A DNAzyme-based calcium nanoregulator, its preparation method and application

By preparing a DNAzyme-based calcium nanomodulator, the acidic conditions in the tumor microenvironment trigger drug release and the Fenton reaction, thus solving the problem of poor efficacy of CDT therapy and achieving highly efficient multiple therapies for tumors.

CN120242065BActive Publication Date: 2025-10-28LINYI UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510463891.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-14
Publication Date
2025-10-28
Estimated Expiration
2045-04-14

AI Technical Summary

Technical Problem

Existing chemodynamic therapy (CDT) cannot effectively treat tumors, and single treatment methods cannot achieve anti-tumor effects. Insufficient H2O2 and low catalyst activity in the tumor microenvironment limit the production of ·OH.

Method used

Manganese-doped calcium phosphate was synthesized via a one-step biomimetic mineralization method. It was loaded with DNAzyme nucleic acid sequences and DOX to form a DNAzyme-based calcium nanoregulator. The acidic conditions in the tumor microenvironment triggered drug release and the Mn2+-mediated Fenton reaction to generate ·OH.

Benefits of technology

It achieves precise treatment of tumors, with high sensitivity and biocompatibility. It can accurately release DOX in the presence of miRNA-21, and combine with glucose to convert H2O2 to produce ·OH, achieving multiple combined therapeutic effects and significantly inhibiting tumor growth.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120242065B_ABST
    Figure CN120242065B_ABST
Patent Text Reader

Abstract

This invention provides a DNAzyme-based nanoregulator, its preparation method, and its application, belonging to the field of breast cancer treatment technology. The preparation method of this invention comprises the following steps: using GOx as a template, manganese-doped calcium phosphate is synthesized via a one-step biomimetic mineralization method; a DNAzyme nucleic acid sequence is loaded onto the surface of the manganese-doped calcium phosphate to obtain an empty calcium nanoregulator; and DOX is loaded into the DNAzyme nucleic acid sequence to obtain the calcium nanoregulator. The DNAzyme-based calcium nanoregulator of this invention can perform multiple combined therapies: in the acidic microenvironment of the tumor, GOx can effectively convert glucose into H2O2 for subsequent Mn2 production. 2+ The Fenton-like catalytic reaction mediated by the calcium nano-modulator effectively consumes glucose and generates ·OH; in vivo experiments showed that the combination of calcium nano-modulators with DOX chemotherapy achieved a high tumor-suppressing effect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of breast cancer treatment technology, and in particular to a DNAzyme-based calcium nanoregulator, its preparation method, and its application. Background Technology

[0002] Breast cancer is one of the most prevalent and deadliest cancers among women worldwide. Despite researchers proposing numerous intelligent strategies for treating cancer, including chemotherapy, chemokinetics, starvation therapy, and photodynamic therapy, tumors often cleverly utilize multiple metabolic processes to resist treatment. A single treatment approach may not be sufficient to effectively combat tumors. Furthermore, the focus of cancer treatment is not solely on cure; early prevention and diagnosis are also crucial. Therefore, developing integrated strategies for cancer diagnosis and treatment is a primary task in the fight against cancer.

[0003] microRNAs (miRNAs) are 19-22 base pairs of non-coding RNAs that play important roles in various stages of the cell cycle. Aberrant expression of miRNAs is often associated with the occurrence and metastasis of various diseases. These characteristics of miRNAs have enabled researchers to develop more accurate, reliable, and sensitive analytical methods to detect them, thereby enabling disease diagnosis, prognosis, and monitoring. miRNA-21, as an anti-apoptotic factor highly expressed in most human cancer cells, generally suggests that aberrant expression of miRNA-21 may inhibit the expression of key genes related to apoptosis, potentially further promoting the development of malignant phenotypes.

