24 or 25.

[0088] Compared to the genomic sequence of wild-type GmCOL2a (SEQ ID NO: 15), the mutant GmCOL2a allele (SEQ ID NO: 18) contains a 398-bp deletion (at position -318 to 70 bp), and the A of the start codon ATG is considered to be position 1. As shown in Examples 1 and Figure 2As shown, soybean plants expressing this mutant allele flowered 12 days earlier than control plants under LD conditions.

[0089] Compared to the genomic sequence of wild-type GmCOL2b (SEQ ID NO: 21), the mutant GmCOL2b allele (SEQ ID NO: 24) contains a 1-bp deletion (at position 48 bp), and the A of the start codon ATG is considered to be position 1. As shown in Examples 1 and Figure 4 As shown, soybean plants expressing this mutant allele flowered 7 days earlier than control plants under LD conditions.

[0090] In some embodiments, soybean plants comprising a mutant GmCOL2b disclosed herein flower earlier than control plants comprising wild-type GmCOL2b. In some embodiments, the GmCOL2b mutant allele comprises a 1-bp deletion and encodes a mutant polypeptide GmCOL2b having the amino acid sequence of SEQ ID NO: 26. In an illustrative embodiment, under LD conditions, plants expressing this mutant protein flower earlier (e.g., seven days) than control plants comprising wild-type GmCOL2b, as shown, for example, in Example 1.

[0091] In some embodiments, the soybean plant is a double mutant, comprising, for example, a genome modified to contain both a mutant GmCOL2a allele and a mutant GmCOL2b allele. In some embodiments, the double mutant soybean plant flowers faster than a control plant containing one or both of the wild-type GmCOL2a allele and the wild-type GmCOL2b allele. In some embodiments, the mutant GmCOL2a allele comprises a 398-bp deletion and encodes the amino acid sequence set forth in SEQ ID NO:20, and the mutant GmCOL2b allele comprises a 1-bp deletion and encodes a mutant polypeptide having the amino acid sequence set forth in SEQ ID NO:26. In one illustrative embodiment, the double mutant soybean plant flowers 17 days earlier than a control plant containing both the wild-type GmCOL2a and GmCOL2b alleles, as shown, for example, in Example 1. B. GmFT4

[0092] GmFT4 is a homolog of the flowering locus T. The genomic sequence of GmFT4 is SEQ ID NO: 27 and the coding sequence is SEQ ID NO: 28. The expression of GmFT4 protein (SEQ ID NO: 29) is strongly upregulated under LD conditions, showing a circadian rhythm, but is downregulated under SD conditions. It is worth noting that when transferred to continuous light, the basal expression level of GmFT4 increases, while when transferred to continuous darkness, the basal expression level of GmFT4 is suppressed. GmFT4 is mainly expressed in fully expanded leaves (Zhai et al., PLoS One, 9(2): e89030, February 19, 2014, doi.org / 10.1371 / journal.pone.0089030).

[0093] The inventors of the present disclosure have surprisingly found that knocking out GmFT4 can accelerate the flowering and / or maturity time of soybean plants. In some cases, soybean plants in which GmFT4 has been knocked out bloom and / or mature 3, 4, 5, 6, 7, or 8 days earlier than control plants expressing wild-type GmFT4, as shown in, for example, Example 2.

[0094] Methods for introducing genomic modifications into plants are known, and exemplary methods are also described in Section V of this application entitled "Methods for Producing Plant Varieties with Altered Flowering and / or Maturity Times." In some embodiments, gene editing of GmFT4 is performed by CRISPR / Cas9-mediated targeted mutagenesis using sgRNAs that target sequences in GmCOL2a. In an exemplary method, one or more vectors encoding Cas9 and sgRNAs containing target binding sequences are introduced into soybean plants. Plants containing expression of Cas9 and sgRNAs can be selected based on the selection marker in the vector and verified by PCR or sequencing. The resulting mutant GmFT4 allele can be determined by sequencing. In an illustrative example, editing of GmFT4 uses the reagents in Table 5. Table 5. Reagents used to knock out GmFT4

[0095] In some embodiments, the mutant allele produced by gene editing is a non-naturally occurring mutant allele. In some embodiments, the mutant GmFT4 allele comprises one or more of the following: nonsense mutation, in-frame deletion mutation, missense mutation, frameshift mutation, splice site mutation, or any combination thereof. In some embodiments, editing of the genomic sequence of the wild-type GmFT4 allele produces a plant having one or more of the following: protein truncation, non-functional protein, or a protein with reduced function relative to the protein expressed by the corresponding wild-type allele.

[0096] In some embodiments, the mutant GmFT4 allele comprises the sequence of SEQ ID NO: 29 (referred to herein as "GmFT4 mutant type 1"). Using the genomic sequence of wild-type GmFT4 (SEQ ID NO: 27) as a reference, the mutant allele contains a 5bp deletion (a deletion from nucleotide position 76 to nucleotide position 80) (relative to the polynucleotide of SEQ ID NO: 27). In some embodiments, the mutant GmFT4 allele comprises the sequence of SEQ ID NO: 31 (referred to herein as "GmFT4 mutant type 2"), which contains a single nucleotide insertion T in the sequence between nucleotide positions 38 and 39. In some embodiments, the mutant GmFT4 allele comprises a sequence having at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 29 or 31.

[0097] In some embodiments, the genetically modified plant expresses a mutant GmFT4 polypeptide comprising the polypeptide sequence of SEQ ID NO: 30 or 32. In some embodiments, the genetically modified plant expresses a mutant GmFT4 polypeptide that is at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to SEQ ID NO: 30 or 32.

[0098] Under SD conditions, plants in which the genomic sequence of wild-type GmFT4 has been converted to a GmFT4 mutant allele by gene editing mature earlier than control plants. In certain embodiments, these plants mature 2-40 days, for example, 3-30 days, 4-25 days, 5-20 days, or 5-17 days earlier than control plants. In certain embodiments, these plants mature between 2 and 9 days earlier, for example, 3 to 6 days earlier. See Table 11.

[0099] Under LD conditions, plants in which wild-type GmFT4 has been edited to the GmFT4 mutant allele disclosed herein bloom and / or mature earlier than control plants. In some embodiments, these plants bloom 2-40 days earlier, such as 3-30 days, 4-25 days, 5-20 days, or 5-17 days earlier than control plants. In some embodiments, these plants bloom 4 days earlier. In some embodiments, these plants mature 5-8 days earlier than control plants. See Table 12.

[0100] In some embodiments, the soybean plants provided herein comprise a mutant GmFT4 allele comprising a 5-bp deletion and encoding a mutant polypeptide GmFT4 having an amino acid sequence as set forth in SEQ ID NO: 30 or 32. In some embodiments, the mutant soybean plants comprising the mutant GmFT4 allele flower earlier than the control plants (wild-type plants) under LD conditions, for example, about three (3) days earlier. In an illustrative embodiment, the mutant soybean plants comprising the mutant GmFT4 allele mature about three (3) to six (6) days earlier than the control plants (wild-type plants) under SD conditions, as shown, for example, in Example 2 (Tables 11 and 12). IV. Polynucleotides and Polypeptides Conferring Delayed Flowering

[0101] GmFT5a and GmFT5b are flowering locus T (FT) homologs and flowering regulators in soybean. The genomic sequence of the wild-type GmFT5a gene is provided as SEQ ID NO:52, and the coding sequence is SEQ ID NO:39. The wild-type GmFT5a polypeptide comprises the sequence of SEQ ID NO:40. The genomic sequence of the GmFT5b gene is SEQ ID NO:54, and the coding sequence is SEQ ID NO:35. The amino acid sequence of the GmFT5b protein is SEQ ID NO:36. GmFT5a is highly upregulated under SD conditions and has a diurnal expression pattern, with highest expression 4h after dawn. Under long-day (LD) conditions, the expression of GmFT5a is downregulated and does not follow a diurnal pattern. (Cai et al., Plant Biotechnology J. [Plant Biotechnology Magazine] January 2020; 18 (1): 298-309). Little information is known about the expression pattern of GmFT5b in soybean plants. GmFT5b has been selected for in soybean domestication and breeding. GmFT5b shares a high degree of amino acid identity (96.5%) with GmFT5a. Ectopic expression experiments in Arabidopsis have demonstrated that GmFT5b can promote flowering (Jiang, B. et al. (2019) Natural variations of FT family genes in soybean varieties covering a wide range of maturity groups, BMC Genomics, 20(1):230; Wang, Z. et al. (2015) Functional evolution of phosphatidylethanolamine binding proteins in soybean and Arabidopsis, the Plant Cell, 27(2):323-36; Kong, F. et al. (2010) Two coordinately regulated homologs of FLOWERING LOCUS T are involved in the control of photoperiodic flowering). insoybean [Two coordinately regulated homologs of the flowering locus T are involved in the control of soybean photoperiodic flowering], Plant Physiology, 154(3):1220-31).

[0102] The GmFT5a gene or its alleles are referenced at GLYMA_16G044100 (soybase.org). GmFT5a regulates floral development and plant circadian rhythms in soybean. The GmFT5a gene is located on chromosome 16. GmFT5a has a phosphatidylethanolamine binding domain (Jiang et al., BMC Genomics 20(1), 230(2019)).

[0103] GmFT5b or its allele reference GLYMA_19G108200 (soybase.org). Like GmFT5a, GmFT5b also regulates flower development and plant circadian rhythms in soybean. GmFT5a is located on chromosome 19. Like GmFT5a, GmFT5b has a phosphatidylethanolamine binding domain (Jiang et al., BMC Genomics 20(1), 230(2019)).

[0104] It has been reported that both GmFT5a and GmFT5b promote early flowering in Arabidopsis (Su, Q. et al., Int. J. Mol. Sci. [International Journal of Molecular Sciences] 2022, 23(5), 2497, doi.org / 10.3390 / ijms23052497; Lee, SH et al., Front. Plant Sci. [Plant Science Frontier], Vol. 12, Art. 613675, April 26, 2021, doi.org / 10.3389 / fpls.2021.613675). The inventors of the present disclosure have found that knocking out GmFT5a and / or GmFT5b alone or together can significantly delay flowering and / or maturity of soybean plants under LD conditions. When both genes are knocked out in the same plant, the effects on flowering and maturity are even more pronounced. In some cases, under LD conditions, soybean plants in which one of GmFT5a or GmFT5b has been knocked out bloom or mature 2-50 days later, e.g., 4-40 days, 10-30 days, or 5-25 days later than control plants. In some cases, under LD conditions, soybean plants in which both GmFT5a and GmFT5b have been knocked out bloom or mature 25 days, 30 days, 35 days, 40 days, or more later than control plants. Figure 14 ).

[0105] Methods for introducing genomic modifications into plants are known, and exemplary methods are also described in Section V of this application entitled "Methods for Producing Plant Varieties with Altered Flowering and / or Maturity Times." In some embodiments, gene editing is performed by CRISPR / Cas9-mediated targeted mutagenesis using sgRNAs that target sequences in GmFT5a or GmFT5b. In an exemplary method, one or more vectors encoding Cas9 and an sgRNA containing a target binding sequence are introduced into soybean plants. Plants containing expression of Cas9 and sgRNA can be selected based on the selection marker in the vector and verified by PCR or sequencing. The resulting mutant GmFT5a or GmFT5b allele can be determined by sequencing. In one illustrative example, editing of GmFT5a uses the reagents in Table 6. In one illustrative example, editing of GmFT5b uses the reagents in Table 7. Table 6. Reagents used to knock out GmFT5a Table 7. Reagents used to knock out GmFT5b

[0106] In some embodiments, the mutant GmFT5a allele comprises the sequences of SEQ ID NO:41 and SEQ ID NO:53. Using the wild-type genomic sequence of GmFT5a (SEQ ID NO:52) as a reference, the mutant allele contains a 1 bp insertion between nucleotide positions 52 and 53 of the polynucleotide having the sequence of SEQ ID NO:52, thereby generating a frameshift-induced premature stop codon in Gmft5a. In some embodiments, the mutant GmFT5a allele comprises a sequence that is at least 85%, at least 90%, at least 95%, or at least 98% identical to SEQ ID NO:41 or 53. In some embodiments, under LD conditions, soybean plants that have been modified to comprise mutant GmFT5a alleles bloom significantly later (e.g., about twenty days) than wild-type soybean plants, as shown in, for example, Example 3, particularly Table 16.

[0107] In some embodiments, the genetically modified plant expresses a mutant GmFT5a protein having the sequence of SEQ ID NO: 42. In some embodiments, the genetically modified plant expresses a mutant GmFT5a protein that is at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to SEQ ID NO: 42.

[0108] In some embodiments, the soybean plant provided herein is a double mutant, comprising, for example, a soybean plant whose genome has been modified to comprise both a mutant GmFT5a allele and a mutant GmFT5b allele. In a particular embodiment, the mutant GmFT5a allele comprises a 1-bp insertion and encodes a mutant polypeptide having the amino acid sequence of SEQ ID NO:42, and the mutant GmFT5b allele comprises an 8-bp deletion and encodes a mutant polypeptide having the amino acid sequence of SEQ ID NO:38. In some embodiments, under LD conditions, the double mutant soybean plant blooms significantly later than the wild-type soybean plant. In an illustrative example, the double mutant plant blooms about 33 days later than the wild-type soybean plant and matures at least 34 days later, as shown in, for example, Example 3, particularly Table 18. V. Methods for Producing Plant Varieties with Altered Flowering and / or Maturation Times

[0109] Provided herein are methods for producing plants with altered flowering and / or maturity times. In one aspect, the method can include editing the genome of a recipient plant such that the resulting plant comprises a mutant allele encoding one or more mutant polypeptides as described above, such as a mutant GmCOL2a polypeptide (SEQ ID NO: 20), a mutant GmCOL2b polypeptide (SEQ ID NO: 26), a mutant GmFT4 polypeptide (SEQ ID NO: 30 or 32), a mutant GmFT5a polypeptide (SEQ ID NO: 42), and / or a mutant GmFT5b polypeptide (SEQ ID NO: 38). In yet another aspect, the method can include reducing the expression level and / or activity of one or more of a mutant GmCOL2a polypeptide (SEQ ID NO: 20), a mutant GmCOL2b polypeptide (SEQ ID NO: 26), a mutant GmFT4 polypeptide (SEQ ID NO: 30 or 32), a mutant GmFT5a polypeptide (SEQ ID NO: 42), and / or a mutant GmFT5b polypeptide (SEQ ID NO: 38) in a recipient plant by inhibiting promoter activity or by replacing the endogenous promoter with a weaker promoter. In another aspect, the method can include breeding a donor plant with a recipient plant and selecting for incorporation of the corresponding mutant polynucleotide into the recipient plant genome, wherein the donor plant comprises one or more of the genomic modifications present in one or more of the above mutant polypeptides (e.g., mutant GmCOL2a polypeptide (SEQ ID NO: 20), mutant GmCOL2b polypeptide (SEQ ID NO: 26), mutant GmFT4 polypeptide (SEQ ID NO: 30 or 32), mutant GmFT5a polypeptide (SEQ ID NO: 42), and / or mutant GmFT5b polypeptide (SEQ ID NO: 38)). 1. Gene Editing

[0110] In some embodiments, the polynucleotide sequences provided herein can be targeted to specific sites within the genome of a recipient plant cell. Such methods include, but are not limited to, meganucleases designed for the target plant genomic sequence CRISPR-Cas9, TALENs, and other technologies for precise genome editing (Feng et al. Cell Research 23: 1229-1232, 2013, WO 2013 / 026740); Cre-lox site-specific recombination; FLP-FRT recombination (Li et al. (2009) Plant Physiol 151: 1087-1095); Bxbl-mediated integration (Yau et al. Plant J (2011) 701: 147-166); zinc finger-mediated integration (Wright et al. (2005) Plant J 44: 693-705; Cai et al. (2009) Plant Physiol 151: 1087-1095); Mol Biol 69:699-709); homologous recombination (Lieberman-Lazarovich and Levy (2011) Methods Mol Biol:51-65); primer editing and transposases (Anzalone, A. et al., Nat Biotechnol. 2020 Jul;38(7):824-844); translocations; and inversions.

[0111] Various embodiments of the methods described herein use gene editing. In some embodiments, gene editing is used to modify the genome of a plant to produce a plant with one or more polypeptides that can confer altered flowering and / or maturity time.

[0112] In some embodiments, the genomic sequence of the plant to be edited is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to one or more of SEQ ID NOs: 15, 21, 27, 52, and / or 54. In some embodiments, the genomic sequence to be edited comprises the nucleic acid sequence shown in SEQ ID NOs: 1, 6, 43, 49, and 46. In some embodiments, the plant that has been modified expresses one or more of the mutant GmCOL2a polypeptide, mutant GmCOL2b polypeptide, mutant GmFT5a polypeptide, mutant GmFT5b polypeptide, and / or mutant GmFT4 polypeptide disclosed above. In particular embodiments, the soybean plant has been edited to express one or more of the following mutant polypeptides: mutant GmCOL2a polypeptide (SEQ ID NO: 20), mutant GmCOL2b polypeptide (SEQ ID NO: 26), mutant GmFT4 polypeptide (SEQ ID NO: 30 or 32), mutant GmFT5a polypeptide (SEQ ID NO: 42), and / or mutant GmFT5b polypeptide (SEQ ID NO: 38). In some embodiments, the plant has been edited to express both mutant GmCOL2a polypeptide (SEQ ID NO: 20) and mutant GmCOL2b polypeptide (SEQ ID NO: 26). In some embodiments, the plant has been edited to express both mutant GmFT5a polypeptide (SEQ ID NO: 42) and mutant GmFT5b polypeptide (SEQ ID NO: 38).

