B cell conservative epitope peptide of self-transcription protein A of swine Lawsonia intracellularis and application of B cell conservative epitope peptide in diagnosis

Abstract

The invention discloses a B cell conservative epitope peptide on self-transcription protein A (LatA) of porcine intracellular Lawsonia suis (LI) and application of the B cell conservative epitope peptide in LI specific antibody diagnosis. The sequence of the B cell conservative epitope peptide of the LatA is NGNGNPAN, and the B cell conservative epitope peptide of the LatA is named as NN8. The B cell conservative epitope peptide can be functionally displayed and expressed on the surface of an inert carrier S9H thallus, an NN8-antibody direct mediated agglutination test established on the basis of S9H thallus surface display and expression is adopted, and NN8 specifically recognizes an LI antibody and has no cross reaction with serum antibodies of other swine infectious diseases. Animal test results show that the method can detect the specific serum antibody 7 days after the Balb / c mouse is infected by the attenuated strain and immunized by the vaccine. The diagnosis method is high in specificity, good in sensitivity, convenient to operate and visual in result judgment, and is expected to become a technical means for LI infection visual on-site accurate and convenient diagnosis and vaccine evaluation.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedical and immunodiagnostic detection, and particularly relates to a B-cell conserved epitope peptide of Lawsonia intracellularis autotranscription protein A and its application in the diagnosis of Lawsonia intracellularis antibodies, and more particularly to the use of the characteristic sequence NGNGNPAN (NN8) of the B-cell conserved epitope peptide on the surface autotranscription protein A of Lawsonia intracellularis and the NN8-antibody direct-mediated agglutination test to detect specific antibodies in pigs infected with or immunized against Lawsonia intracellularis, and to accurately diagnose Lawsonia intracellularis infection and evaluate the potential application of vaccines. Background Art

[0002] Lawsonia intracellularis (LI) in pigs is the pathogen that causes porcine proliferative enteritis. The infection of Lawsonia intracellularis in pigs can lead to pathological changes such as hyperplasia, hemorrhage, and necrosis in the large intestine of diseased pigs, resulting in impaired intestinal nutrient absorption and seriously affecting the production performance of pigs. When the integrity of the intestinal mucosa is damaged, it is extremely easy to secondary bacterial or fungal infections (especially Gram-negative bacteria and anaerobes), so the fatality rate caused by Lawsonia intracellularis infection in pigs is relatively high. Lawsonia intracellularis is a species of the genus Lawsonia in the family Desulfovibrionaceae. It is an obligate intracellular proliferating, motile, Gram-negative curved bacillus, mainly existing in the apical cytoplasm of infected intestinal cells. Lawsonia intracellularis can infect a variety of domestic and wild animals, such as pigs, horses, rabbits, hamsters, deer, ferrets, etc. The main transmission mode of Lawsonia intracellularis in pigs is through the fecal-oral route within the pig population. A large number of pathogenic Lawsonia intracellularis can be present in the feces of diseased pigs, and the contamination of feces to feed, drinking water, etc. can lead to the spread of the disease. In terms of disease diagnosis, there are no indicative clinical symptoms after Lawsonia intracellularis infection in pigs, and Lawsonia intracellularis infection cannot be directly diagnosed through clinical symptoms. Its clinical symptoms are easily confused with those of other gastrointestinal diseases, which makes it difficult for front-line staff to make an accurate diagnosis and unable to determine effective treatment or prevention and control plans in a timely manner. Lawsonia intracellularis infection seriously affects the development of the pig industry worldwide. Through research, it is found that the current detection methods for Lawsonia intracellularis in pigs have limited specificity and sensitivity. Although necropsy can increase the accuracy of diagnosis, for early establishment of prevention and control measures, accurate diagnosis of Lawsonia intracellularis infection before death is very important for the treatment of the disease and the prevention and control of the epidemic situation. In terms of bacterial isolation and identification, Lawsonia intracellularis is difficult to culture in vitro and needs to grow in a specific growth environment and cells, which hinders the application of bacterial isolation and identification in disease diagnosis; polymerase chain reaction (PCR) can be used to detect the bacterial DNA in feces to indicate Lawsonia intracellularis infection, but its low detection sensitivity and high cost limit PCR as a routine diagnostic tool for Lawsonia intracellularis infection; serological detection is a simple method for pre-mortem diagnosis. The serological detection methods reported in the literature that can be used for Lawsonia intracellularis infection in pigs include peroxidase monolayer assay (IPMA), indirect immunofluorescent antibody test (IFAT), and enzyme-linked immunosorbent assay (ELISA). However, the serological detection methods reported currently are cumbersome to operate, require laboratory instruments and professional technical personnel, and cannot achieve rapid and accurate diagnosis at the clinical front line. In addition, there are technical bottlenecks in specificity and sensitivity in the current traditional serological methods. Because the complete protein antigen contains a large number of redundant protein components, background reactions, non-specific reactions, etc. will occur during the detection process; the protein antigen is coated on the solid-phase carrier, and the limited coating area limits the amount of protein antigen that this method can carry (the antigen concentration and molecular number are limited); all these detection methods lack an objective control for each sample, and only having a system control cannot obtain a clear diagnosis result for each sample.Therefore, it is necessary to study the detection method of Lawsonia intracellularis in pigs so that it can quickly and accurately diagnose Lawsonia intracellularis infection at the clinical front line. Summary of the Invention

[0003] Object of the Invention: The technical problem to be solved by the present invention is to provide a B-cell conserved epitope peptide on the surface autotranscriptional protein A of Lawsonia intracellularis in pigs.