[0004] DNAzymes are DNA-based catalysts that can cleave specific substrates with the help of certain metal ions. They have attracted increasing attention due to their ease of synthesis and modification, as well as their inherent heat and chemical resistance. Since the amount of DNAzyme cofactors within cells is far below the minimum concentration required for DNAzyme reactions, these reagents, including not only nucleic acid probes but also metal ions, must be efficiently introduced into target cells. Calcium phosphate nanoparticles can strongly adsorb nucleic acid probes and, as effective carriers, penetrate cell membranes, thus being widely used for DNAzyme delivery.

[0005] Chemodynamic therapy (CDT) utilizes metal ions as catalysts to decompose endogenous H₂O₂ into cytotoxic ·OH. However, the therapeutic efficacy of CDT is often limited by insufficient ·OH production due to the unsuitable reaction environment in the tumor microenvironment (TME), insufficient H₂O₂, and low catalytic activity of the catalyst. Although researchers have proposed many intelligent strategies to accelerate the catalytic rate of CDT, the ·OH generated in these efforts remains insufficient to achieve effective tumor elimination due to the strong drug resistance of tumors.

[0006] Therefore, providing a DNAzyme-based calcium nanoregulator that can effectively treat tumors has significant practical implications. Summary of the Invention

[0007] The purpose of this invention is to provide a DNAzyme-based calcium nanoregulator, its preparation method, and its application, aiming to solve the technical problems that existing chemodynamic therapy (CDT) cannot effectively treat tumors, and that single treatment methods cannot effectively achieve anti-tumor effects.

[0008] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0009] This invention provides a method for preparing a calcium nanoregulator based on DNAzyme, the steps of which are as follows:

[0010] Using glucose oxidase GOx as a template, manganese-doped calcium phosphate was synthesized via a one-step biomimetic mineralization method. The manganese-doped calcium phosphate is GOx-MnCaP.

[0011] The DNAzyme nucleic acid sequence was loaded onto the surface of the manganese-doped calcium phosphate to obtain an empty calcium nano-regulator, namely GOx-MnCaP-D.

[0012] DOX was loaded into the DNAzyme nucleic acid sequence to obtain the calcium nanoregulator, namely GOx-MnCaP-DD.

[0013] Furthermore, the one-step biomimetic mineralization method for synthesizing manganese-doped calcium phosphate specifically involves: dissolving 10 μL of 0.1M MnCl2·4H2O and 2 mg of GOx in 1 mL of sugar-free DMEM, reacting at 37°C for 24 hours, adding 10 μL of 1M CaCl2 and continuing the reaction for another 24 hours, centrifuging at 13500 rpm for 15 minutes, washing the separated product with PBS three times, precipitating and then freeze-drying.

[0014] Furthermore, the DNAzyme nucleic acid sequence specifically includes: SEQ ID NO.1:TCAACATCAGTCTGATAAGCTAAACAGATCTCAACTCCGAGCCGGTCGAATAGCTTATCAGACTGA and SEQ ID NO.2:AGCAGCTAAGCTAGCTTATAAGCTAGGAAGAGATTGCTAGCTATGCTGC.

[0015] Furthermore, the process of loading the DNAzyme nucleic acid sequence onto the surface of the manganese-doped calcium phosphate is as follows: 20 μL of 1 μM SEQ ID NO.1, 20 μL of 9 μM SEQ ID NO.2 and 10 μL of 450 μg / mL GOx-MnCaP are mixed for 20 minutes, then 25 μL of HEPES buffer is added and incubated at room temperature for another hour. After that, the mixture is centrifuged at 15000 rpm for 10 minutes to remove excess hairpin probes from the mixture, thus obtaining the unloaded calcium nanoregulator.

[0016] Furthermore, the HEPES buffer has a concentration of 20 mM and a pH of 7.2, and the HEPES buffer comprises 150 mM NaCl and 2 mM MgCl2.

[0017] Furthermore, the conditions for loading DOX into the DNAzyme nucleic acid sequence are as follows: 10 μL of 5 μM DOX is mixed with the empty calcium nanoregulator and reacted at room temperature for 12 hours. Finally, the mixture is centrifuged at 9000 rpm for 10 min and washed to obtain the calcium nanoregulator, namely GOx-MnCaP-DD.