[0113] In some embodiments, provided herein are plants transformed with and expressing the gene editing machinery as described above, which, when crossed with a target plant, result in gene editing in the target plant.

[0114] Typically, gene editing may involve transient, inducible, or constitutive expression of a gene editing component or system in a target plant. Gene editing may involve genomic integration or episomal presence of a gene editing component or system.

[0115] Gene editing generally refers to the use of site-directed nucleases (including but not limited to CRISPR / Cas, zinc fingers, meganucleases, etc.) to shorten a nucleotide sequence at a desired position. This may result in insertion / deletion ("indel") mutations (i.e., "SDN1"), base editing (i.e., "SDN2"), or allele insertion or replacement (i.e., "SDN3"). SDN2 or SDN3 gene editing can include providing one or more recombination templates (e.g., in a vector) comprising a target gene sequence (i.e., to be introduced into the plant genome) that can be used for homology-directed repair (HDR) in plants. In some embodiments, the target gene or allele is a gene or allele that can confer improved traits (e.g., altered flowering and / or maturity time) to the plant. The recombination template can be introduced into the plant and edited by transformation or by breeding using a donor plant containing the recombination template. The break in the plant genome can be introduced into, upstream, and / or downstream of the target sequence. In some embodiments, a double-stranded DNA break is generated within or near the target sequence locus. In certain embodiments, the target sequence locus is subjected to a rupture that is generated upstream and downstream of the target sequence locus, which can cause it to be excised from the genome. In certain embodiments, one or more single-stranded DNA breaks (nicks) are produced inside the target sequence, upstream and / or downstream (e.g., using nickase Cas9 variants). Any of these DNA breaks and those DNA breaks introduced via additive methods well known to those skilled in the art can induce HDR. By HDR, the target sequence is replaced by the sequence of the recombinant template comprising the provided polynucleotide of interest. In certain embodiments, the target sequence for gene editing is one or more of the GmCOL2a gene target sequence as shown in SEQ ID NO:1, the GmCOL2b gene target sequence as shown in SEQ ID NO:6, the GmFT4 gene target sequence as shown in SEQ ID NO:43, the GmFT5a gene target sequence as shown in SEQ ID NO:49, and / or the GmFT5b gene target sequence as shown in SEQ ID NO:46. By designing this system, one or more single-stranded or double-stranded breaks are introduced into the interior, upstream and / or downstream of the corresponding region in the plant genome that does not comprise the target gene sequence, and this region can be replaced with a template.

[0116] In certain embodiments, the mutation in the target gene described herein can be produced via targeted introduction of DNA double-strand breaks without using a recombinant template. Such a break can be repaired by non-homologous end joining (NHEJ) process, which may result in a small insertion or deletion (indel) at the repair site. Such indels may result in frameshift mutations, thereby causing premature termination codons or other types of loss-of-function mutations in the targeted gene.

[0117] In certain embodiments, nucleic acid modification or mutation is achieved by a (modified) zinc finger nuclease (ZFN) system. The ZFN system uses an artificial restriction endonuclease generated by fusing a zinc finger DNA binding domain with a DNA cleavage domain that can be engineered to target a desired DNA sequence. Exemplary methods for genome editing using ZFNs can be found, for example, in the following: U.S. Patent Nos. 6,534,261; 6,607,882; 6,746,838; 6,794,136; 6,824,978; 6,866,997; 6,933,113; and 6,979,539.

[0118] In certain embodiments, nucleic acid modification is achieved by (modified) meganucleases, which are endodeoxyribonucleases characterized by a large recognition site (a double-stranded DNA sequence of 12 to 40 base pairs). Exemplary methods using meganucleases can be found in: U.S. Patent Nos. 8,163,514; 8,133,697; 8,021,867; 8,119,361; 8,119,381; 8,124,369; and 8,129,134, which are specifically incorporated by reference.

[0119] In certain embodiments, nucleic acid modification is achieved by a (modified) CRISPR / Cas complex or system. In certain embodiments, the CRISPR / Cas system or complex is a Class 2 CRISPR / Cas system. In certain embodiments, the CRISPR / Cas system or complex is a Type II, Type V, or Type VI CRISPR / Cas system or complex. Instead of generating customized proteins to target specific sequences, the CRISPR / Cas system can program a single Cas protein to recognize a specific nucleic acid target via an RNA guide sequence (gRNA). In other words, the short RNA guide sequence can be used to recruit the Cas enzyme protein to a specific target nucleic acid locus (which may contain or consist of RNA and / or DNA).

[0120] Typically, CRISPR / Cas or CRISPR systems, as used herein in the above-mentioned documents, collectively refer to transcripts and other elements involved in the expression of CRISPR-associated ("Cas") genes or directing their activity, including sequences encoding Cas genes and one or more of the following: tracr (trans-activating CRISPR) sequences (e.g., tracrRNA or active partial tracrRNA), tracr-pairing sequences (including "direct repeats" and partial direct repeats processed by tracrRNA in the context of endogenous CRISPR systems), guide sequences (also referred to as "spacers" in the context of endogenous CRISPR systems), or one or more "RNAs" as used herein (e.g., one or more RNAs for guiding Cas such as Cas9, e.g., CRISPR RNA and, where applicable, trans-activating (tracr) RNA or single guide RNA (sgRNA) (chimeric RNA)) or other sequences and transcripts from the CRISPR locus. Typically, a CRISPR system is characterized by an element (also referred to as a protospacer in the context of an endogenous CRISPR system) that promotes the formation of a CRISPR complex at the site of a target sequence. In the context of forming a CRISPR complex, a "target sequence" refers to a sequence to which a guide sequence is designed to have complementarity, wherein hybridization between the target sequence and the guide sequence promotes formation of a CRISPR complex. The target sequence can comprise any polynucleotide, such as a DNA or RNA polynucleotide.

[0121] In certain embodiments, gRNA is a chimeric guide RNA or a single guide RNA (sgRNA). In certain embodiments, gRNA comprises a guide sequence and a tracr pairing sequence (or a repeat sequence in the same direction). In certain embodiments, gRNA comprises a guide sequence, a tracr pairing sequence (or a repeat sequence in the same direction) and a tracr sequence. In certain embodiments, CRISPR / Cas systems or complexes as described herein do not include and / or do not rely on the presence of a tracr sequence (e.g., if the Cas protein is Cas12a).

[0122] Cas proteins as mentioned herein, such as, but not limited to, Cas9, Cas12a (formerly known as Cpf1), Cas12b (formerly known as C2c1), Cas13a (formerly known as C2c2), C2c3, Cas13b proteins, can be derived from any suitable source and therefore can include different orthologs derived from a variety of (prokaryotic) organisms, as well as well documented in the art. In certain embodiments, the Cas protein is (modified) Cas9, preferably (modified) Staphylococcus aureus Cas9 (SaCas9) or (modified) Streptococcus pyogenes Cas9 (SpCas9). In certain embodiments, the Cas protein is Cas12a, optionally from an aminoacidococcus species, such as an aminoacidococcus species BV3L6 Cpf1 (AsCas12a), or a Lachnospiraceae bacteria Cas12a, such as Lachnospiraceae bacteria MA2020 or Lachnospiraceae bacteria MD2006 (LBCas12a). See U.S. Patent No. 10,669,540, which is incorporated herein by reference in its entirety. Alternatively, the Cas12a protein can be from Moraxella bovoculi AAX08_00205 [Mb2Cas12a] or Moraxella bovoculi AAX11_00205 [Mb3Cas12a]. See, WO 2017 / 189308, which is incorporated herein by reference in its entirety. In certain embodiments, the Cas protein is (modified) C2c2, preferably Leptotrichia wadei C2c2 (LwC2c2) or Listeria newyorkensis FSL M6-0635 C2c2 (LbFSLC2c2). In certain embodiments, the (modified) Cas protein is C2c1. In certain embodiments, the (modified) Cas protein is C2c3. In certain embodiments, the (modified) Cas protein is Cas13b. Other Cas enzymes are available to those skilled in the art.

[0123] Gene editing methods and compositions are also disclosed in U.S. Patent Nos. 10,519,456 and 10,285,348 82, the entire contents of which are incorporated herein by reference.

[0124] The gene editing machine (for example, DNA modification enzyme) introduced into the plant can be controlled by any promoter that can drive the recombinant gene to be expressed in the plant. In certain embodiments, the promoter is a constitutive promoter. In certain embodiments, the promoter is a tissue-specific promoter, such as a pollen-specific promoter or a sperm cell-specific promoter, a zygote-specific promoter, a root-specific promoter, or a promoter (for example, prOsActin1) highly expressed in sperm, ovum and zygote. Exemplary promoters are disclosed in U.S. Patent No. 10,519,456, the entire contents of which are incorporated herein by reference.

[0125] In certain embodiments, guide RNA and Cas protein (or any other suitable nuclease) can be delivered in the form of DNA, for example, in a suitable vector that can be introduced into yeast cells. Typically, the DNA encoding gRNA is cloned into a vector downstream of a promoter for expression. sgRNA and Cas can be expressed by the same vector of the system or by different vectors. In certain embodiments, the genome modification of plants uses one or more pUC57-sgRNAs containing the target sequence of any one of PTF101-Cas9 and GmCOL2a, GmCOL2b, GmFT5a, GmFT5b, and / or GmFT4 using vectors expressing DNA modification enzymes. In a particular example, the GmCOL2a gene target sequence as shown in SEQ ID NO: 1, the GmCOL2b gene target sequence as shown in SEQ ID NO: 6, the GmFT4 gene target sequence as shown in SEQ ID NO: 43, the GmFT5a gene target sequence as shown in SEQ ID NO: 49, and / or the GmFT5b gene target sequence as shown in SEQ ID NO: 46 can be used. In some embodiments, SEQ ID NO: 1 and SEQ ID NO: 6 are both used for gene editing to produce soybean plants comprising both mutant GmCOL2a alleles and mutant GmCOL2b alleles. In some embodiments, SEQ ID NO: 49 and SEQ ID NO: 46 are both used for gene editing to produce soybean plants comprising both mutant GmFT5a alleles and mutant GmFT5b alleles. In some embodiments, SEQ ID NO: 49 (GmFT5a target sequence) and SEQ ID NO: 6 (GmCOL2b target sequence) are both used for gene editing to produce soybean plants comprising both mutant GmCOL2a alleles and mutant GmCOL2b alleles. In some embodiments, the vectors are respectively transformed into the target soybean plants to induce gene editing. In some embodiments, the coding sequence of Cas9 and the coding sequence of sgRNA are connected to a single vector, which is then transformed into the soybean plant to induce genome modification. Cas9 vectors and sgRNA vectors typically contain a selection marker, such as spectinomycin, for identifying transformants comprising gene editing machinery.

[0126] In some embodiments, the target soybean plant is an elite soybean plant, such as an elite edamame (Glycine max) plant or an elite wild soybean (Glycine soja) plant, and the elite target soybean plant can be edited using the methods described above to express one or more of the following mutant polypeptides: mutant GmCOL2a polypeptide (SEQ ID NO: 20), mutant GmCOL2b polypeptide (SEQ ID NO: 26), mutant GmFT4 polypeptide (SEQ ID NO: 30 or 32), mutant GmFT5a polypeptide (SEQ ID NO: 42), and / or mutant GmFT5b polypeptide (SEQ ID NO: 38).

[0127] In some embodiments, the methods described above can be used to edit a target soybean plant (optionally an elite soybean target plant) to express one or more of the following mutant polypeptides: a mutant GmCOL2a polypeptide having at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 20, a mutant GmCOL2b polypeptide having at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 26, a mutant GmFT4 polypeptide having at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 30 or 32, a mutant GmFT5a polypeptide having at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 42, and / or a mutant GmFT6 polypeptide having at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO: 43. NO:38 A mutant GmFT5b polypeptide having at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity.

[0128] In some embodiments, methods of introducing a desired genomic modification comprise pollinating a target plant comprising genomic DNA to be edited using a first soybean plant expressing a DNA modifying enzyme and at least one optional guide nucleic acid as described above. 2. Hybridization

[0129] In some embodiments, the method includes hybridizing a donor plant comprising a genome modification disclosed herein with a recipient plant, and the genome modification can impart altered flowering and / or maturity time in the recipient plant. As used herein, the terms "hybridization" and "breeding" refer to gamete fusion to produce progeny (e.g., by fertilization, such as producing seeds in plants by pollination). In some embodiments, "hybridization," "breeding," or "cross-fertilization" is the fertilization of one individual by another (e.g., cross-pollination in plants). The plant disclosed herein can be a whole plant, or can be a plant cell, seed, or tissue, or a plant part, such as a leaf, stem, pollen, or a cell that can be cultivated into a whole plant. In some embodiments, the donor plant or recipient plant is an excellent soybean plant, such as an excellent edamame plant or an excellent wild soybean plant.

[0130] In some embodiments, the donor plant that has been edited to express one or more of the following mutant polypeptides: mutant GmCOL2a polypeptide (SEQ ID NO: 20), mutant GmCOL2b polypeptide (SEQ ID NO: 26), mutant GmFT4 polypeptide (SEQ ID NO: 30 or 32), mutant GmFT5a polypeptide (SEQ ID NO: 42), and / or mutant GmFT5b polypeptide (SEQID NO: 38) can be crossed with an elite recipient soybean plant to produce progeny plants containing such mutant alleles.

[0131] In some embodiments, the donor plant has been edited to express one or more of: a mutant GmCOL2a polypeptide having at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO:20, a mutant GmCOL2b polypeptide having at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO:26, a mutant GmFT4 polypeptide having at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO:30 or 32, a mutant GmFT5a polypeptide having at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO:42, and / or a mutant GmFT5b polypeptide having at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identity to SEQ ID NO:38. And the donor plant can be crossed with an elite recipient soybean plant to produce progeny plants containing such mutant alleles

[0132] In some embodiments, progeny plants produced by hybridization or breeding methods are repeatedly backcrossed to one of their parents by a process referred to herein as "backcrossing." In a backcrossing protocol, the "donor" parent refers to the parent plant that has the desired gene or locus to be introgressed. The "recipient" parent (used one or more times) or the "recurrent" parent (used two or more times) refers to the parent plant into which the gene or locus is introgressed. See, e.g., Ragot, M. et al. (1995) Marker-assisted Backcrossing: A Practical Example, Techniques et Utilisations des Marqueurs Moleculaires Les Colloques, Vol. 72, pp. 45-56; and Openshaw et al. (1994) Marker-assisted Selection in Backcross Breeding, Proceedings of the Symposium "Analysis of Molecular Marker Data," Joint Plant Breeding Symposia Series, American Society for Horticultural Science / Crop Science of America, Corvallis, Oregon, pp. 41-43. The initial cross produces the F1 generation. The term "BC1" typically refers to the second use of the recurrent parent, "BC2" refers to the third use of the recurrent parent, and so on. 3. Gene Regulation and Silencing

[0133] In some methods, the method of conferring altered flowering and / or maturity time involves inhibiting transcription of one or more wild-type alleles of GmCOL2a, GmCOL2b, GmFT5a, GmFT5b, and / or GmFT4. In some embodiments, the method comprises delivering a transcriptional repressor that can bind to the transcriptional regulatory region of any of the GmCOL2a, GmCOL2b, GmFT5a, GmFT5b, and / or GmFT4 genes in the plant, thereby inhibiting transcription of the wild-type polypeptide and reducing expression of the wild-type polypeptide. In some embodiments, expression of one or more wild-type polypeptides GmCOL2a, GmCOL2b, GmFT5a, GmFT5b, and / or GmFT4 is reduced by at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95% compared to control plants.

[0134] In some methods, methods for conferring altered flowering and / or maturity time involve reducing protein translation efficiency, such as by using non-optimized codons for expression in soybean plants.

[0135] In some methods, the method of conferring altered flowering and / or maturity time involves mutagenesis of the transcriptional regulatory region of one or more of the genes disclosed herein (e.g., GmCOL2a (SEQ ID NO: 15), GmCOL2b (SEQ ID NO: 21), GmFT4 (SEQ ID NO: 27), GmFT5a (SEQID NO: 52), and GmFT5b (SEQ ID NO: 54)) to modulate the transcriptional level of the polypeptide, thereby altering flowering and / or maturity time. As used herein, a gene regulatory region is a region of a gene where RNA polymerase and other auxiliary transcriptional regulatory proteins bind and interact to control RNA synthesis. Although the promoter is an integral part of the regulatory region, this region may also contain binding sites for proteins that act in a positive or negative regulatory manner, and various nucleotide sequence features (such as attenuators) may contribute to the regulation of transcription. In one example, one or more of these functional sequences may be deleted. In one example, a deletion may be performed to eliminate one or more normal start codons in a gene. In another example, one or more point mutations can be introduced to change the start codon of the RNA transcript, and optionally, one or more point mutations can be introduced to change any other in-frame AUG (methionine codon) near the normal start codon of the transcript.