[0018] The present invention also provides a DNAzyme-based calcium nanometer regulator, which is obtained by the preparation method described in the above technical solution.

[0019] The present invention also provides an application of a DNAzyme-based calcium nanometer regulator, wherein the calcium nanometer regulator is the calcium nanometer regulator described in the above technical solution, and the application specifically refers to the use of the DNAzyme-based calcium nanometer regulator in the preparation of drugs for treating breast cancer.

[0020] Compared with the prior art, the technical solution of the present invention has the following beneficial effects:

[0021] (1) The calcium nano-regulator based on DNAzyme described in this invention has the advantages of low complexity and high sensitivity: This invention can obtain a targeted triggering calcium nano-regulator based on DNAzyme using only 2 DNA hairpins; the method has higher sensitivity than the traditional HCR method, with a detection limit of 210 fM; the nanosystem has high selectivity and extremely high sensitivity to the target miRNA-21, and can successfully distinguish between cancer cells and normal cells;

[0022] (2) The DNAzyme-based calcium nanoregulator described in this invention is biodegradable and highly biocompatible: no need to add exogenous Mn. 2+The DNAzyme-based calcium nanoregulator GOx-MnCaP-DD described in this invention exhibits excellent biocompatibility, which is of great significance for intracellular applications. Furthermore, drug disintegration in the tumor microenvironment releases Mn... 2+ It can serve as a cofactor ion for DNAzymes without needing to be added again, thus avoiding secondary stimulation of cells;

[0023] (3) The DNAzyme-based calcium nano-regulator described in this invention can precisely release drugs: when the drug reaches the tumor area, the hairpin will open to release DOX in the presence of miRNA-21, thereby achieving precise treatment;

[0024] (4) The DNAzyme-based calcium nanoregulator described in this invention can perform multiple combined therapies: In the acidic microenvironment of the tumor, GOx can effectively convert glucose into H2O2 for subsequent Mn 2+ The calcium nanomodulator mediates a Fenton-like catalytic reaction, thereby effectively consuming glucose and generating ·OH. In in vivo experiments, the calcium nanomodulator, combined with DOX chemotherapy, achieved a high tumor-suppressing effect. This calcium nanomodulator represents an effective cancer treatment paradigm that can be translated into clinical applications and has great potential for application in disease diagnosis and treatment. Attached Figure Description

[0025] Figure 1 The figure shows the pH response degradation test results of the DNAzyme-based calcium nanoregulator described in Test Example 1.

[0026] Figure 2 The figure shows the test results of DOX release from the DNAzyme-based calcium nanoregulator described in Test Example 2.

[0027] Figure 3 The graph shows the test results of the ability of the DNAzyme-based calcium nano-regulator to generate ·OH in Test Example 3;

[0028] Figure 4 The graph shows the test results for testing the sensitivity of the DNAzyme-based calcium nanomodulator.

[0029] Figure 5 The graph shows the test results for testing the selectivity of the DNAzyme-based calcium nanomodulator.

[0030] Figure 6 The graph shows the test results of the antitumor ability of the DNAzyme-based calcium nanomodulator.

[0031] Figure 7 The figure shows the test results of the tumor suppression effect of the DNAzyme-based calcium nanomodulator in vivo. Detailed Implementation

[0032] This invention provides a method for preparing a calcium nanoregulator based on DNAzyme, characterized in that the preparation method comprises the following steps:

[0033] Using glucose oxidase GOx as a template, manganese-doped calcium phosphate was synthesized via a one-step biomimetic mineralization method. The manganese-doped calcium phosphate is GOx-MnCaP.

[0034] The DNAzyme nucleic acid sequence was loaded onto the surface of the manganese-doped calcium phosphate to obtain an empty calcium nano-regulator, namely GOx-MnCaP-D.

[0035] DOX was loaded into the DNAzyme nucleic acid sequence to obtain the calcium nanoregulator, namely GOx-MnCaP-DD.