[0136] In some methods, methods for conferring altered flowering and / or ripening time involve silencing the expression of wild-type GmCOL2a, GmCOL2b, GmFT4, GmFT5a, and / or GmFT5b genes by using an expression cassette of a transcriptional inhibitory RNA molecule (or a fragment thereof) that inhibits wild-type gene expression or activity in plant cells. Non-limiting examples of inhibitory RNA molecules include short interfering RNA (siRNA), microRNA (miRNA), antisense RNA, and the like.

[0137] RNAi (e.g., siRNA, miRNA) works by base pairing with complementary RNA or DNA target sequences. When bound to RNA, inhibitory RNA molecules trigger RNA cutting or translation inhibition of the target sequence. When bound to a DNA target sequence, it is believed that inhibitory RNA can mediate DNA methylation of the target sequence. MicroRNA (miRNA) is a non-coding RNA of about 19 to about 24 nucleotides in length that is processed from a longer precursor transcript that forms a stable hairpin structure. Any method that can lead to inhibition of gene expression of one or more of the wild-type GmCOL2a, GmCOL2b, GmFT4, GmFT5a, and / or GmFT5b genes, regardless of the specific mechanism, can be used in the methods disclosed herein. Other methods that can reduce transcription and / or translation of one or more of the wild-type GmCOL2a, GmCOL2b, GmFT4, GmFT5a, or GmFT5b polypeptides can also be used to change flowering and / or ripening time. VI. Plants, Plant Cells, and Plant Parts

[0138] Although soybean plants are used to illustrate compositions and methods throughout the application, any plant species can be edited to knock out one or more genomic DNAs in a plant, thereby imparting the flowering and / or ripening time of the change. These plant species include, but are not limited to, monocots and dicots. Examples of target plants include, but are not limited to, corn (maize), sorghum, wheat, sunflower, tomato, crucifers, pepper, potato, cotton, rice, soybean, beet, sugarcane, tobacco, barley and oilseed rape, Brassica, alfalfa, rye, millet, safflower, peanut, sweet potato, cassava, coffee, coconut, pineapple, citrus, cocoa, tea, banana, nectarine, fig, guava, mango, olive, papaya, cashew, macadamia, apricot, oat, vegetables, ornamental plants, and conifers.

[0139] The genus Glycine (soybean or soya bean) is a genus of the soybean family, Fabaceae. A Glycine plant can be Glycine arenaria, Glycine argyrea, Glycine cyrtoloba, Glycine canescens, Glycine clandestine, Glycine curvata, Glycine falcata, Glycine latifolia, Glycine microphylla, Glycine pescadrensis, Glycine senophita, Glycine syndetica, Glycine soja Seib. Et Zucc., Glycine max (L.) Merrill., Glycine tabacina, or Glycine tomentella.

[0140] In some embodiments, the soybean plant is an elite soybean plant, such as an elite edamame plant or an elite wild soybean plant. In some embodiments, the elite soybean plant expresses one or more of the following mutant polypeptides: a mutant GmCOL2a polypeptide (SEQ ID NO: 20), a mutant GmCOL2b polypeptide (SEQ ID NO: 26), a mutant GmFT4 polypeptide (SEQ ID NO: 30 or 32), a mutant GmFT5a polypeptide (SEQ ID NO: 42), and / or a mutant GmFT5b polypeptide (SEQ ID NO: 38). In some embodiments, the elite soybean plant expresses one or more of a mutant GmCOL2a polypeptide at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to SEQ ID NO: 20, a mutant GmCOL2b polypeptide at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to SEQ ID NO: 26, a mutant GmFT4 polypeptide at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to SEQ ID NO: 30 or 32, a mutant GmFT5a polypeptide at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to SEQ ID NO: 42, and / or a mutant GmFT5b polypeptide at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% identical to SEQ ID NO: 38.

[0141] The plant propagation produced as described above can be made to produce progeny plants, and the progeny plants stably incorporated into their genomes by the genomic modifications of flowering and / or ripening time that have been disclosed herein that impart changes can be selected. If desired, these progeny plants can be further bred. The term "progeny" refers to one or more descendants of a specific hybrid. Typically, progeny is produced by the breeding of two individuals, but some species (particularly some plants and hermaphroditic animals) can self-fertilize (that is, the same plant serves as the donor of both male and female gametes). The one or more descendants can be, for example, F1, F2 or any subsequent generations.

[0142] In certain embodiments, the modified plant or its progeny plant comprises a homozygous mutant allele of a gene disclosed herein. In certain embodiments, the mutant allele does not naturally exist in the plant. Plants comprising a homozygous mutant allele disclosed herein can be easily selected by methods well known in the art (e.g., PCR or sequencing).

[0143] In certain embodiments, plant cells, seeds, or plant parts or harvested products can be obtained from the plants produced as above, and plant cells, seeds, or plant parts can be screened using the methods disclosed above for demonstrating stable incorporation of polynucleotides. As used herein, the term "plant part" refers to a part of a plant, including single cells and cell tissues (such as complete plant cells in plants), cell masses, and tissue cultures that can regenerate plants. Examples of plant parts include, but are not limited to, single cells and tissues from: pollen, ovules, zygotes, leaves, embryos, roots, root tips, anthers, flowers, floral parts, fruits, stems, buds, cuttings, and seeds; and pollen, ovules, egg cells, zygotes, leaves, embryos, roots, root tips, anthers, flowers, floral parts, fruits, stems, buds, cuttings, scions, rhizomes, seeds, protoplasts, callus, etc.

[0144] In some embodiments, plant products can be harvested from the plants disclosed above and processed to produce processed products such as flour, soybean meal, oil, starch, etc. These processed products are also within the scope of the present invention, provided that they comprise a polynucleotide or polypeptide disclosed herein or a variant thereof. Other soybean plant products include, but are not limited to, protein concentrates, protein isolates, soybean hulls, meal, flowers, oil, and the whole soybean itself. Exemplary embodiments

[0145] Embodiment 1 is a plant having a genomic modification, wherein the genomic modification comprises knocking out one or more of the following genes: GmCOL2a; GmCOL2b; GmFT5a; GmFT5b; or GmFT4, wherein the plant has altered flowering time and / or maturity time relative to a control plant not comprising the genomic modification.

[0146] Embodiment 2 is a plant as described in embodiment 1, wherein the genomic modification results in reduced expression and / or activity of a polypeptide encoded by the one or more genes, and the reduced expression and / or activity of the polypeptide results in the altered flowering time and / or maturity time under long day (LD) and / or short day (SD) conditions.

[0147] Embodiment 3 is the plant of embodiment 1, wherein the genomic modification is non-natural to the plant.

[0148] Embodiment 4 is the plant of embodiment 3, wherein the genomic modification comprises a deletion, insertion, or substitution in the genomic DNA sequence of the one or more genes.

[0149] Embodiment 5 is the plant of embodiment 3 or 4, wherein the genomic DNA sequence of the one or more genes: (a) is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to at least one of SEQ ID NOs: 15, 21, 27, 52, or 54, (b) is at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical to at least one of SEQ ID NOs: 16, 22, 56, 35, or 39, and / or (c) comprises the nucleic acid sequence shown in SEQ ID NOs: 1, 6, 43, 49, and 46.

[0150] Embodiment 6 is the plant of any one of embodiments 1-5, wherein the genome modification is effected by CRISPR, TALEN, or meganuclease.

[0151] Embodiment 7 is a plant as described in embodiment 6, wherein the genome modification is achieved by Cas12a-mediated gene editing.

[0152] Embodiment 8 is a plant as described in embodiment 7, wherein the Cas12a-mediated gene editing uses a gRNA with a target sequence, and the target sequence comprises one or more of SEQ ID NO: 1, 6, 43, 49, or 46.

[0153] Embodiment 9 is the plant of embodiment 1, wherein the genomic modification of the one or more genes produces a plant expressing one or more of the following: a mutant GmCOL2a polypeptide; a mutant GmCOL2b polypeptide; a mutant GmFT5a polypeptide; a mutant GmFT5b polypeptide; and / or a mutant GmFT4 polypeptide.

[0154] Embodiment 10 is a plant as described in embodiment 1, wherein the genomic modification of the one or more genes produces a plant expressing one or more of the following: a mutant GmCOL2a allele; a mutant GmCOL2b allele; a mutant GmFT5a allele; a mutant GmFT5b allele; and / or a mutant GmFT4 allele.

[0155] Embodiment 11 is the plant of any one of embodiments 1-10, wherein the genomic modification results in reduced expression and / or activity of a polypeptide comprising: (a) an amino acid sequence at least 85%, 90%, 91%, 92%, 93%, 94, 95%, 96%, 97%, 98%, or 99% identical to at least one of SEQ ID NOs: 17, 23, 28, 36, or 40, and / or (b) an amino acid sequence set forth in at least one of SEQ ID NOs: 17, 23, 28, 36, or 40.

[0156] Embodiment 12 is a plant as described in embodiment 1 or 9, wherein the genomic modification results in at least 80% reduction in expression of one or more of a wild-type GmCOL2a polypeptide (SEQ ID NO: 17), a wild-type GmCOL2b polypeptide (SEQ ID NO: 23), a wild-type GmFT5a polypeptide (SEQ ID NO: 40), a wild-type GmFT5b polypeptide (SEQ ID NO: 36), or a wild-type GmFT4 polypeptide (SEQ ID NO: 28) relative to a control plant not comprising the genomic modification.

[0157] Embodiment 13 is the plant of embodiment 9 or 12, wherein the mutant GmCOL2a polypeptide, the mutant GmCOL2b polypeptide, the mutant GmFT5a polypeptide, the mutant GmFT5b polypeptide, or the mutant GmFT4 polypeptide shares less than 20% identity with the corresponding wild-type polypeptide.

[0158] Embodiment 14 is the plant of embodiment 9 or 12, wherein the mutant GmCOL2a polypeptide, the mutant GmCOL2b polypeptide, the mutant GmFT5a polypeptide, the mutant GmFT5b polypeptide, or the mutant GmFT4 polypeptide is a non-functional polypeptide.

[0159] Embodiment 15 is the plant of any one of embodiments 9-14, wherein the plant expresses a mutant GmCOL2a polypeptide comprising: (a) an amino acid sequence at least 85% identical to SEQ ID NO: 20, or (b) the amino acid sequence as shown in SEQ ID NO: 20.

[0160] Embodiment 16 is the plant of embodiment 15, wherein the mutant GmCOL2a polypeptide is encoded by a sequence at least 85% identical to SEQ ID NO: 18 or 19.

[0161] Embodiment 17 is the plant of any one of embodiments 9-14, wherein the mutant GmCOL2b polypeptide comprises an amino acid sequence at least 85% identical to SEQ ID NO: 26, or wherein the mutant GmCOL2b polypeptide is encoded by a nucleic acid sequence at least 85% identical to SEQ ID NO: 24 or 25.

[0162] Embodiment 18 is a plant as described in any of embodiments 9-14, wherein the mutant GmFT5a polypeptide comprises an amino acid sequence that is at least 85% identical to SEQ ID NO:42, or wherein the mutant GmFT5a polypeptide is encoded by a nucleic acid sequence that is at least 85% identical to SEQ ID NO:41 or SEQ ID NO:53.

[0163] Embodiment 19 is a plant as described in any of embodiments 9-14, wherein the mutant GmFT5b polypeptide comprises an amino acid sequence that is at least 85% identical to SEQ ID NO:38, or wherein the mutant GmFT5b polypeptide is encoded by a nucleic acid sequence that is at least 85% identical to SEQ ID NO:37 or SEQ ID NO:55.

[0164] Embodiment 20 is a plant as described in any of embodiments 9-14, wherein the mutant GmFT4 polypeptide comprises an amino acid sequence that is at least 85% identical to SEQ ID NO:32 or 30, or wherein the mutant GmFT4 polypeptide is encoded by a nucleic acid sequence that is at least 85% identical to SEQ ID NO:31 or 29.

[0165] Embodiment 21 is the plant of any one of embodiments 1-20, wherein the plant is knocked out for one or more of the GmCOL2a gene, the GmCOL2b gene, or the GmFT4 gene, and wherein the plant flowers and / or matures earlier under LD conditions relative to a control plant not comprising the genomic modification.

[0166] Embodiment 22 is the plant of embodiment 21, wherein under LD conditions, the genetically modified plant flowers and / or matures at least 2 days earlier than the control plant.

[0167] Embodiment 23 is the plant of embodiment 21, wherein under LD conditions, the genetically modified plant flowers and / or matures 2-40 days earlier than the control plant.

[0168] Embodiment 24 is the plant of any one of embodiments 1-22, wherein the plant is knocked out for both the GmCOL2a gene and the GmCOL2b gene, and wherein the plant flowers and / or matures 2-40 days earlier than control plants under LD conditions.

[0169] Embodiment 25 is the plant of any one of embodiments 1-22, wherein the plant is knocked out of the GmFT4 gene, and wherein the plant flowers and / or matures 2-40 days earlier than the control plants under LD conditions and matures 2-40 days earlier than the control plants under SD conditions.

[0170] Embodiment 26 is the plant of any one of embodiments 1-20, wherein the plant is knocked out for GmFT5a or GmFT5b, or both GmFT5a and GmFT5b, and wherein the plant flowers and / or matures later under LD conditions relative to a control plant not comprising the genomic modification.

[0171] Embodiment 27 is the plant of embodiment 26, wherein under LD conditions, the genetically modified plant flowers and / or matures at least 2 days later than the control plant.

[0172] Embodiment 28 is the plant of embodiment 27, wherein under LD conditions, the genetically modified plant flowers and / or matures 2-40 days later than the control plant.

[0173] Embodiment 29 is the plant of any one of embodiments 1-22, wherein the plant is knocked out for both GmFT5a and GmFT5b, and wherein the genetically modified plant flowers and / or matures 30-70 days later than the control plant under LD conditions.

[0174] Embodiment 30 is the plant of any one of embodiments 1-29, wherein the plant is a dicot.

[0175] Embodiment 31 is the plant of embodiment 30, wherein the dicot plant is a soybean plant, and optionally wherein the soybean plant is an elite soybean plant.

[0176] Embodiment 32 is a plant cell, seed, or plant part derived from the plant of any one of embodiments 9-31, wherein the plant cell, seed, or plant part expresses one or more of a mutant GmCOL2a polypeptide, a mutant GmCOL2b polypeptide, a mutant GmFT5a polypeptide, a mutant GmFT5b polypeptide, or a mutant GmFT4 polypeptide.

[0177] Embodiment 33 is a harvested product derived from the plant of any one of embodiments 9-31 or the plant cell, seed, or plant part of embodiment 32, wherein the harvested product expresses one or more of a mutant GmCOL2a polypeptide, a mutant GmCOL2b polypeptide, a mutant GmFT5a polypeptide, a mutant GmFT5b polypeptide, or a mutant GmFT4 polypeptide.

[0178] Embodiment 34 is a processed product derived from the harvested product of embodiment 33, wherein the altered flowering of the genetically modified plant comprises fewer days between the VE stage and the R1 stage of the modified plant relative to a control plant.

[0179] Embodiment 35 is a plant expressing both a mutant GmCOL2a polypeptide and a mutant GmCOL2b polypeptide, wherein the mutant GmCOL2a polypeptide comprises: (a) an amino acid sequence at least 85% identical to SEQ ID NO: 20, or (b) the amino acid sequence as shown in SEQ ID NO: 20, and wherein the mutant GmCOL2b polypeptide comprises an amino acid sequence at least 85% identical to SEQ ID NO: 26, or (b) the amino acid sequence as shown in SEQ ID NO: 26.

[0180] Embodiment 36 is a plant expressing both a mutant GmFT5a polypeptide and a mutant GmFT5b polypeptide, wherein the mutant GmFT5a polypeptide comprises: (a) an amino acid sequence that is at least 85% identical to SEQ ID NO:42, or (b) an amino acid sequence as shown in SEQ ID NO:42, and wherein the mutant GmFT5b polypeptide comprises an amino acid sequence that is at least 85% identical to SEQ ID NO:38, or (b) an amino acid sequence as shown in SEQ ID NO:38.

[0181] Embodiment 37 is a method of altering the flowering time and / or maturity time of a soybean plant, the method comprising editing one or more of the following genes in the genome of the soybean plant: GmCOL2a, GmCOL2b, GmFT5a, GmFT5b, or GmFT4, thereby forming a modified soybean plant, wherein the modified soybean plant has altered flowering time and / or maturity time relative to a control plant that does not comprise the edit in one or more of these genes.

[0182] Embodiment 38 is a method as described in embodiment 37, wherein the editing comprises knocking out the one or more genes, thereby producing the modified soybean plant expressing one or more of the following: a mutant GmCOL2a polypeptide, a mutant GmCOL2b polypeptide, a mutant GmFT5a polypeptide, a mutant GmFT5b polypeptide, or a mutant GmFT4 polypeptide.

[0183] Embodiment 39 is a method as described in embodiment 38, wherein the mutant GmCOL2a polypeptide, the mutant GmCOL2b polypeptide, the mutant GmFT5a polypeptide, the mutant GmFT5b polypeptide, or the mutant GmFT4 polypeptide shares less than 20% identity with the corresponding wild-type polypeptide.

[0184] Embodiment 40 is the method of embodiment 38 or 39, wherein the mutant GmCOL2a polypeptide, the mutant GmCOL2b polypeptide, the mutant GmFT5a polypeptide, the mutant GmFT5b polypeptide, or the mutant GmFT4 polypeptide is each a non-functional polypeptide.

[0185] Embodiment 41 is a method as described in embodiment 38 or 39, wherein the mutant GmCOL2a polypeptide comprises SEQ ID NO:20, the mutant GmCOL2b polypeptide comprises SEQ ID NO:26, the mutant GmFT5a polypeptide comprises SEQ ID NO:42, the mutant GmFT5b polypeptide comprises SEQ ID NO:38, or the mutant GmFT4 polypeptide comprises SEQ ID NO:30 or 32.

[0186] Embodiment 42 is the method of any one of embodiments 38-40, wherein the knockout of the GmCOL2a gene, the GmCOL2b gene, the GmFT5a gene, the GmFT5b gene, or the GmFT4 gene is performed by gene editing using a site-directed nuclease.

[0187] Embodiment 43 is the method of embodiment 42, wherein the site-directed nuclease is selected from the group consisting of a Cas 12 nuclease, a mega-nuclease, a zinc finger nuclease, or a transcription activator-like effector nuclease.

[0188] Embodiment 44 is a method as described in any one of embodiments 38-43, wherein the knockout of the GmCOL2a gene, the GmCOL2b gene, the GmFT5a gene, the GmFT5b gene, or the GmFT4 gene is performed using a Cas nuclease and a guide RNA, the guide RNA comprising a nucleotide sequence corresponding to a target sequence in one or more of the GmCOL2a gene, the GmCOL2b gene, the GmFT5a gene, the GmFT5b gene, or the GmFT4 gene, respectively.

[0189] Embodiment 45 is the method of embodiment 44, wherein the target sequence in the GmCOL2a gene comprises SEQ ID NO: 1.

[0190] Embodiment 46 is a method as described in embodiment 44 or 45, wherein the guide RNA for gene editing of the GmCOL2a gene is encoded by SEQ ID NO: 2 or 3.

[0191] Embodiment 47 is the method of embodiment 44, wherein the target sequence in the GmCOL2b gene comprises SEQ ID NO: 6.

[0192] Embodiment 48 is the method of embodiment 44 or 47, wherein the guide RNA for genetically modifying the GmCOL2b gene is encoded by SEQ ID NO: 7 or 8.

[0193] Embodiment 49 is the method of embodiment 44, wherein the target sequence in the GmFT5a gene comprises SEQ ID NO:49.

[0194] Embodiment 50 is a method as described in embodiment 44 or 49, wherein the guide RNA for gene editing the GmFT5a gene is encoded by SEQ ID NO:50 or 51.

[0195] Embodiment 51 is the method of embodiment 44, wherein the target sequence in the GmFT5b gene comprises SEQ ID NO:46.

[0196] Embodiment 52 is a method as described in embodiment 44 or 51, wherein the guide RNA used for gene editing the GmFT5b gene is encoded by SEQ ID NO:47 or 48.

[0197] Embodiment 53 is the method of embodiment 44, wherein the target sequence in the GmFT4 gene comprises SEQ ID NO: 43.

[0198] Embodiment 54 is a method as described in embodiment 44 or 53, wherein the guide RNA for gene editing of the GmFT4 gene is encoded by SEQ ID NO:44 or 45.

[0199] Embodiment 55 is the method of any one of embodiments 37-54, wherein the editing comprises knocking out one or more of GmCOL2a, GmCOL2b, or GmFT4, wherein the method further comprises detecting accelerated flowering and / or maturation of the modified soybean plant compared to control plants under LD conditions.

[0200] Embodiment 56 is the method of embodiment 55, wherein the LD conditions are 16 h light / 8 h dark over a 24 hour period.

[0201] Embodiment 57 is the method of embodiment 55, wherein the accelerated flowering and / or maturity is at least 2 days earlier, at least 4 days earlier, at least 5 days earlier, at least 6 days earlier, or at least 7 days earlier compared to control plants grown under LD conditions.

[0202] Embodiment 58 is a method as described in any of embodiments 37-54, wherein the editing comprises knocking out one or both of GmFT5a and GmFT5b, wherein the method further comprises detecting delayed flowering and / or maturity of the modified soybean plant compared to the control plant under LD conditions, wherein the detecting delayed flowering is based on counting the number of days between the VE stage and the R1 stage, and wherein the detecting delayed maturity is based on counting the number of days between the VE stage and the R7 stage.

[0203] Embodiment 59 is the method of embodiment 60, wherein the delayed flowering is at least 2 days later, at least 4 days later, at least 5 days later, at least 6 days later, or at least 7 days later compared to control plants grown under LD conditions.

[0204] Embodiment 60 is a modified soybean plant produced using the method of any one of embodiments 37-59.

[0205] Embodiment 61 is a plant cell, seed, or plant part derived from the modified soybean plant of embodiment 60.

[0206] Embodiment 62 is a breeding method comprising: crossing the plant of any one of embodiments 10-31 with a different plant that does not comprise the one or more mutant alleles; wherein both plants are soybean plants, and selecting progeny plants having altered flowering and / or maturity times.

[0207] Embodiment 63 is the method of embodiment 62, wherein the different plant is an elite soybean plant.

[0208] Embodiment 64 is a plant comprising a genomic modification resulting in reduced expression and / or activity of a polypeptide comprising: (a) an amino acid sequence at least 85%, 90%, 91%, 92%, 93%, 94, 95%, 96%, 97%, 98%, or 99% identity to at least one of SEQ ID NOs: 7, 23, 28, 36, or 40, or (b) an amino acid sequence as set forth in at least one of SEQ ID NOs: 17, 23, 28, 36, or 40, wherein the modification is heterologous to the plant, and the reduced expression and / or activity in the plant results in the plant having altered flowering and / or maturity time compared to a control plant not comprising the genomic modification, and wherein the genomic modification is introduced via genome editing.

[0209] Embodiment 65 is a modified soybean plant, or plant part thereof, comprising one or more non-naturally occurring mutant alleles at one or more genetic loci, wherein the non-naturally occurring mutant alleles are introduced via genomic modification using a site-directed nuclease, wherein the one or more genetic loci comprise GmFT4a, GmFT5a, GmFT5b, GmCOL2a, or GmCOL2b, and wherein the one or more mutant alleles result in altered flowering and / or maturity time in the plant relative to a control plant not comprising the mutant alleles.

[0210] Embodiment 66 is the modified soybean plant or plant part thereof of embodiment 65, wherein the non-naturally occurring mutant allele is a homozygous mutant allele.

[0211] Embodiment 67 is a modified soybean plant or plant part thereof as described in embodiment 65, wherein the modified soybean plant or plant part thereof comprises a non-naturally occurring mutant allele at each of the GmFT5a locus and the GmFT5b locus, wherein both of the loci comprise homozygous mutant alleles.

[0212] Embodiment 68 is the modified soybean plant or plant part thereof of embodiment 65, comprising a non-naturally occurring mutant allele at each of the GmCOL2a locus and the GmCOL2b locus, wherein both loci comprise homozygous mutant alleles.

[0213] Embodiment 69 is the modified soybean plant or plant part thereof of embodiment 65, comprising a non-naturally occurring homozygous mutant allele at the GmFT4a locus.

[0214] Embodiment 70 is a modified soybean plant or plant part thereof as described in any of embodiments 65-69, wherein the mutant allele exhibits a decrease in expression or activity relative to the unmodified wild-type gene allele, and wherein the mutant allele produces a modified soybean plant with the altered flowering and / or maturity time when grown under LD conditions.

[0215] Embodiment 71 is the modified soybean plant or plant part thereof of any one of embodiments 65-70, wherein the mutant allele produces a modified soybean plant having accelerated flowering and / or maturity relative to the control plant when grown under LD conditions.

[0216] Embodiment 72 is the modified soybean plant or plant part thereof of any one of embodiments 65-71, wherein at least one of the mutant alleles comprises a nonsense mutation, an in-frame deletion mutation, a missense mutation, a frameshift mutation, a splice site mutation, or any combination thereof.

[0217] Embodiment 73 is the modified soybean plant or plant part thereof of any of embodiments 65-72, wherein at least one of the mutant alleles encodes a protein truncation, a non-functional protein, a protein with reduced function relative to the protein expressed by the corresponding wild-type allele, and / or wherein at least one of the mutant alleles comprises a premature stop codon, a frameshift mutation, and an in-frame deletion relative to the corresponding wild-type allele. Examples

[0218] The provided methods and compositions are further described in the following examples, which do not limit the scope of the methods and compositions of matter described in the claims. Example 1. Targeted mutagenesis of GmCOL2a and GmCOL2b accelerates flowering in soybean 1.1 Design and construction of sgRNAs for gene editing vectors targeting GmCOL2a and GmCOL2b

[0219] In this study, the vector pUC57-SgRNA (SEQ ID NO: 13) was used for sgRNA construction and expression. The vector was linearized by restriction endonucleases NHeI and BbsI, and then cleaved using Zymoclean. TM A fragment of approximately 3201 bp was extracted using a gel DNA recovery kit (D4008).

[0220] The sequence and other information of the soybean endogenous gene GmCOL2a (Glyma.13G050300) were downloaded from the Phytozome website (phytozome-next.jgi.doe.gov / info / Gmax_Wm82_a2_v1). We used the web tool CRISPR-P (crispr.hzau.edu.cn / CRISPR / ) to design sgRNAs and selected the GmCOL2a target sequence, GmCOL2a-SP1: 5'-TTGGTGGCAGCACCGGCACCTGG-3' (SEQ ID NO: 1). We then synthesized primers GmCOL2a-Cas9-F: 5′-TCGAAGTAGTGATTGTTGGTGGCAGCACCGGCACCGTTTTAG AGCTAGAA-3′ (SEQ ID NO: 2) and GmCOL2a-Cas9-R: 5′-TTCTAGCTCTAAAACGGTGCCGGTGCTGCCACCAACAATCAC TACTTCGA-3′ (SEQ ID NO: 3) from TSINGKE Biotechnology Co., Ltd. (Beijing).

[0221] The sequence and other information of the soybean endogenous gene GmCOL2b (Glyma.19G039000) were downloaded from the Phytozome website (phytozome-next.jgi.doe.gov / info / Gmax_Wm82_a2_v1). We used the web tool CRISPR-P (http: / / crispr.hzau.edu.cn / CRISPR / ) to design sgRNA and selected the target sequence of GmCOL2b, GmCOL2b-SP1: 5'-GCAGCAACACTGGCACCACCTGG-3' (SEQ ID NO: 6). We then synthesized primers GmCOL2b-Cas9-F: 5′-TCGAAGTAGTGATTGGCAGCAACACTGGCACCACCGTTTTAG AGCTAGAA-3′ (SEQ ID NO: 7) and GmCOL2b-Cas9-R: 5′-TTCTAGCTCTAAAACGGTGGTGCCAGTGTTGCTGCCAATCACTACTTCGA-3′ (SEQ ID NO: 8) from Qingke Biotechnology Co., Ltd. (Beijing).

[0222] The DNA oligos were then annealed (10 μM GmCOL2a-Cas9-F / R per 5 μL of 15 μL ddH2O were thoroughly mixed). The mixture was then placed at 95°C for 3 min. Afterwards, the temperature was slowly cooled to 16°C at -1°C / 20 s to generate dimers, which were then integrated into the linearized pUC57-sgRNA vector using the ClonExpress Ultra One Step Cloning Kit (Vazyme, C115-01).

[0223] The ligation product from the last step was transformed into E. coli DH5α competent cells, then incubated on ice for 30 min, heat-shocked in a water bath at 42° C. for 90 s, and then incubated on ice for 2 min, 700 μL LB liquid medium (10 g / L tryptone, 5 g / L yeast extract, and 10 g / L NaCl) was added, and incubated at 37° C. for 1 h with shaking at 180 rpm. All bacteria were then spread on LB plates (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, and 15 g / L agar) with 100 mg / mL ampicillin, and incubated overnight at 37° C.

[0224] Some single clones were then sequenced by Qingke Biotechnology (Beijing) using primer pSgRNA-CX: 5'-CGCCAGGGTTTTCCCAGTCACGAC-3' (SEQ ID NO: 65). The subsequent constructs were purified using the TIANprep Rapid Mini Plasmid Kit (TIANGEN, DP103-200) for subsequent use.

[0225] Cas9 expression was performed using the vector PTF101-Cas9. The bar gene was used as a herbicide resistance marker in this vector. The two plasmids, PTF101-Cas9 and pUC57-sgRNA, containing the target sequence for GmCOL2a were then digested using PacI and PmeI. The two linearized fragments were then integrated using T4 DNA ligase.

[0226] The ligation product from the last step is transformed into Escherichia coli DH5a competent cells, and then smeared on LB plates with 50mg / mL spectinomycin and incubated overnight at 37°C. Primer pCas9-TYJC is then used by Qingke Biotechnology Co., Ltd. (Beijing) to sequence some monoclonal clones: 5'-TGGGAATCTGAAAGAAGAGAAGCA-3' (SEQ ID NO:66). Expected CRISPR / Cas9 expression vector is purified and transformed into Agrobacterium tumefaciens (Agrobacterium tumefaciens) bacterial strain EHA101 via electroporation, and then at 28°C, on LB plates with 50mg / L kanamycin, 50mg / L chloramphenicol, 50mg / L spectinomycin and 50mg / L rifampicin, incubated 48h.

[0227] Some monoclones were selected from the plate and inoculated into 1 mL LB liquid medium containing antibiotics, and then incubated at 28 ° C with shaking at 180 rpm for 14 h. Primers Cas9JC-F (5'-TTGGGGCTCACACCAAACTT-3') (SEQ ID NO: 11) and Cas9JC-R (5'-CGATCGCCTTCTTTTGCTCG-3') (SEQ ID NO: 12) were used to test bacterial liquid by PCR. The PCR cycle was as follows: 95 ° C 5 min; 94 ° C 30 s, 58 ° C 30 s, 72 ° C 1 min, 35 cycles; 72 ° C 10 min. The expected band was about 910 bp. These strains can then be used for soybean transformation. 1.2 Transformation of soybean with gene editing vectors encoding GmCOL2a and GmCOL2b

[0228] Smooth and plump soybean seeds were selected and surface sterilized using chlorine for 16-20 h. After sterilization, the seeds were incubated in germination medium containing 3.1 g / L Gamborg basal salt mixture, 20 g / L sucrose (pH 5.8) and 7 g / L agar at 28°C for one day.

[0229] Agrobacterium tumefaciens strain EHA101 containing the intended CRISPR / Cas9 vector for GmCOL2a was activated twice. Initially, the bacteria were brush-blotted onto the surface of an LB plate containing the appropriate antibiotics and incubated at 28°C for 48 h, then smeared onto a new solidified LB medium plate with the same antibiotics and incubated overnight at 28°C. Fresh Agrobacterium was collected by applicator and resuspended in liquid co-culture medium (2.165 g / L Murashige & Skoog basal salt mixture, 30 g / L sucrose, 3.9 g / L 2-(N-morpholino)ethanesulfonic acid (MES), 1 mL / L Gamborg vitamin solution, 2 mg / L trans-zeatin, 150 mg / L dithiothreitol (DTT), 40 mg / L acetosyringone (As), pH 5.4) until the OD 600 It is 0.6-0.8.

[0230] Explants were prepared from 1-day-old seedlings. Cotyledonary nodes were scratched and immersed in Agrobacterium tumefaciens for 2 h at 28 ° C. After inoculation, the cotyledons were placed in a solid co-culture medium (2.165 g / L Murashige & Skoog basal salt mixture, 30 g / L sucrose, 3.9 g / L MES, 7 g / L agar, 1 mL / L Gamborg vitamin solution, 2 mg / L trans-zeatin, 150 mg / L DTT, 40 mg / L As, pH 5.4) with a Whatman filter paper, and then incubated at 22 ° C in the dark for 5 days.

[0231] After co-cultivation, the explants were transferred to recovery medium (3.1 g / L Gamborg basal salt mixture, 0.98 g / L MES, 30 g / L sucrose, 7 g / L agar, 1 mL / L Gamborg vitamin solution, 150 mg / L cefotaxime, 450 mg / L timentin, 1 mg / L 6-benzylaminopurine, 12 mg / L ferrous sulfate, 30 mg / L ethylenediaminetetraacetic acid disodium salt, 50 mg / L L-glutamine, 50 mg / L L-asparagine, pH 5.7) and incubated at 28°C for 7 days.

[0232] After recovery, the explants were transferred to selection medium (3.1 g / L Gamborg basal salt mixture, 0.98 g / L MES, 30 g / L sucrose, 7 g / L agar, 1 mL / L Gamborg vitamin solution, 150 mg / L cefotaxime, 450 mg / L timentin, 1 mg / L 6-benzylaminopurine, 12 mg / L ferrous sulfate, 30 mg / L ethylenediaminetetraacetic acid disodium salt, 50 mg / L L-glutamine, 50 mg / L L-asparagine, 6 mg / L glufosinate, pH 5.7) and incubated at 28°C for 21 days.