[0036] In this invention, the one-step biomimetic mineralization method for synthesizing manganese-doped calcium phosphate specifically involves: dissolving 10 μL of 0.1 M MnCl2·4H2O and 2 mg of GOx in 1 mL of sugar-free DMEM, reacting at 37 °C for 24 hours, adding 10 μL of 1 M CaCl2 and continuing the reaction for another 24 hours, centrifuging at 13500 rpm for 15 minutes, washing the separated product with PBS, repeating the process three times, precipitating and then freeze-drying.

[0037] In this invention, the DNAzyme nucleic acid sequence is specifically: SEQ ID NO.1:TCAACATCAGTCTGATAAGCTAAACAGATCTCAACTCCGAGCCGGTCGAATAGCTTATCAGACTGA and SEQ ID NO.2:AGCAGCTAAGCTAGCTTATAAGCTAGGAAGAGATTGCTAGCTATGCTGC.

[0038] In this invention, the process of loading the DNAzyme nucleic acid sequence onto the surface of the manganese-doped calcium phosphate is as follows: 20 μL of 1 μM SEQ ID NO.1, 20 μL of 9 μM SEQ ID NO.2, and 10 μL of 450 μg / mL GOx-MnCaP are mixed for 20 minutes, followed by the addition of 25 μL of HEPES buffer and incubation at room temperature for another hour. Then, the mixture is centrifuged at 15000 rpm for 10 minutes to remove excess hairpin probes, thus obtaining the unloaded calcium nanoregulator.

[0039] In this invention, the HEPES buffer solution has a concentration of 20 mM and a pH of 7.2, and the HEPES buffer solution comprises 150 mM NaCl and 2 mM MgCl2.

[0040] In this invention, the conditions for loading DOX into the DNAzyme nucleic acid sequence are as follows: 10 μL of 5 μM DOX is mixed with the empty calcium nanoregulator and reacted at room temperature for 12 hours. Finally, the mixture is centrifuged at 9000 rpm for 10 min and washed to obtain the calcium nanoregulator (GOx-MnCaP-DD).

[0041] The present invention also provides a DNAzyme-based calcium nanometer regulator, which is obtained by the preparation method described in the above technical solution.

[0042] The present invention also provides an application of a DNAzyme-based calcium nanometer regulator, wherein the calcium nanometer regulator is the calcium nanometer regulator described in the above technical solution, and the application specifically refers to the use of the DNAzyme-based calcium nanometer regulator in the preparation of drugs for treating breast cancer.

[0043] In this invention, unless otherwise specified, all raw materials required for preparation are commercially available products well known to those skilled in the art.

[0044] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0045] Example 1

[0046] (1) Using glucose oxidase GOx as a template, manganese-doped calcium phosphate, namely GOx-MnCaP, was synthesized by a one-step biomimetic mineralization method. Specifically, 10 μL of 0.1M MnCl2·4H2O and 2 mg of GOx were dissolved in 1 mL of sugar-free DMEM and reacted at 37 °C for 24 hours. Then, 10 μL of 1M CaCl2 was added and the reaction continued for another 24 hours. The product was centrifuged at 13500 rpm for 15 minutes, and the separated product was washed with PBS three times. After precipitation, the product was freeze-dried.

[0047] (2) The DNAzyme nucleic acid sequence was loaded onto the surface of the manganese-doped calcium phosphate to obtain an empty calcium nano-regulator, namely GOx-MnCaP-D. Specifically, 20 μL of 1 μM SEQ ID NO.1, 20 μL of 9 μM SEQ ID NO.2 and 10 μL of 450 μg / mL GOx-MnCaP were mixed for 20 minutes, then 25 μL of HEPES buffer was added and incubated at room temperature for 1 hour. Then, the mixture was centrifuged at 15000 rpm for 10 minutes to remove the excess hairpin probe from the mixture, thus obtaining the empty calcium nano-regulator. The DNAzyme nucleic acid sequence included SEQ ID NO.1: TCAACATCAGTCTGATAAGCTAAACAGATCTCAACTCCGAGCCGGTCGAATAGCTTATCAGACTGA; SEQ ID NO.2: AGCACTAAGCTAGCTTATAAGCTA / rA / GGAAGAGATTGCTAGCTATGCTGC, where SEQ ID NO. The cleavage site in NO.2 is labeled with / rA / , as AGCAGTAAGCTAGCTTATAAGCTA / rA / GGAAGAGATTGCTAGCTATGCTGC; the HEPES buffer has a concentration of 20 mM and a pH of 7.2, and the HEPES buffer includes 150 mM NaCl and 2 mM MgCl2.