[0233] After selection, cotyledons and brown leaves were cut from the explants, and the remaining tissue was transferred to a shoot elongation medium (4.0 g / L Murashige & Skoog basal salt mixture, 0.6 g / L MES, 30 g / L sucrose, 7 g / L agar, 1 mL / L Gamborg vitamin solution, 150 mg / L cefotaxime, 450 mg / L timentin, 0.1 mg / L indole-3-acetic acid (IAA), 0.5 mg / L gibberellin (GA), 1 mg / L trans-zeatin, 12 mg / L ferrous sulfate, 30 mg / L ethylenediaminetetraacetic acid disodium salt, 50 mg / L L-glutamine, 50 mg / L L-asparagine, and 6 mg / L glufosinate-ammonium, pH 5.7) and incubated at 28° C. until the elongated shoots grew to 5-8 cm in length. Simultaneously, the culture medium was replaced every 2 weeks.

[0234] Elongated shoots were cut from the bottom of the buds and the stems were immersed in 1 mg / L indole-3-butyric acid (IBA) for 1 min and then placed in rooting medium (2.165 g / L Murashige & Skoog basal salt mixture, 0.6 g / L MES, 20 g / L sucrose, 7 g / L agar, 1 mL / L Gamborg vitamin solution, 50 mg / L L-glutamine, 50 mg / L L-asparagine, 3 mg / L glufosinate, pH 5.7) and incubated for 7 days at 28° C. After root production, the plants were transferred to pots and grown in a greenhouse. 1.3 Screening for GmCOL2a mutations after gene editing

[0235] Genomic DNA was extracted from leaves of each individual plant in the T0 generation and then used The region spanning the target site was amplified by PCR using ultra-fidelity DNA polymerase (Novozyme Biotech) and the GmCOL2a forward primer (5′-AGGGATAACATGAGATTTTGACTGG-3′ (SEQ ID NO: 4)) and reverse primer (5′-CAGAGATCGGGAGAATGGGC-3′ (SEQ ID NO: 5)). Zymoclean TM The gel DNA recovery kit was purified and sequenced by Qingke Biotechnology Co., Ltd. (Beijing). Different types of gene editing can be identified by sequence peaks. Short base insertions or deletions (not multiples of three) induced by the gene editing machine can lead to frameshift mutations. Heterozygous mutations show overlapping peaks from the target site to the end. There are no overlapping peaks for wild-type and homozygous mutations at the target site. The homozygous mutant type is then identified by sequence alignment with the wild-type sequence. This method is also used in the T1 and T2 generations. In this study, we detected two types of homozygous mutations at the target site of GmCOL2a in the T1 generation ( Figure 1 One type of mutation is an 8-bp deletion (from nucleotide position 535 to nucleotide position 542 of SEQ ID NO: 15), which also produces an early flowering phenotype. Another type of mutation is a 398-bp deletion (from nucleotide position 182 to nucleotide position 579 of SEQ ID NO: 15). 1.4 Phenotype of GmCOL2a Mutants

[0236] To investigate whether GmCOL2a is involved in the regulation of photoperiodic flowering, wild-type (WT) plants and GmCOL2a mutants (398-bp deletion) were grown under long-day (LD, 16 h light / 8 h dark over a 24-hour period) and short-day (SD, 12 h light / 12 h dark over a 24-hour period) photoperiod conditions. The flowering time of each soybean plant was recorded as the number of days from seedling emergence to the R1 stage (the appearance of the first flower at any node in the main stem). For quantitative analysis of flowering time, at least 12 individual soybean plants were analyzed for each genotype. Statistical analysis was performed using Microsoft Excel. One-way analysis of variance with the least significant difference (LSD) test was used to compare the significance of differences between the control and treatment at a probability level of 0.01. Histograms were plotted using Graphpad Prism. Flowering time is shown as mean ± standard deviation. Under SD conditions, the flowering time of GmCOL2a mutant was almost the same as that of WT plants (22.31 ± 0.48 DAE for GmCOL2a mutant vs. 22.33 ± 0.65 DAE for WT) (Tables 8 and Figure 2In contrast, under LD conditions and compared to WT plants, the GmCOL2a mutant showed an approximately 5-day earlier flowering time (34.53 ± 0.52 DAE for the GmCOL2a mutant vs. 39.70 ± 1.80 DAE for the WT) (Tables 8 and Figure 2 These results indicate that CRISPR / Cas9-mediated targeted mutagenesis of GmCOL2a accelerates flowering in soybean under LD conditions. Table 8. Flowering time of WT plants and GmCOL2a mutants under SD and LD conditions. 2.1 Screening for GmCOL2b mutations after gene editing

[0237] Genomic DNA was extracted from leaves of each individual plant in the T0 generation and then used The region spanning the target site was amplified by PCR using high-fidelity DNA polymerase (Novozyme Biotech) and the GmCOL2b forward primer (5′-ACACGTGTCTCCAAGTTGTGT-3′ (SEQ ID NO: 9)) and reverse primer (5′-ACGCGTTTGTGATTGTGCTC-3′ (SEQ ID NO: 10)). Zymoclean TM The gel DNA recovery kit was purified and sequenced by Qingke Biotechnology Co., Ltd. (Beijing). Different types of gene editing can be identified by sequence peaks. Short base insertions or deletions (not multiples of three) induced by CRISPR / Cas9 can lead to frameshift mutations. Heterozygous mutations show overlapping peaks from the target site to the end. There are no overlapping peaks for wild-type and homozygous mutations at the target site. The homozygous mutant type is then identified by sequence alignment with the wild-type sequence. This method was also used in the T1 and T2 generations. In this study, we detected two types of homozygous mutations at the target site of GmCOL2b in the T1 generation ( Figure 3 One type of mutation was a 3-bp deletion (bp 546 to 548 of SEQ ID NO: 21). Another type of mutation was a 1-bp deletion (bp 548 of SEQ ID NO: 21). The mutant with the 1-bp deletion was used in subsequent experiments. 2.2 Phenotype of GmCol2b Mutants

[0238] The GmCOL2b mutant disclosed in this example is homozygous recessive for the corresponding mutant allele (i.e., 3-bp deletion or 1-bp deletion as described above). In order to verify whether GmCOL2b is involved in the regulation of photoperiod flowering, wild-type (WT) plants and Gmcol2b mutants (1-bp deletion) were grown under long-day (LD, 16h light / 8h dark in a 24-hour period) and short-day (SD, 12h light / 12h dark in a 24-hour period) photoperiod conditions. The flowering time of each soybean plant was recorded as the number of days from emergence to the R1 stage (the first flower appears at any node in the main stem). For quantitative analysis of flowering time, at least 12 individual soybean plants were analyzed for each genotype. Statistical analysis was performed using Microsoft Excel. One-way analysis of variance was used, and the least significant difference test (LSD) was used to compare the significance of the difference between the control and the treatment at a probability level of 0.01. Graphpad Prism was used to draw histograms. Flowering time is shown as mean ± standard deviation. Under SD conditions, the flowering time of Gmcol2b mutant was almost the same as that of WT plants (21.93 ± 0.27 DAE of Gmcol2b mutant vs. 22.33 ± 0.65 DAE of WT) ( Table 3 and Figure 4 In contrast, under LD conditions and compared to WT plants, the Gmcol2b mutant showed an approximately 7-day earlier flowering time (32.69 ± 0.85 DAE for the col2b mutant vs. 39.70 ± 1.80 DAE for the WT) (Tables 9 and Figure 4 These results indicate that CRISPR / Cas9-mediated targeted mutagenesis of GmCOL2b accelerates flowering in soybean under LD conditions. Table 9. Flowering time of WT plants and GmCOL2b mutants under SD and LD conditions. 3.1 Generation of GmCOL2a / GmCOL2b double mutants

[0239] To generate the Gmcol2a Gmcol2b double mutant, we used a T1 homozygous Gmcol2a mutant (398-bp deletion) as the male parent and a Gmcol2b mutant (1-bp deletion) as the female parent for hybridization. F2 plants were obtained by selfing. Genomic DNA was extracted from the leaves of each individual plant in the F2 generation and then cloned using The region spanning the GmCOL2a or GmCOL2b target site was amplified by PCR using ultra-fidelity DNA polymerase (Novozymes Biotech) and the GmCOL2a forward primer (5′-AGGGATAACATGAGATTTTGACTGG-3′ (SEQ ID NO: 4)), GmCOL2a reverse primer (5′-CAGAGATCGGGAGAATGGGC-3′ (SEQ ID NO: 5)), and the GmCOL2b forward primer (5′-ACACGTGTCTCCAAGTTGTGT-3′ (SEQ ID NO: 9)), GmCOL2b reverse primer (5′-ACGCGTTTGTGATTGTGCTC-3′ (SEQ ID NO: 10)) using Zymoclean. TM The DNA was purified using a gel DNA recovery kit and sequenced by Qingke Biotechnology Co., Ltd. (Beijing). Homozygous Gmcol2a Gmcol2b double mutants were used in subsequent experiments. 3.2 Phenotype of the GmCOL2a GmCOL2b double mutant

[0240] Wild-type (WT) plants and Gmcol2a Gmcol2b double mutants were grown under long-day (LD, 16h light / 8h darkness) and short-day (SD, 12h light / 12h darkness) photoperiod conditions. The flowering time of each soybean plant was recorded as the number of days from emergence to the R1 stage (first flower appears at any node in the main stem). For the quantitative analysis of flowering time, at least 12 individual soybean plants were analyzed for each genotype. Statistical analysis was performed using Microsoft Excel. One-way ANOVA was used, and the least significant difference test (LSD) was used to compare the significance of the difference between the control and the treatment at a 0.01 probability level. Graphpad prism was used to draw a histogram. Flowering time was shown as mean ± standard deviation. Under SD conditions, the flowering time of the Gmcol2a Gmcol2b double mutant was almost the same as that of the WT plants (21.92 ± 0.67 DAE of the Gmcol2a Gmcol2b double mutant vs. 22.33 ± 0.65 DAE of the WT) (Tables 10 and Figure 5 In contrast, under LD conditions and compared to WT plants, the Gmcol2a Gmcol2b double mutant showed an approximately 17-day earlier flowering time (22.69 ± 0.95 DAE for the Gmcol2a Gmcol2b double mutant vs. 39.70 ± 1.80 DAE for the WT) (Tables 10 and Figure 5 These results indicate that the Gmcol2a Gmcol2b double mutant exhibits a significant early flowering phenotype under LD conditions. Table 10. Flowering time of WT plants and GmCOL2a GmCOL2b double mutants under SD and LD conditions. Example 2. Targeted mutagenesis of GmFT4 accelerates flowering in soybean 1: Generation of Gmft4 mutant plants 1.1 Design and construction of sgRNA for gene editing vectors

[0241] (1) The genomic sequence of soybean GmFT4 (SEQ ID NO: 27) was obtained from the Phytozome database. GmFT4 is located on chromosome 8. CRISPR-P (cbi.hzau.edu.cn / cgi-bin / CRISPR) was used. An online web tool was used to select the target site sequence of GmFT4 sgRNA. The target is located in the first exon region of GmFT4, and the target sequence is 5'-CTTGTTCTTGGACGTATAATAGG-3' (SEQ ID NO: 43) (SEQ ID NO: 27, positions 64-86).

[0242] Target primers for sgRNA were synthesized and integrated into the CRISPR / Cas9 vector (ViewSolid Biotec, VK005-15, Beijing), and the primer sequences were: GmFT4-F: 5′-TTGCTTGTTCTTGGACGTATAAT-3′ (SEQ ID NO: 44) and GmFT4-R: 5′-AACATTATACGTCCAAGAACAAG-3′ (SEQ ID NO: 45).

[0243] The DNA oligos were then annealed (5 μL of 10 μM GmFT4-Cas9-F / R was thoroughly mixed with 15 μL of ddH2O). The mixture was then incubated at 95°C for 3 minutes. The mixture was then slowly cooled to 16°C at a rate of -1°C / 20 seconds to generate dimers, which were then incorporated into a Cas9 / gRNA vector containing a Cas9 protein expression unit (Weishanglide Biotechnology Co., Ltd., VK005-15, Beijing) to obtain the recombinant Cas9 sgRNA vector.

[0244] The prepared recombinant vector Cas9 sgRNA was transferred into Escherichia coli DH5α and then incubated overnight on an LB plate containing 50 mg / L kanamycin at 37° C. Monoclonal antibodies were extracted and sequenced.

[0245] Using sequencing primer SQ: TGAAGTGGACGGAAGGAGGAGG AGG (SEQ ID NO: 67), the plasmid with the correct insertion was identified and named CRISPR / Cas9-GmFT4.

[0246] The recombinant plasmid CRISPR / Cas9-GmFT4 was transformed into Agrobacterium tumefaciens EHA105 by electroporation. The plasmid was extracted and sequenced, and the correct recombinant strain named CRISPR / Cas9-GmFT4 was verified by sequencing. The PCR reaction system is as follows: 2×Taq master mix, 12.5 μL; bacterial solution, 1 μL; Cas9-F (10 pmol / μL), 1 μL; Cas9-R (10 pmol / μL), 1 μL; ddH2O 9.5 μL, total volume 25 μL. The PCR reaction settings are as follows: 94°C for 3 min; 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s for 35 cycles; and a final extension of 10 min at 72°C. The expected band is approximately 910 bp. These strains can then be used for soybean transformation. 1.2 Transformation of soybean with the intended gene editing vector for GmFT4

[0247] Transformation of soybean with the intended gene-editing vector for GmFT4 was performed essentially as described in Example 1, Section 1.2. 1.3 Screening for GmFT4 mutations induced by the CRISPR / Cas9 system

[0248] Genomic DNA was extracted from leaves of each individual plant in the T0 generation and then used The region spanning the target site was amplified by PCR using high-fidelity DNA polymerase (Novozyme Biotech) and the GmFT4 forward primer (5′-TCACACGCGCAAGAACGTAT-3′ (SEQ ID NO: 68)) and reverse primer (5′-CTAGGAGCATCGGGGTTCAC-3′ (SEQ ID NO: 69)). Zymoclean TMThe gel DNA recovery kit was used for purification and sequencing by Qingke Biotechnology Co., Ltd. (Beijing). The 470bp PCR product was sequenced and confirmed by alignment with the WT sequence. The PCR reaction system was as follows: 2×Taq master mix, 12.5μL; DNA (200ng / μL), 1μL; GmFT4 forward primer (10pmol / μL), 1μL; GmFT4 reverse primer (10pmol / μL), 1μL; ddH2O 9.5μL, total volume 25μL. The PCR reaction was set as follows: 94℃ for 3min; 94℃ for 30s, 54℃ for 30s, and 72℃ for 1min for 35 cycles; and a final extension at 72℃ for 10min. All PCR products were sequenced by GmFT4 forward primer 5'-TCACACGCGCAAGAACGTAT-3' (SEQ ID NO: 68). Different types of gene editing can be identified by sequence peaks.

[0249] Short base insertions or deletions induced by CRISPR / Cas9 result in frameshift mutations. Heterozygous mutations show overlapping peaks from the target site to the terminus. Wild-type and homozygous mutations have no overlapping peaks at the target site. Homozygous mutant types are then identified by sequence alignment with the wild-type sequence. This method has also been used in T1 and T2 generations.

[0250] The mutation types of the GmFT4 gene in the mutant plants include two mutations: type 1 and type 2. Both mutation types lead to premature termination of protein translation and encode polypeptides having the amino acid sequences of SEQ ID NO: 30 and SEQ ID NO: 32, respectively.

[0251] Mutant type 1 comprises a 5-bp deletion from nucleotide position 76 to nucleotide position 80 of the polynucleotide having the nucleic acid sequence of SEQ ID NO: 27 (other nucleotides remain unchanged). The CDS sequence of GmFT4 in the Gmft4 mutant type (5-bp deletion) is shown in SEQ ID NO: 57.

[0252] Mutant type 2 comprises a 1-bp insertion of T between nucleotide position 80 and nucleotide position 81 of the polypeptide having the nucleic acid sequence of SEQ ID NO: 27 (the other nucleotides remain unchanged). The CDS sequence of GmFT4 in the Gmft4 mutant (1-bp insertion) is shown in SEQ ID NO: 58.

[0253] The T1 transgenic GmFT4 soybean mutant plants having various GmFT4 gene mutation types were continuously grown until T2, and after harvest, seeds of T3 transgenic GmFT4 soybean (Gmft4 homozygous mutant) were harvested. Identification of flowering and maturation of 1.4Gmft4 mutations

[0254] Materials: soybean Jack (WT), T3 transgenic GmFT4 mutant soybean homozygous lines Gmft4-73, Gmft4-81 and Gmft4-122.

[0255] Methods: Each study period was conducted according to the standard recording method for soybean growth stages proposed by Fehr et al. (Fehr et al., November 1, 1971, Crop Science, available at doi.org / 10.2135 / cropsci1971.0011183X001100060051x). The standards for each period are shown in Table 2. This experiment required studying the emergence stage (VE, cotyledon emergence) and the first flowering stage (R1 stage, the time of first flowering, the presence of open flowers at any node on the soybean main stem). Materials were grown in an artificial growth chamber under long-day (LD, 16 h light, 30°C / 8 h dark, 22°C) and short-day (SD, 12 h light, 30°C / 12 h dark, 22°C) conditions. Flowering time for each soybean plant was recorded as the number of days from seedling emergence (VE) to the R1 stage (time when the first flower appears at any node on the main stem), and maturity time was recorded from VE to R7 (time when the first pod on the main stem reaches mature color) according to Fehr and Caviness, 1977.

[0256] Under SD conditions, the R1 of the two Gmft4 mutant types were 23.7±2.0d (type 1) and 23.3±1.1d (type 2), respectively, which were not significantly different from WT (23.7±2.1d) (p>0.05, Table 11); the R7 of the two Gmft4 mutant types were 64.9±2.2d and 62.0±1.7d, respectively, which were 2.9-5.8d earlier than WT (67.8±2.5d) (p<0.05, Table 10), indicating that GmFT4 did not affect flowering date but accelerated post-flowering growth under SD conditions. There were no significant differences in plant height and node number between the wild type and mutant types (p>0.05); when compared with the seed number of WT (33.6±5.3), the two mutant types were 25.9±2.9 (p<0.05) and 32.1±2.1 (p>0.05), indicating that type 1 may affect seed number, but type 2 maintains similar yield potential to WT.

[0257] Under LD conditions, the R1 of the two Gmft4 mutants was 40.6 ± 1.5 d (type 1) and 40.6 ± 2.1 d (type 2), respectively, and was about 3 days earlier than the WT (44.1 ± 2.8 d) (p < 0.05, Table 12); the R7 of the two Gmft4 mutants was 132.7 ± 3.8 d and 136.0 ± 3.5 d, respectively, 5.0-8.3 d earlier than the WT (141.0 ± 3.5 d) (p < 0.05, Table 12), indicating that GmFT4 promotes both flowering and post-flowering maturation under LD conditions. There was no significant difference in plant height and number of nodes between the wild type and the mutants (p > 0.05); the number of pods and seeds was slightly reduced compared to the WT (p > 0.05), indicating that the mutants of GmFT4 accelerated maturation without a significant reduction in pod or seed number. Table 11. Phenotypic statistics of Gmft4 mutants under SD conditions Note: SD: 12h light / 12h dark Table 12. Phenotypic statistics of Gmft4 mutants under LD conditions Note: LD: 16h light / 8h dark in 24 hours Example 3. Targeted mutagenesis of GmFT5a and GmFT5b alters flowering time in soybean 1. Generation of Gmft5b Mutant Plants 1.1 Design and construction of sgRNA for gene editing vectors

[0258] A CRISPR / Cas9 vector (VK005-15, Weishanglide Biotechnology Co., Ltd., Beijing) was used for sgRNA construction and expression. The Cas9 sequence was codon-optimized for dicots and assembled with a custom sgRNA driven by the Arabidopsis U6 promoter (SEQ ID NO: 34) downstream of the CaMV 2×35S promoter. The bar gene driven by the CaMV 35S promoter was used as a selection marker.

[0259] The genomic sequence of GmFT5b was obtained from the Phytozome database based on the Glyma.19G108200 gene located on chromosome 19. The target site (GmFT5b-TS) of GmFT5b was designed by CRISPR-P software (cbi.hzau.edu.cn / cgi-bin / CRISPR). The sequence of GmFT5b-TS is 5'-GGAGAACCCTCTTGTTATTGGGG-3' (SEQ ID NO: 46), which is located on the first exon (from 34 to 56 of SEQ ID NO: 54) ( Figure 7 ).

[0260] To obtain the CRISPR / Cas9-GmFT5b vector, the GmFT5b-sense primer: 5'-TTGGGAGAACCCTCT TGTTATTG-3' (SEQ ID NO: 47) and the GmFT5b-antisense primer: 5'-AACCAATAA CAAGAGGGTTCTCC-3' (SEQ ID NO: 48) were synthesized by Qingke Biotechnology Co., Ltd. (Beijing).

[0261] To generate GmFT5b dimers, the reaction system was as follows: GmFT5b-sense, 5 μL; GmFT5b-antisense, 5 μL; ddH2O, 15 μL; total volume, 25 μL; 95°C for 3 min and naturally cooled to 25°C. The dimers were then integrated into the CRISPR / Cas9 vector.

[0262] The GmFT5b dimer chain was subcloned into the CRISPR / Cas9 vector with the help of T4 DNA ligase. The reaction system was as follows: CRISPR / Cas9 vector, 1 μL; GmFT5b dimer, 1 μL; Solution 1, 1 μL; Solution 2, 1 μL; ddH2O, 6 μL; total volume, 10 μL; incubate at 16°C for 2 h.

[0263] The ligation product was transformed into E. coli DH5α competent cells, then incubated on ice for 30 min, heat-shocked at 42° C. for 90 s in a water bath, and then incubated on ice for 2 min, 700 μL LB liquid medium (10 g / L tryptone, 5 g / L yeast extract, and 10 g / L NaCl) was added, and incubated at 37° C. with shaking at 180 rpm for 1 h. All bacteria were then spread on LB plates (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, and 15 g / L agar) with 50 mg / L kanamycin, and incubated overnight at 37° C.

[0264] The recombinant vector was named CRISPR / Cas9-GmFT5b. Monoclonal clones were confirmed by sequencing (Qingke Biotechnology, Beijing) using the following primer sqprimer: 5'-GATGAAGTGGACGGAAGGAAGGAG-3' (SEQ ID NO: 70). The subsequent construct was purified using the TIANprep Rapid Mini Plasmid Kit (TIANGEN Biotechnology, DP103-200) for subsequent use.

[0265] The CRISPR / Cas9-GmFT5b plasmid was transformed into the Agrobacterium tumefaciens EHA105 strain via electroporation and then incubated on an LB plate with 50 mg / L kanamycin and 50 mg / L rifampicin at 28°C for 48 h. The EHA105 monoclone was verified by PCR and sequencing using primers (Cas9JC-F 5'-TTGGGGCTCACACCAAACTT-3' (SEQ ID NO: 11); Cas9JC-R 5'-CGATCGCCTTCTTTTGCTCG-3' (SEQ ID NO: 12)). The PCR reaction system was as follows: 2×Taq master mix, 12.5 μL; bacterial solution, 1 μL; Cas9-F (10 pmol / μL), 1 μL; Cas9-R (10 pmol / μL), 1 μL; ddH2O 9.5 μL, total volume 25 μL. The PCR reaction settings were as follows: 94°C for 3 min; 35 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 1 min; and a final extension at 72°C for 10 min. The expected band was approximately 910 bp. The EHA105 single clone carrying the CRISPR / Cas9-GmFT5b plasmid was used for soybean transformation. 1.2 Transformation of soybean with CRISPR / Cas9-GmFT5b Plant materials

[0266] Transformation of soybean was performed as described in Chen, L. et al. (2018) Improvement of soybean Agrobacterium-mediated transformation efficiency by adding glutamine and asparagine to the culture media, International Journal of Molecular Sciences, 19(10):3039. Soybean cultivar Jack was used for Agrobacterium-mediated transformation. Healthy seeds were surface sterilized by exposure to chlorine gas for 16 h. Sterilized seeds were placed in germination medium (GCM) containing 3.1 g / L Gamborgs basal salt mixture (Phytotech, G768, Lenexa, KS, USA), 20 g / L sugar, 1 mL / L Gamborgs vitamin solution (Phytotech, G219, Lenexa, KS, USA) and 7 g / L agar (Sigma, St. Louis, MO, USA), pH 5.8, and the seeds were germinated at 25°C under light for 18-20 h. 1.2.2. Agrobacterium strains and vectors

[0267] Agrobacterium tumefaciens EHA105 was used in the experiment. The CRISPR / Cas9 vector (Weishanglide Biotechnology Co., Ltd., VK005-15, Beijing) carries T-DNA, and the bar gene serves as a herbicide resistance marker. 1.2.3. Agrobacterium preparations

[0268] The Agrobacterium strain stock solution of EHA105 stored at-80 ℃ is streaked on the solidification YEP culture medium plate containing 5g / L NaCl, 10g / L tryptone, 5g / L yeast extract and 15g / L agar and 50mg / L kanamycin and 50mg / L rifampicin.The plate with Agrobacterium streaking is hatched at 28 ℃ for about 2 days, until bacterium colony formation.Bacterium colonies are collected by applicator, smeared on the new solidification YEP culture medium plate with identical antibiotic and incubated overnight at 28 ℃. Fresh Agrobacterium was resuspended in liquid co-culture medium (LCCM) containing 1 / 2 Murashige & Skoog basal salt mixture (Phytotech, M524, Lenexa, KS, USA), 3.9 g / L MES, 30 g / L sucrose, 1 mL / L Gamborgs vitamin solution, 150 mg / L DTT, 2 mg / L zeatin and 40 mg / L As (pH 5.4). The OD of Agrobacterium strains was 0.05. 600 It is 0.6-0.8. 1.2.4. Infection and co-cultivation

[0269] Explant is prepared by 1 day old seedling.Carry out longitudinal cutting to separate cotyledon and remove seed coat along the hilum.Excision is found in the hypocotyl and the juncture of cotyledon hypocotyl and obtain half seed explant.Explant cutting is immersed in Agrobacterium 2h under 50rpm.After inoculation, each in 9 cotyledons is placed in the solid co-culture medium (CCM) containing 1 / 2Murashige&Skoog basal salt mixture, 3.9g / L MES, 30g / L sucrose, 1mL / L Gamborgs vitamin solution, 150mg / L DTT, 40mg / L As, 2mg / L zeatin, 7g / L agar (pH 5.4) with a Whatman filter paper, and then hatched in the dark again at 22 ℃ for 5 days. 1.2.5. Recovery culture and selection culture

[0270] After co-cultivation, the explants were then transferred to recovery medium (SIM0) containing 3.1 g / L Garmborgs basal salt mixture, 0.98 g / L Garmborgs ES, 30 g / L sucrose, 1 mL / L Garmborgs vitamin solution, 150 mg / L cefotaxime, 450 mg / L timentin, 1 mg / L 6-benzylaminopurine (6-BA), and 7 g / L agar (pH 5.7) and incubated at 28°C for 7 days. Seven days after recovery, the explants were transferred to selection medium (SIM6) containing 3.1 g / L Gamborgs basal salt mixture, 0.98 g / L MES, 30 g / L sucrose, 1 mL / L Gamborgs vitamin solution, 150 mg / L cefotaxime, 450 mg / L timentin, 1 mg / L 6-BA, 7 g / L agar, and 6 mg / L glufosinate (pH 5.7) and incubated at 28°C for 21 days. 1.2.6. Shoot elongation and rooting

[0271] After selection culture, cotyledons and brown leaves were cut from the explants, and the remaining tissue was transferred to shoot elongation medium (SEM) containing 4.0 g / L Murashige & Skoog basal salt mixture, 0.6 g / L MES, 30 g / L sucrose, 1 mL / L Gamborgs vitamin solution, 150 mg / L cefotaxime, 450 mg / L timentin, 0.1 mg / L IAA, 0.5 mg / L GA, 1 mg / L zeatin, 7 g / L agar, and 6 mg / L glufosinate (pH 5.6) and incubated at 28° C. The medium was changed every two weeks. While replacing the SEM, elongated shoots (5-8 cm) were cut from the bottom of the bud buds and the stems were immersed in 1 mg / L IBA for 1 min, placed in rooting medium (RCM) containing 1 / 2 Murashige & Skoog basal salt mixture, 0.6 g / L MES, 20 g / L sucrose, 1 mL / L Gamborgs vitamin solution, and 7 g / L agar, 3 mg / L glufosinate (pH 5.7) and incubated at 28° C. for 7 days. After root production, the plants were transferred to pots and grown in a greenhouse. 1.3 Screening of GmFT5b mutant plants by sequencing analysis

[0272] We then screened 33 independent T0 transgenic Gmft5b mutant lines by PCR and Sanger sequencing. To generate Gmft5b mutant plants, we amplified the GmFT5b fragment using primers GmFT5b-661-F / R (GmFT5b-661-F: 5'-TTGACCATGCACCAAGGGAA-3' (SEQ ID NO: 71); GmFT5b-661-R: 5'-CAAGACAG GGTTGCTAGGGC-3' (SEQ ID NO: 72)). The 661-bp PCR product was sequenced and confirmed by alignment with the WT sequence. The PCR reaction system was as follows: 2× Taq master mix, 12.5 μL; DNA (200 ng / μL), 1 μL; GmFT5b-661-F (10 pmol / μL), 1 μL; GmFT5b-661-R (10 pmol / μL), 1 μL; ddH2O 9.5 μL, for a total volume of 25 μL. The PCR reaction settings were as follows: 94°C for 3 min; 35 cycles of 94°C for 30 s, 54°C for 30 s, and 72°C for 1 min; and a final extension at 72°C for 10 min. All PCR products were sequenced by GmFT5b-661-R: 5'-CAAGACAGGGTTGCTAGGGC-3' (SEQ ID NO: 72). Finally, a homozygous "null transgene" Gmft5b mutant carrying a frameshift mutation was obtained in the T1 generation. The Gmft5b mutant has an 8-bp deletion (SEQ ID NO: 55 and SEQ ID NO: 37), which generates a frameshift-induced premature stop codon in GmFT5b (SEQ ID NO: 38). All progeny of the homozygous Gmft5b mutant were "null transgene" homozygous Gmft5b mutants, as confirmed by libertylink strips. 1.4. Soybean Growth Conditions

[0273] In March 2021, wild-type (WT) and Gmft5b mutant plants were grown and evaluated under short-day (SD; 12 h light and 12 h dark, 22°C-30°C) and long-day (LD; 16 h light and 8 h dark, 22°C-30°C) conditions. The red to blue quantum (R:B) ratio of the light was 5.17. Details of the light used are: Model value Lux 11068lx CCT 3190K PPFD <![CDATA[299.72μmol / m 2 s]]> PPF-UV <![CDATA[0.40μmol / m 2 s]]> PPF-B <![CDATA[38.42μmol / m 2 s]]> PPF-G <![CDATA[62.21μmol / m 2 s]]> PPF-R <![CDATA[198.75μmol / m 2 s]]> PPF-NIR <![CDATA[48.68μmol / m 2 s]]> 1.5 Phenotyping and statistical analysis

[0274] Flowering time was evaluated as described by Fehr et al. (1971). Briefly, flowering time for each soybean plant was recorded as the number of days from emergence to the R1 stage (one flower at any node), and physiological maturity was recorded as the number of days from emergence to the R7 stage (any pod matured). Plant height was measured from the cotyledonary node to the stem tip. The cotyledonary node was counted as the first node. We also counted the number of pods and seeds per plant. Statistical analysis was performed using Microsoft Excel. Significant differences were determined by one-way ANOVA. These data are presented as mean ± one standard deviation. 1.6 Phenotypes of Gmft5b mutant plants under different photoperiod conditions

[0275] Under SD conditions, the average flowering time of Gmft5b mutant plants (26.3 ± 0.84 DAE) was not significantly different from that of WT plants (26.6 ± 0.96 DAE). Figure 8 ). In addition, the average R7 (onset of maturity) time of Gmft5b mutant plants was 70.6±2.7 DAE, which was not significantly different from WT (71.7±8.0 DAE). In addition, the average plant height of Gmft5b mutant plants (46.7±6.5 cm) was not significantly different from that of WT plants (48.5±11.3 cm). The average number of nodes of Gmft5b mutant plants (6.3±0.76) was not significantly different from that of WT plants (6.4±0.7). Figure 8 , Table 13). Table 13. Phenotypes of WT and Gmft5b plants under SD conditions. plant R1 (flowering) (d) R7(mature)(d) Plant height (cm) Number of sections Gmft5b 26.3±0.84 70.6±2.7 46.7±6.5 6.3±0.76 WT 26.6±0.96 71.7±8.0 48.5±11.3 6.4±0.7

[0276] Under LD conditions, the average flowering time of Gmft5b mutants was significantly later than that of WT plants (47.8 ± 1.8 vs. 44.8 ± 1.6 DAE, respectively) ( Figure 9 ). In addition, the average R7 time of Gmft5b mutant plants was 151.4±4.7DAE, which was significantly later than that of WT (146.5±3.9DAE). In addition, the average plant height of Gmft5b mutant plants (231.9±26.7 cm) was not significantly different from that of WT plants (221.5±19.8 cm). The average number of nodes of Gmft5b mutant plants (23.0±2.6) was not significantly different from that of WT plants (22.6±2.5). Figure 9 , Table 14). One-way ANOVA was used for statistical analysis. These observations strongly suggest that loss of Gmft5b function leads to delayed flowering in soybean under LD conditions, but not under SD conditions. Table 14. Phenotypes of WT and Gmft5b plants under LD conditions. plant R1 (flowering) (d) R7(mature)(d) Plant height (cm) Number of sections Gmft5b 47.8±1.8** 151.4±4.7** 231.9±26.7 23.0±2.6 WT 44.8±1.6 146.5±3.9 221.5±19.8 22.6±2.5 ** indicates p < 0.01. 2. Generation of Gmft5a Mutant Plants 2.1 Design and construction of sgRNA for CRISPR / Cas9 expression vector

[0277] A CRISPR / Cas9 vector (VK005-15, Weishanglide Biotechnology Co., Ltd., Beijing) was used for sgRNA construction and expression. The Cas9 sequence was codon-optimized for dicots and assembled with a custom sgRNA driven by the Arabidopsis U6 promoter (SEQ ID NO: 34) downstream of the CaMV 2×35S promoter. The bar gene driven by the CaMV 35S promoter was used as a selection marker.