[0048] (3) Load DOX into the DNAzyme nucleic acid sequence to obtain the calcium nanoregulator, namely GOx-MnCaP-DD. Specifically, 10 μL of 5 μM DOX is mixed with the empty calcium nanoregulator and reacted at room temperature for 12 hours. Finally, the mixture is centrifuged at 9000 rpm for 10 min and washed to obtain the calcium nanoregulator.

[0049] Test Example 1

[0050] pH-responsive degradation of the DNAzyme-based calcium nanoregulator was tested.

[0051] 1 mg / mL NPs were immersed in PBS buffer solutions with glucose at pH 7.4, 6.2, and 5.4+ to simulate different biological environments for testing. The results are as follows: Figure 1 As shown, based on Figure 1 It can be seen that under pH 7.4 conditions, only a small amount of Ca can be detected after 12 hours of incubation. 2+ Its cumulative release was approximately 122.17 μg / mL; however, Ca was detected at a pH of 5.4. 2+ The burst release, Ca 2+The release rate reached 419.76 μg / mL, proving that GOx-MnCaP can disintegrate under acidic conditions; while under conditions of pH 5.4 + glucose, Ca... 2+ The release rate can reach 473.55 μg / mL because GOx reacts with glucose to produce gluconic acid, which can further promote the disintegration of GOx-MnCaP.

[0052] Test Example 2

[0053] The release rate of DOX from the DNAzyme-based calcium nanoregulator was investigated.

[0054] The release of DOX was experimentally investigated in the presence and absence of miRNA-21, and the results are as follows: Figure 2 As shown, based on Figure 2 It can be seen that in the absence of miRNA-21, the release of DOX was only 10% within 120 minutes. However, in the presence of miRNA-21, the release of DOX reached 78% within 50 minutes and 83% within 120 minutes; this demonstrates that in the presence of miRNA-21, DOX can be released in large quantities, resulting in a good anti-tumor effect.

[0055] Test Example 3

[0056] The ability of the DNAzyme-based calcium nanoregulator to generate ·OH was investigated.

[0057] Using methylene blue (MB) as an indicator, the ability of calcium nano-regulators to generate ·OH was tested. The groups were divided into a GOx-MnCaP group and a group co-incubated with H2O2 and GOx-MnCaP, and H2O2. The results are as follows: Figure 3 As shown, based on Figure 3 (a) It can be seen that when GOx-MnCaP and H2O2 are incubated, the absorbance of MB decreases significantly, while when treated with GOx-MnCaP or H2O2 alone, the absorbance of MB does not change significantly; based on Figure 3 (b) It is evident that MB was almost completely degraded after 180 minutes. These results indicate that GOx-MnCaP can undergo Mn degradation. 2+ The Fenton-like reaction mediated by GOx-MnCaP and the efficient generation of ·OH suggest the potential use of GOx-MnCaP for CDT.

[0058] Given that GOx can efficiently convert glucose into abundant hydrogen peroxide, this invention further verifies GOx-triggered glucose oxidation and Mn 2+ The cascade of Fenton-type mediated reactions yields the following results: Figure 3 As shown in (c), based on Figure 3(c) It is evident that MB is partially degraded in the presence of GOx-MnCaP and glucose, while the absorbance of MB does not change significantly when treated with glucose alone. These results indicate that GOx-induced glucose oxidation can initiate Mn... 2+ The Fenton-like reaction mediated by the medium leads to the degradation of MB.