[0278] The genomic sequence of GmFT5a was obtained from the Phytozome database based on the Glyma.16G044100 gene located on chromosome 16. The target site (GmFT5a-TS) of GmFT5a was designed by CRISPR-P software (cbi.hzau.edu.cn / cgi-bin / CRISPR). The sequence of GmFT5a-TS is 5'-AAAGTAAATAATCATGGCACGGG-3' (SEQ ID NO: 49), which is located on the first exon of GmFT5a (from 36 to 58 of SEQ ID NO: 52) ( Figure 10 ).

[0279] To obtain the CRISPR / Cas9-GmFT5a vector, the primers for GmFT5a-TS (GmFT5a-sense primer: 5′-TTGAAAGTAAATAATCATGGCAC-3′ (SEQ ID NO: 50); GmFT5a-antisense primer: 5′-AACGTGCCAT GATTATTTACTTT-3′ (SEQ ID NO: 51)) were synthesized by Qingke Biotechnology Co., Ltd. (Beijing).

[0280] To generate GmFT5a dimer chains, the reaction system was as follows: GmFT5a-sense, 5 μL; GmFT5a-antisense, 5 μL; ddH2O, 15 μL; total volume, 25 μL; 95°C for 3 min and naturally cooled to 25°C. The dimer was then incorporated into the CRISPR / Cas9 vector.

[0281] The GmFT5a dimer chain was subcloned into the CRISPR / Cas9 vector with the help of T4 ligase. The reaction system was as follows: CRISPR / Cas9 vector, 1 μL; GmFT5a dimer chain, 1 μL; Solution 1, 1 μL; Solution 2, 1 μL; ddH2O, 6 μL; total volume, 10 μL; incubate at 16°C for 2 hours.

[0282] The ligation product was transformed into E. coli DH5α competent cells, then incubated on ice for 30 min, heat-shocked at 42° C. for 90 s in a metal bath or water bath, and then incubated on ice for 2 min, 700 μL LB liquid medium (10 g / L tryptone, 5 g / L yeast extract, and 10 g / L NaCl) was added, and incubated at 37° C. for 1 h with shaking at 180 rpm. All bacteria were then spread on LB plates (10 g / L tryptone, 5 g / L yeast extract, 10 g / L NaCl, and 15 g / L agar) with 50 mg / mL kanamycin, and incubated overnight at 37° C.

[0283] The recombinant vector was named CRISPR / Cas9-GmFT5a. Some single clones were confirmed by sequencing (Qingke Biotechnology Co., Ltd., Beijing) using the following primer sqprimer: 5'-GATGAAGTGGACGGAAGGAAGGAG-3' (SEQ ID NO: 70). The subsequent construct was purified using the TIANprep Rapid Mini Plasmid Kit (TIANGEN Biotechnology Co., Ltd., DP103-200) for subsequent use.

[0284] The CRISPR / Cas9-GmFT5a plasmid was transformed into the Agrobacterium tumefaciens EHA105 strain via electroporation and then incubated on an LB plate with 50 mg / L kanamycin and 50 mg / L rifampicin at 28°C for 48 h. The EHA105 monoclone was verified by PCR and sequencing using primers (Cas9JC-F 5'-TTGGGGCTCACACCAAACTT-3' (SEQ ID NO: 11); Cas9JC-R 5'-CGATCGCCTTCTTTTGCTCG-3' (SEQ ID NO: 12)). The PCR reaction system was as follows: 2×Taq master mix, 12.5 μL; bacterial solution, 1 μL; Cas9-F (10 pmol / μL), 1 μL; Cas9-R (10 pmol / μL), 1 μL; ddH2O 9.5 μL, total volume 25 μL. The PCR reaction settings were as follows: 94°C for 3 min; 35 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 1 min; and a final extension at 72°C for 10 min. The expected band was approximately 910 bp. The EHA105 clone carrying the CRISPR / Cas9-GmFT5a plasmid was used for soybean transformation. 2.2 Transformation of soybean with CRISPR / Cas9-GmFT5a

[0285] CRISPR / Cas9-GmFT5a was transformed into soybean using the materials and methods described in Section 1.1 of this Example. 2.3 Screening of Gmft5a mutant plants by sequencing analysis

[0286] We screened T0 transgenic Gmft5a mutant lines by PCR and Sanger sequencing. To generate Gmft5a mutant plants, we amplified the GmFT5a fragment using primers GmFT5a-616-F / R (GmFT5a-616-F: 5'-ATCGACCGATCGAGGACAAC-3' (SEQ ID NO: 73); GmFT5a-616-R: 5'-TGGGAGACTACAGAAGCAAAGA-3' (SEQ ID NO: 74)). The 616-bp PCR product was sequenced and confirmed by alignment with the WT sequence. The PCR reaction system was as follows: 2× Taq master mix, 12.5 μL; DNA (200 ng / μL), 1 μL; GmFT5a-616-F (10 pmol / μL), 1 μL; GmFT5a-616-R (10 pmol / μL), 1 μL; ddH2O 9.5 μL, for a total volume of 25 μL. The PCR reaction settings were as follows: 94°C for 3 min; 35 cycles of 94°C for 30 s, 54°C for 30 s, and 72°C for 1 min; and a final extension at 72°C for 10 min. Finally, a homozygous Gmft5a mutant carrying a frameshift mutation was obtained in the T1 generation. The Gmft5a mutant had a 1-bp insertion (SEQ ID NO:41 and SEQ ID NO:53), which resulted in a frameshift-induced premature stop codon (SEQ ID NO:42) in Gmft5a. All offspring of homozygous Gmft5a mutants were “transgene-free” homozygous Gmft5a mutants. 2.4 Soybean materials and growth conditions

[0287] In March 2021, wild-type (WT) and Gmft5a mutant plants were grown and evaluated under short-day (SD; 12 h light and 12 h dark, 22°C-30°C) and long-day (LD; 16 h light and 8 h dark, 22°C-30°C) conditions. The red to blue quantum (R:B) ratio of the light was 5.17. The same lighting as described in Section 1.4 of this example was used. 2.5 Phenotypes of Gmft5a mutant plants under different photoperiod conditions

[0288] Under SD conditions, the average flowering time of Gmft5a mutant plants (26.1±1.1 DAE) was not significantly different from that of WT (26.6±0.96 DAE). In addition, the average R7 time of Gmft5a mutant plants was 72.1±7.3 DAE, which was not significantly different from that of WT (71.7±8.0 DAE). In addition, the average plant height of Gmft5a mutant plants (47.3±6.3 cm) was not significantly different from that of WT plants (48.5±11.3 cm). The average number of nodes of Gmft5a mutant plants (6.7±0.8) was not significantly different from that of WT plants (6.4±0.7) ( Figure 11 , Table 15). Table 15. Phenotypes of WT and Gmft5a plants under SD conditions. plant R1 (flowering) (d) R7(mature)(d) Plant height (cm) Number of sections Gmft5a 26.1±1.1 72.1±7.3 47.3±6.3 6.7±0.8 WT 26.6±0.96 71.7±8.0 48.5±11.3 6.4±0.7

[0289] Under LD conditions, the average flowering time of Gmft5a mutants was significantly later than that of WT plants (66.6 ± 4.6 vs. 44.8 ± 1.6 DAE, respectively) ( Figure 12 ). In addition, the average R7 time of Gmft5a mutant plants was 161.9±7.5DAE, which was significantly later than that of WT (146.5±3.9DAE). In addition, the average plant height of Gmft5a mutant plants was 236.1±16.9 cm, which was not significantly different from the average plant height of WT plants (221.5±19.8 cm). The average number of nodes of Gmft5a mutant plants (23.3±5.0) was not significantly different from the average number of nodes of WT plants (22.6±2.5). Figure 12 , Table 16). One-way ANOVA was used for statistical analysis. These observations strongly suggest that loss of Gmft5a function leads to delayed flowering in soybean under LD conditions, but not under SD conditions. Table 16. Phenotypes of WT and Gmft5a plants under LD conditions. plant R1 (flowering) (d) R7(mature)(d) Plant height (cm) Number of sections Gmft5a 66.6±4.6** 161.9±7.5** 236.1±16.9 23.3±5.0 WT 44.8±1.6 146.5±3.9 221.5±19.8 22.6±2.5 ** indicates p < 0.01. 3. Generation of Gmft5a Gmft5b Double Mutant Plants 3.1 Generation of Gmft5a Gmft5b Hybrid Lines

[0290] First, T3 homozygous Gmft5a and Gmft5b mutant plants were grown under natural long-day conditions. Then, we used Gmft5a mutant plants (1-bp insertion) as male parents and Gmft5b mutant plants (8-bp deletion) as female parents for hybridization to generate the F1 generation of Gmft5a Gmft5b double mutant plants. 3.2 Screening of homozygous Gmft5a Gmft5b double mutant plants

[0291] First, the F1 generation of Gmft5a Gmft5b double mutant plants were grown under short-day conditions. Genomic DNA was extracted using TPS buffer (100 mM Tris-HCl, 10 mM EDTA, 1 M KCl, pH 8.0) as follows. Briefly, approximately 100 mg of soybean leaves were immersed in TPS buffer and the supernatant was obtained by centrifugation. Genomic DNA was then extracted by anhydrous ethanol precipitation at -20°C. Subsequently, the GmFT5a and GmFT5b fragments were amplified from the DNA of each plant by PCR using GmFT5a-616-F / R primers (GmFT5a-616-F: 5'-ATCGACCGATCGAGGACAAC-3' (SEQ ID NO:73); GmFT5a-616-R: 5'-TGGGAGACTACAGAAGCAAAGA-3' (SEQ ID NO:74)) and GmFT5b-661-F / R primers (GmFT5b-661-F: 5'-TTGACCATGCACCAAGGGAA-3' (SEQ ID NO:71); GmFT5b-661-R: 5'-CAAGACAGGGTTGCTAGGGC-3' (SEQ ID NO:72)), respectively. The PCR reaction system was as follows: 2× Taq master mix, 12.5 μL; DNA (200 ng / μL), 1 μL; GmFT5b-661-F (10 pmol / μL), 1 μL; GmFT5b-661-R (10 pmol / μL), 1 μL; ddH2O 9.5 μL, total volume 25 μL. 2× Taq master mix, 12.5 μL; DNA (200 ng / μL), 1 μL; GmFT5a-616-F (10 pmol / μL), 1 μL; GmFT5a-616-R (10 pmol / μL), 1 μL; ddH2O 9.5 μL, total volume 25 μL. The PCR reaction settings were as follows: 94°C for 3 min; 35 cycles of 94°C for 30 s, 54°C for 30 s, and 72°C for 1 min; and a final extension at 72°C for 10 min. All PCR products for GmFT5a and GmFT5b were sequenced using GmFT5a-616-R: 5'-TGGGAGACTACAGAAGCAAAGA-3' (SEQ ID NO: 74) and GmFT5b-661-R: 5'-CAAGACAGGGTTGCTAGGGC-3' (SEQ ID NO: 72), respectively. Finally, a homozygous Gmft5a Gmft5b double mutant plant carrying the frameshift mutation was obtained in the F3 generation.In particular, there is a 1-bp insertion at the target site GmFT5a-TS, which produces a frameshift-induced premature stop codon (SEQ ID NO: 53) in GmFT5a. Simultaneously, there is an 8-bp deletion at the target site GmFT5b-TS, which produces a frameshift-induced premature stop codon (SEQ ID NO: 55) in GmFT5b. All offspring of the homozygous 'Gmft5a Gmft5b' double mutant comprising both SEQ ID NO: 53 and SEQ ID NO: 55 are "no transgene" homozygous Gmft5a Gmft5b double mutants. 3.3 Soybean materials and growth conditions

[0292] In March 2021, wild-type (WT) and Gmft5a Gmft5b double mutants were grown and evaluated under short-day (SD; 12 h light and 12 h dark, 22°C-30°C) and long-day (LD; 16 h light and 8 h dark, 22°C-30°C) conditions. The red to blue quantum (R:B) ratio of the light was 5.17. The same lighting as described in Section 1.4 of this example was used. 3.4 Gmft5a Gmft5b double mutant plants have different phenotypes under different photoperiod conditions

[0293] Under SD conditions, the average flowering time of Gmft5a Gmft5b double mutant plants (26.8 ± 1.0 DAE) was not significantly different from that of WT plants (26.6 ± 0.96 DAE). Figure 13 ). In addition, the average R7 time of Gmft5a Gmft5b double mutant plants was 71.2±5.8DAE, which was not significantly different from WT (71.7±8.0DAE). In addition, the average plant height of Gmft5aGmft5b double mutant plants (48.2±7.6cm) was not significantly different from that of WT plants (48.5±11.3cm). The average number of nodes of Gmft5a Gmft5b double mutant plants (6.4±1.2) was not significantly different from that of WT plants (6.4±0.7). Figure 13 , Table 17). Table 17. Phenotypes of WT and Gmft5a Gmft5b double mutant plants under SD conditions. plant R1 (flowering) (d) R7(mature)(d) Plant height (cm) Number of sections Gmft5a Gmft5b 26.8±1.0 71.2±5.8 48.2±7.6 6.4±1.2 WT 26.6±0.96 71.7±8.0 48.5±11.3 6.4±0.7

[0294] Under LD conditions, the average flowering time of Gmft5a Gmft5b double mutant plants (77.1±4.4 DAE) was significantly later than that of WT plants (44.8±1.6 DAE). Figure 14). In addition, the average R7 time of WT plants was 146.5±3.9 DAE, while Gmft5a Gmft5b double mutant plants did not mature for more than 180 days. In addition, the average plant height of Gmft5aGmft5b double mutant plants (270.0±32.9 cm) was significantly higher than that of WT plants (221.5±19.8 cm). The average number of nodes of Gmft5aGmft5b double mutant plants (24.4±1.1) was not different from that of WT plants (22.6±2.5) ( Figure 14 , Table 18). One-way ANOVA was used for statistics. Table 18. Phenotypes of WT and Gmft5a Gmft5b double mutant plants under LD conditions. plant R1 (flowering) (d) R7(mature)(d) Plant height (cm) Number of sections Gmft5a Gmft5b 77.1±4.4** More than 180 days without maturity 270.0±32.9** 24.4±1.1 WT 44.8±1.6 146.5±3.9 221.5±19.8 22.6±2.5 ** indicates p < 0.01.

[0295] All patents, patent publications, patent applications, journal articles, books, technical references, etc. discussed in this disclosure are incorporated herein by reference in their entirety for all purposes.

[0296] It is understood that in certain aspects of the present disclosure, a single component may be replaced by multiple components, and multiple components may be replaced by a single component to provide an element or structure or to perform a given function or functions. Unless such a replacement would be inoperable to implement certain embodiments of the present disclosure, such a replacement is considered to be within the scope of the present disclosure.

[0297] The examples presented herein are intended to illustrate the potential and specific implementation of the present disclosure. It will be appreciated that these examples are primarily intended to illustrate the purpose of the present disclosure to those skilled in the art. Without departing from the spirit of the present disclosure, these figures or the operations described herein may vary. For example, in some cases, method steps or operations may be performed or executed in different orders, or operations may be added, deleted, or modified.

[0298] All numerical names, such as pH, temperature, time, concentration and molecular weight (including ranges) are approximate values, which vary in increments (+) or (-) of 0.1 or 1.0, as appropriate. It should be understood that all numerical names are preceded by the term "about," although not always explicitly stated. Where a numerical range is provided, it should be understood that each intermediate value between the upper and lower limits of the range (to the smallest decimal of the units of the lower limit, unless the context clearly dictates otherwise) is also specifically disclosed. Any smaller range between any stated value or non-stated intermediate value in the stated range and any other stated value or intermediate value in the stated range is encompassed. The upper and lower limits of these smaller ranges may be independently included or excluded from the range, and each range in which any one, none or both of the limits are included in the smaller range is also encompassed within the present technology, but is subject to any specifically excluded limits in the stated range. Where the stated range includes one or both of the limits, the range excluding one or both of the included limits is also encompassed.

[0299] In the foregoing description, many specific details are set forth to provide a more thorough understanding of the present invention. However, it will be clear to those skilled in the art that the invention described in this disclosure can be practiced without one or more of these specific details. In other cases, features and procedures well known to those skilled in the art are not described to avoid obscuring the present invention. For illustrative and not restrictive purposes, embodiments of the present disclosure have been described. Although the present invention is primarily described with reference to specific embodiments, other embodiments that will become clear to those skilled in the art upon reading this disclosure are also contemplated, and such embodiments are intended to be included within the inventive method. Therefore, the present disclosure is not limited to the embodiments described above or depicted in the accompanying drawings, and various embodiments and modifications may be made without departing from the scope of the following claims.

Claims

1. A plant with genomic modification, wherein the genomic modification comprises knocking out one or more of the following genes: (i) GmCOL2a; (ii) GmCOL2b; (iii) GmFT5a; (iv) GmFT5b; or (v) GmFT4, wherein the plant has an altered flowering time and / or maturity time relative to a control plant that does not contain the genomic modification.

2. The plant according to claim 1, wherein the genomic modification results in a decrease in the expression and / or activity of the polypeptide encoded by the one or more genes, and the decrease in the expression and / or activity of the polypeptide causes the altered flowering time and / or maturity time under long-day (LD) and / or short-day (SD) conditions.