[0059] Test Example 4

[0060] The sensitivity of the DNAzyme-based calcium nanomodulator was tested.

[0061] Different concentrations of miRNA-21 were added and tested, and the results are as follows: Figure 4 As shown, based on Figure 4 (a) It can be seen that the fluorescence intensity signal increases with the increase of miRNA-21 concentration; based on Figure 4 (b) It can be seen that the change in fluorescence value in the range of 0-60 nM is positively linearly correlated with the logarithm of miRNA-21 concentration.

[0062] Test Example 5

[0063] The selectivity of the DNAzyme-based calcium nanomodulator was tested.

[0064] Experiments were conducted using interfering RNAs (RNA1, RNA2, RNA3, miR-200b, let-7a, miR-429), miR-21, and a control group, all at a concentration of 60 nM. Corresponding fluorescence spectra were obtained, and the results are as follows: Figure 5 As shown, based on Figure 5 It can be seen that the fluorescence intensity of miRNA-21 is significantly higher than that of other interfering RNAs, indicating that the calcium nanoregulator described in this invention has high specificity and good selectivity.

[0065] Test Example 6

[0066] The antitumor activity of the DNAzyme-based calcium nanomodulator was tested.

[0067] First, the accumulation and retention capacity of GOx-MnCaP-DD at tumor sites was investigated, and its in vivo fluorescence imaging results are as follows: Figure 6 As shown, Figure 6 (a) Fluorescence images of mice at different time points (0.5, 2, 4, 6, 8, 10, 12, 24, 36 and 48 h) after intravenous injection of GOx-MnCaP-DD. Figure 6 (b) Fluorescence images of the tumor and organs at the end of imaging (48 h after injection);

[0068] based on Figure 6(a) It is known that within 2-6 hours after injection of GOx-MnCaP-DD, due to the EPR effect, a gradual accumulation of Cy5.5 fluorescence can be observed at the tumor site. Based on this, the GOx-MnCaP-DD described in this invention is used as a fluorescent imaging agent for directly tracking tumor treatment. Furthermore, analysis of the fluorescence images at the tumor site shows that a clear Cy5.5 fluorescence signal appears 2 hours after GOx-MnCaP-DD injection, reaches its peak at 6 hours, and fluorescence can still be detected at the tumor site 48 hours later. Figure 6 (b) It can be seen that the tumors of mice in the GOx-MnCaP-DD group can emit strong fluorescence, indicating the effective accumulation and high retention of GOx-MnCaP-DD.

[0069] Test Example 7

[0070] The tumor-suppressive effect of the DNAzyme-based calcium nanomodulator in vivo was investigated.

[0071] Anti-cancer evaluation was conducted using a 4T1 tumor nude mouse model, with a tumor volume of approximately 100 mm. 3 Nude mice with 4T1 tumors were randomly divided into five groups (n=4 per group) and intravenously injected with PBS, GOx, MnCaP, GOx-MnCaP, and GOx-MnCaP-DD on days 1, 3, and 5, respectively. To evaluate the antitumor efficacy, the body weight and tumor volume of the mice were measured continuously, and the results are as follows: Figure 7 As shown, where, Figure 7 (a) shows the changes in the tumor during treatment. Figure 7 (b) shows the changes in mouse body weight during treatment. Figure 7 (c) are digital photographs of the mice before and after treatment;

[0072] based on Figure 7 (a) It can be seen that after two weeks of observation, the tumors in the PBS group rapidly increased in size, reaching 5 times the size of those in the final treatment group. Although MnCaP and GOx-MnCaP have anti-tumor effects, their inhibitory effects are limited, reflecting that a single treatment approach cannot produce satisfactory efficacy. Compared with other groups, GOx-MnCaP-DD significantly reduced tumor burden and inhibited tumor growth in the long term.

[0073] based on Figure 7 (b) It can be seen that: during the treatment process, the body weight of mice in each treatment group did not change significantly, which proves the safety of the treatment;

[0074] based on Figure 7 (c)-(d) show that by comparing the mouse photos at the end of the treatment cycle with the digital photos of the isolated tumors, the tumors in the GOx-MnCaP-DD group were the smallest, which fully demonstrates the good tumor inhibition effect.

[0075] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A method for preparing a calcium nanoregulator based on DNAzyme, characterized in that, The preparation method comprises the following steps: Using glucose oxidase GOx as a template, manganese-doped calcium phosphate GOx-MnCaP was synthesized via a one-step biomimetic mineralization method. DNAzyme nucleic acid sequences were loaded onto the surface of the manganese-doped calcium phosphate to obtain empty calcium nanoregulators; DOX was loaded into the DNAzyme nucleic acid sequence to obtain the DNAzyme-based calcium nanoregulator; The specific DNAzyme nucleic acid sequences are: SEQ ID NO.1:TCAACATCAGTCTGATAAGCTAAACAGATCTCAACTCCGAGCCGGTCGAATAGCTTATCAGACTGA and SEQ ID NO.2:AGCAGCTAAGCTAGCTTATAAGCTAGGAAGAGATTGCTAGCTATGCTGC.

2. The method for preparing the DNAzyme-based calcium nanoregulator according to claim 1, characterized in that, The one-step biomimetic mineralization method for synthesizing manganese-doped calcium phosphate specifically involves dissolving 10 μL of 0.1 M MnCl2·4H2O and 2 mg of GOx in 1 mL of sugar-free DMEM, reacting at 37 °C for 24 hours, adding 10 μL of 1 M CaCl2 and continuing the reaction for another 24 hours, centrifuging at 13500 rpm for 15 minutes, washing the separated product with PBS three times, precipitating and then freeze-drying.

3. The method for preparing the DNAzyme-based calcium nanoregulator according to claim 1, characterized in that, The process of loading the DNAzyme nucleic acid sequence onto the surface of manganese-doped calcium phosphate is as follows: 20 μL of 1 μM SEQ ID NO.1, 20 μL of 9 μM SEQ ID NO.2 and 10 μL of 450 μg / mL GOx-MnCaP are mixed for 20 minutes, then 25 μL of HEPES buffer is added and incubated at room temperature for another hour. After that, the mixture is centrifuged at 15000 rpm for 10 minutes to remove excess hairpin probes, thus obtaining the unloaded calcium nanoregulator.

4. The method for preparing the DNAzyme-based calcium nanoregulator according to claim 3, characterized in that, The HEPES buffer solution has a concentration of 20 mM and a pH of 7.2, and includes 150 mM NaCl and 2 mM MgCl2.

5. The method for preparing the DNAzyme-based calcium nanoregulator according to claim 1, characterized in that, The conditions for loading DOX into the DNAzyme nucleic acid sequence are as follows: 10 μL of 5 μM DOX is mixed with the empty calcium nanoregulator, reacted at room temperature for 12 hours, and finally washed after centrifugation at 9000 rpm for 10 min to obtain the DNAzyme-based calcium nanoregulator.

6. A calcium nanoregulator based on DNAzyme, characterized in that, The DNAzyme-based calcium nanoregulator is obtained by the preparation method described in any one of claims 1 to 5.

7. An application of a DNAzyme-based calcium nanoregulator, characterized in that, The calcium nanometer regulator is the DNAzyme-based calcium nanometer regulator as described in claim 6, and the application specifically refers to the use of the DNAzyme-based calcium nanometer regulator in the preparation of drugs for treating breast cancer.

Citation Information

Patent Citations

  • Application of glucose oxidase-iron doped calcium phosphate nano composite material loaded with tirapazamine

    CN117462659A

  • Multi-channel Ca < 2 + > nano modulator based on nucleic acid as well as preparation method and application of multi-channel Ca < 2 + > nano modulator

    CN118903446A