3. The plant according to claim 1, wherein the genomic modification is non-natural to the plant.

4. The plant according to claim 3, wherein the genomic modification comprises a deletion, insertion, or substitution in the genomic DNA sequence of the one or more genes.

5. The plant according to claim 3 or 4, wherein the genomic DNA sequence of the one or more genes: (a) has at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with at least one of SEQ ID NO:15, 21, 27, 52, or 54, (b) has at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identity with at least one of SEQ ID NO:16, 22, 56, 35, or 39, and / or (c) contains the nucleic acid sequences shown in SEQ ID NO:1, 6, 43, 49, and 46.

6. The plant according to any one of claims 1-5, wherein the genomic modification is achieved by CRISPR, TALEN, or meganuclease.

7. The plant according to claim 6, wherein the genomic modification is achieved by Cas12a-mediated gene editing.

8. The plant according to claim 7, wherein the Cas12a-mediated gene editing employs a gRNA with a target sequence that contains one or more of SEQ ID NO:1, 6, 43, 49, or 46.

9. The plant according to claim 1, wherein the genomic modification of the one or more genes produces a plant that expresses one or more of the following: (i) a mutant GmCOL2a polypeptide; (ii) a mutant GmCOL2b polypeptide; (iii) a mutant GmFT5a polypeptide; (iv) a mutant GmFT5b polypeptide; and / or (v) a mutant GmFT4 polypeptide.

10. The plant according to claim 1, wherein the genomic modification of the one or more genes produces a plant that expresses one or more of the following: (i) a mutant GmCOL2a allele; (ii) a mutant GmCOL2b allele; (iii) a mutant GmFT5a allele; (iv) Mutant GmFT5b allele; and / or (v) Mutant GmFT4 allele.

11. The plant according to any one of claims 1-10, wherein the genomic modification results in a decrease in the expression and / or activity of a polypeptide comprising: (a) an amino acid sequence having at least 85%, 90%, 91%, 92%, 93%, 94, 95%, 96%, 97%, 98%, or 99% identity to at least one of SEQ ID NO: 17, 23, 28, 36, or 40, and / or (b) the amino acid sequence shown in at least one of SEQ ID NO: 17, 23, 28, 36, or 40.

12. The plant according to claim 1 or 9, wherein the genomic modification results in a decrease in the expression of one or more of the wild-type GmCOL2a polypeptide (SEQ ID NO: 17), wild-type GmCOL2b polypeptide (SEQ ID NO: 23), wild-type GmFT5a polypeptide (SEQ ID NO: 40), wild-type GmFT5b polypeptide (SEQ ID NO: 36), or wild-type GmFT4 polypeptide (SEQ ID NO: 28) by at least 80% relative to a control plant that does not contain the genomic modification.

13. The plant according to claim 9 or 12, wherein the mutant GmCOL2a polypeptide, the mutant GmCOL2b polypeptide, the mutant GmFT5a polypeptide, the mutant GmFT5b polypeptide, or the mutant GmFT4 polypeptide shares less than 20% identity with the corresponding wild-type polypeptide.

14. The plant according to claim 9 or 12, wherein the mutant GmCOL2a polypeptide, the mutant GmCOL2b polypeptide, the mutant GmFT5a polypeptide, the mutant GmFT5b polypeptide, or the mutant GmFT4 polypeptide is a non-functional polypeptide.

15. The plant according to any one of claims 9-14, wherein the plant expresses a mutant GmCOL2a polypeptide comprising: (a) an amino acid sequence having at least 85% identity to SEQ ID NO: 20, or (b) the amino acid sequence shown in SEQ ID NO:

20.

16. The plant according to claim 15, wherein the mutant GmCOL2a polypeptide is encoded by a sequence having at least 85% identity to SEQ ID NO: 18 or 19.

17. The plant according to any one of claims 9-14, wherein the mutant GmCOL2b polypeptide comprises an amino acid sequence having at least 85% identity to SEQ ID NO: 26, or wherein the mutant GmCOL2b polypeptide is encoded by a nucleic acid sequence having at least 85% identity to SEQ ID NO: 24 or 25.

18. The plant according to any one of claims 9-14, wherein the mutant GmFT5a polypeptide comprises an amino acid sequence having at least 85% identity with SEQ ID NO: 42, or wherein the mutant GmFT5a polypeptide is encoded by a nucleic acid sequence having at least 85% identity with SEQ ID NO: 41 or SEQ ID NO:

53.

19. The plant according to any one of claims 9-14, wherein the mutant GmFT5b polypeptide comprises an amino acid sequence having at least 85% identity with SEQ ID NO: 38, or wherein the mutant GmFT5b polypeptide is encoded by a nucleic acid sequence having at least 85% identity with SEQ ID NO: 37 or SEQ ID NO:

55.

20. The plant according to any one of claims 9-14, wherein the mutant GmFT4 polypeptide comprises an amino acid sequence having at least 85% identity with SEQ ID NO: 32 or 30, or wherein the mutant GmFT4 polypeptide is encoded by a nucleic acid sequence having at least 85% identity with SEQ ID NO: 31 or 29.

21. The plant according to any one of claims 1-20, wherein one or more of the GmCOL2a gene, the GmCOL2b gene, or the GmFT4 gene is knocked out in the plant, and wherein the plant flowers and / or matures earlier than a control plant not comprising the genomic modification under LD conditions.

22. The plant according to claim 21, wherein under LD conditions, the genetically modified plant flowers and / or matures at least 2 days earlier than the control plant.

23. The plant according to claim 21, wherein under LD conditions, the genetically modified plant flowers and / or matures 2-40 days earlier than the control plant.

24. The plant according to any one of claims 1-22, wherein both the GmCOL2a gene and the GmCOL2b gene are knocked out in the plant, and wherein the plant flowers and / or matures 2-40 days earlier than the control plant under LD conditions.

25. The plant according to any one of claims 1-22, wherein the GmFT4 gene is knocked out in the plant, and wherein the plant matures 2-40 days earlier than the control plant under LD conditions and matures 2-40 days earlier than the control plant under SD conditions.

26. The plant according to any one of claims 1-20, wherein GmFT5a or GmFT5b, or both GmFT5a and GmFT5b, are knocked out in the plant, and wherein the plant flowers and / or matures later than a control plant not comprising the genomic modification under LD conditions.

27. The plant according to claim 26, wherein under LD conditions, the genetically modified plant flowers and / or matures at least 2 days later than the control plant.

28. The plant according to claim 27, wherein under LD conditions, the genetically modified plant flowers and / or matures 2-40 days later than the control plant.

29. A plant according to any one of claims 1-22, wherein the plant has both GmFT5a and GmFT5b knocked out, and wherein the genetically modified plant flowers and / or matures 30-70 days later than the control plant under LD conditions.

30. A plant according to any one of claims 1-29, wherein the plant is a dicotyledonous plant.

31. The plant according to claim 30, wherein the dicotyledonous plant is a soybean plant, and optionally wherein the soybean plant is an elite soybean plant.

32. A plant cell, seed, or plant part derived from a plant according to any one of claims 9-31, wherein the plant cell, seed, or plant part expresses one or more of a mutant GmCOL2a polypeptide, a mutant GmCOL2b polypeptide, a mutant GmFT5a polypeptide, a mutant GmFT5b polypeptide, or a mutant GmFT4 polypeptide.

33. A harvested product derived from a plant according to any one of claims 9-31 or a plant cell, seed, or plant part according to claim 32, wherein the harvested product expresses one or more of a mutant GmCOL2a polypeptide, a mutant GmCOL2b polypeptide, a mutant GmFT5a polypeptide, a mutant GmFT5b polypeptide, or a mutant GmFT4 polypeptide.

34. A processed product derived from the harvested product according to claim 33, wherein the altered flowering of the genetically modified plant comprises fewer days between the VE stage and the R1 stage compared to the control plant.

35. A plant that expresses both a mutant GmCOL2a polypeptide and a mutant GmCOL2b polypeptide, wherein the mutant GmCOL2a polypeptide comprises: (a) an amino acid sequence having at least 85% identity to SEQ ID NO:20, or (b) the amino acid sequence as set forth in SEQ ID NO:20, and wherein the mutant GmCOL2b polypeptide comprises an amino acid sequence having at least 85% identity to SEQ ID NO:26, or (b) the amino acid sequence as set forth in SEQ ID NO:

26.

36. A plant that expresses both a mutant GmFT5a polypeptide and a mutant GmFT5b polypeptide, wherein the mutant GmFT5a polypeptide comprises: (a) an amino acid sequence having at least 85% identity to SEQ ID NO:42, or (b) the amino acid sequence as set forth in SEQ ID NO:42, and wherein the mutant GmFT5b polypeptide comprises an amino acid sequence having at least 85% identity to SEQ ID NO:38, or (b) the amino acid sequence as set forth in SEQ ID NO:

38.

37. A method of altering the flowering time and / or maturity time of a soybean plant, the method comprising editing one or more of the following genes in the genome of the soybean plant: (i) GmCOL2a (ii) GmCOL2b, (iii) GmFT5a, (iv) GmFT5b, or (v) GmFT4, thereby forming a modified soybean plant, wherein the modified soybean plant has an altered flowering time and / or maturity time relative to a control plant that does not contain the editing in one or more of the genes.

38. The method according to claim 37, wherein the editing comprises knocking out one or more of the genes, thereby producing the modified soybean plant that expresses one or more of the following: (i) a mutant GmCOL2a polypeptide, (ii) a mutant GmCOL2b polypeptide, (iii) a mutant GmFT5a polypeptide, (iv) a mutant GmFT5b polypeptide, or (v) a mutant GmFT4 polypeptide.

39. The method according to claim 38, wherein the mutant GmCOL2a polypeptide, the mutant GmCOL2b polypeptide, the mutant GmFT5a polypeptide, the mutant GmFT5b polypeptide, or the mutant GmFT4 polypeptide shares less than 20% identity with the corresponding wild-type polypeptide.

40. The method according to claim 38 or 39, wherein the mutant GmCOL2a polypeptide, the mutant GmCOL2b polypeptide, the mutant GmFT5a polypeptide, the mutant GmFT5b polypeptide, or the mutant GmFT4 polypeptide is each a non-functional polypeptide.

41. The method according to claim 38 or 39, wherein the mutant GmCOL2a polypeptide comprises SEQ ID NO:20, the mutant GmCOL2b polypeptide comprises SEQ ID NO:26, the mutant GmFT5a polypeptide comprises SEQ ID NO:42, the mutant GmFT5b polypeptide comprises SEQ ID NO:38, or the mutant GmFT4 polypeptide comprises SEQ ID NO:30 or 32.

42. The method according to any one of claims 38-40, wherein the knockout of the GmCOL2a gene, the GmCOL2b gene, the GmFT5a gene, the GmFT5b gene, or the GmFT4 gene is carried out by gene editing using a site-directed nuclease.

43. The method according to claim 42, wherein the site-directed nuclease is selected from the group consisting of Cas12 nuclease, mega nuclease, zinc finger nuclease, or transcription activator-like effector nuclease.

44. The method according to any one of claims 38-43, wherein the knockout of the GmCOL2a gene, the GmCOL2b gene, the GmFT5a gene, the GmFT5b gene, or the GmFT4 gene is carried out using a Cas nuclease and a guide RNA, and the guide RNA comprises a nucleotide sequence corresponding to a target sequence in one or more of the GmCOL2a gene, the GmCOL2b gene, the GmFT5a gene, the GmFT5b gene, or the GmFT4 gene.

45. The method according to claim 44, wherein the target sequence in the GmCOL2a gene comprises SEQ ID NO:

1.

46. The method according to claim 44 or 45, wherein the guide RNA for gene editing of the GmCOL2a gene is encoded by SEQ ID NO: 2 or 3.

47. The method according to claim 44, wherein the target sequence in the GmCOL2b gene comprises SEQ ID NO:

6.

48. The method according to claim 44 or 47, wherein the guide RNA for genetically modifying the GmCOL2b gene is encoded by SEQ ID NO: 7 or 8.

49. The method according to claim 44, wherein the target sequence in the GmFT5a gene comprises SEQ ID NO:

49.

50. The method according to claim 44 or 49, wherein the guide RNA for gene editing the GmFT5a gene is encoded by SEQ ID NO: 50 or 51.

51. The method according to claim 44, wherein the target sequence in the GmFT5b gene comprises SEQ ID NO:

46.

52. The method according to claim 44 or 51, wherein the guide RNA for gene editing the GmFT5b gene is encoded by SEQ ID NO: 47 or 48.

53. The method according to claim 44, wherein the target sequence in the GmFT4 gene comprises SEQ ID NO:

43.

54. The method according to claim 44 or 53, wherein the guide RNA for gene editing of the GmFT4 gene is encoded by SEQ ID NO: 44 or 45.

55. The method according to any one of claims 37 - 54, wherein the editing comprises knocking out one or more of GmCOL2a, GmCOL2b, or GmFT4, and wherein the method further comprises detecting accelerated flowering and / or maturation of the modified soybean plant compared to a control plant under LD conditions.

56. The method according to claim 55, wherein the LD conditions are 16 h light / 8 h dark in a 24 - hour period.

57. The method according to claim 55, wherein the accelerated flowering and / or maturation is at least 2 days earlier, at least 4 days earlier, at least 5 days earlier, at least 6 days earlier, or at least 7 days earlier compared to a control plant grown under LD conditions.

58. The method according to any one of claims 37 - 54, wherein the editing comprises knocking out one or both of GmFT5a and GmFT5b, and wherein the method further comprises detecting delayed flowering and / or maturation of the modified soybean plant compared to a control plant under LD conditions, wherein the detection of delayed flowering is based on counting the number of days elapsed between the VE stage and the R1 stage, and wherein the detection of delayed maturation is based on counting the number of days between the VE stage and the R7 stage.

59. The method according to claim 60, wherein the delayed flowering is at least 2 days later, at least 4 days later, at least 5 days later, at least 6 days later, or at least 7 days later compared to a control plant grown under LD conditions.

60. A modified soybean plant produced by the method according to any one of claims 37 - 59.

61. A plant cell, seed, or plant part derived from the modified soybean plant according to claim 60.

62. A breeding method comprising: crossing a plant according to any one of claims 10 - 31 with a different plant that does not contain one or more mutant alleles; wherein both plants are soybean plants, and selecting progeny plants having altered flowering and / or maturity time.

63. The method according to claim 62, wherein the different plant is an elite soybean plant.

64. A plant comprising a genomic modification that results in reduced expression and / or activity of a polypeptide comprising: (a) an amino acid sequence having at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to at least one of SEQ ID NO:7, 23, 28, 36, or 40, or (b) an amino acid sequence as set forth in at least one of SEQ ID NO:17, 23, 28, 36, or 40, wherein the modification is heterologous to the plant, and the reduced expression and / or activity in the plant results in the plant having an altered flowering and / or maturity time compared to a control plant that does not contain the genomic modification, and wherein the genomic modification is introduced via genome editing.

65. A modified soybean plant or a plant part thereof comprising one or more non - naturally occurring mutant alleles at one or more loci, wherein the non - naturally occurring mutant alleles are introduced via genome modification using a site - directed nuclease, wherein the one or more loci comprise GmFT4a, GmFT5a, GmFT5b, GmCOL2a, or GmCOL2b, and wherein the one or more mutant alleles result in an altered flowering and / or maturity time of the plant compared to a control plant that does not contain the mutant alleles.

66. The modified soybean plant or a plant part thereof according to claim 65, wherein the non - naturally occurring mutant allele is a homozygous mutant allele.

67. The modified soybean plant or a plant part thereof according to claim 65, wherein the modified soybean plant or a plant part thereof comprises non - naturally occurring mutant alleles at each of the GmFT5a locus and the GmFT5b locus, and wherein both loci comprise homozygous mutant alleles.

68. A modified soybean plant or a plant part thereof as claimed in claim 65, wherein the modified soybean plant or the plant part thereof comprises a non-naturally occurring mutant allele at each of the GmCOL2a locus and the GmCOL2b locus, and both of the loci comprise homozygous mutant alleles.

69. A modified soybean plant or a plant part thereof as claimed in claim 65, wherein the modified soybean plant or the plant part thereof comprises a non-naturally occurring homozygous mutant allele at the GmFT4a locus.

70. A modified soybean plant or a plant part thereof as claimed in any one of claims 65-69, wherein the mutant allele exhibits a decrease in expression or activity relative to the unmodified wild-type gene allele, and wherein the mutant allele gives rise to a modified soybean plant having the altered flowering and / or maturity time when grown under LD conditions.

71. A modified soybean plant or a plant part thereof as claimed in any one of claims 65-70, wherein the mutant allele gives rise to a modified soybean plant having accelerated flowering and / or maturity relative to the control plant when grown under LD conditions.

72. A modified soybean plant or a plant part thereof as claimed in any one of claims 65-71, wherein at least one of the mutant alleles comprises a nonsense mutation, an in-frame deletion mutation, a missense mutation, a frameshift mutation, a splice site mutation, or any combination thereof.

73. A modified soybean plant or a plant part thereof as claimed in any one of claims 65-72, wherein at least one of the mutant alleles encodes a protein truncation, a non-functional protein, a protein having a reduced function relative to the protein expressed by the corresponding wild-type allele, and / or wherein at least one of the mutant alleles comprises a premature stop codon, a frameshift mutation, and an in-frame deletion relative to the corresponding wild-type allele.

Images