[0004] Another technical problem to be solved by the present invention is to provide a nucleic acid molecule encoding the B-cell conserved epitope peptide.

[0005] Another technical problem to be solved by the present invention is to provide a recombinant gene DNA fragment containing the nucleic acid molecule.

[0006] Another technical problem to be solved by the present invention is to provide an expression cassette, a recombinant vector, a recombinant cell or a recombinant strain containing the nucleic acid molecule or the recombinant gene DNA fragment.

[0007] Another technical problem to be solved by the present invention is to provide a Lawsonia intracellularis-specific antibody detection system containing an expression cassette, a recombinant vector, a recombinant cell or a recombinant strain.

[0008] Another technical problem to be solved by the present invention is to provide a method for constructing a recombinant vector or a recombinant strain.

[0009] Another technical problem to be solved by the present invention is to provide the application of the B-cell conserved epitope peptide, the nucleic acid molecule, the recombinant gene DNA fragment, the expression cassette, the recombinant vector, the recombinant cell or the recombinant strain, and the detection system in the preparation of a Lawsonia intracellularis-specific antibody detection reagent or kit.

[0010] The last technical problem to be solved by the present invention is to provide a Lawsonia intracellularis-specific antibody detection reagent or kit.

[0011] Technical Solution: To solve the above technical problems, in the first aspect of the present invention, a B-cell conserved epitope peptide on the surface autotranscriptional protein A (LatA) of Lawsonia intracellularis in pigs is provided. The amino acid sequence of the B-cell conserved epitope peptide is NGNGNPAN, named NN8.

[0012] In the second aspect of the present invention, a nucleic acid molecule encoding the B-cell conserved epitope peptide of LatA is provided. The DNA sequence of the nucleic acid molecule of the B-cell conserved epitope peptide is AATGGTAATGGAAATCCAGC CAAC, named AC24.

[0013] The third aspect of the present invention provides a recombinant gene DNA fragment, which is obtained by introducing the nucleic acid molecule into the coding gene sequence of the Peg pilus operon, and the sequence of the recombinant gene DNA fragment is as shown in SEQ ID NO.1.

[0014] The fourth aspect of the present invention provides an expression cassette, a recombinant vector, a recombinant cell or a recombinant strain, which contains the nucleic acid molecule of the B cell conserved epitope peptide or the recombinant gene DNA fragment. Among them, the recombinant strain is obtained by introducing the recombinant vector into a carrier bacterium.

[0015] The fifth aspect of the present invention provides a detection system for specific antibodies against Lawsonia intracellularis in pigs, and the detection system for specific antibodies against Lawsonia intracellularis in pigs includes the expression cassette, the recombinant vector, the recombinant cell or the recombinant strain.

[0016] The sixth aspect of the present invention provides a method for constructing the recombinant vector, which includes the following steps:

[0017] (1) Obtaining the DNA sequence of the nucleic acid molecule of the B cell conserved epitope peptide of the surface autotranscriptional protein A of Lawsonia intracellularis in pigs; the DNA sequence is AATGGTAATGGAAATCCAGCCAAC;

[0018] (2) Introducing the DNA sequence obtained in step (1) into the coding gene sequence of the Peg pilus operon to construct a recombinant gene DNA fragment; the sequence of the recombinant gene DNA fragment is as shown in SEQ ID NO.1;

[0019] (3) Connecting the recombinant gene DNA fragment obtained in step (2) to a vector to construct a recombinant vector.

[0020] The seventh aspect of the present invention provides a method for constructing the recombinant strain, which is obtained by introducing the recombinant vector into an inert carrier bacterium by electroporation.

[0021] The eighth aspect of the present invention provides the application of the B cell conserved epitope peptide, the nucleic acid molecule, the recombinant gene DNA fragment, the expression cassette, the recombinant vector, the recombinant cell, the recombinant strain or the detection system for specific antibodies against Lawsonia intracellularis in pigs in the preparation of detection reagents or kits for specific antibodies against Lawsonia intracellularis in pigs.

[0022] The ninth aspect of the present invention provides a detection reagent or kit for specific antibodies against Lawsonia intracellularis in pigs, and the reagent or kit includes the B cell conserved epitope peptide, the nucleic acid molecule, the recombinant gene DNA fragment, the expression cassette, the recombinant vector, the recombinant cell, the recombinant strain or the detection system.

[0023] Beneficial effects: Compared with existing detection technologies, the present invention has the following significant advantages: The B-cell conserved epitope peptide NN8 of LatA of the present invention is derived from the conserved antigen epitope determinant domain of LatA. By using the Peg pilus to display and express the functional B-cell conserved epitope peptide NN8, an agglutination assay based on the direct mediation of NN8-antibody is established to detect LI antibodies in LI-infected pigs. The functional B-cell conserved epitope peptide NN8 displayed and expressed on the surface of the bacteria specifically recognizes and binds to LI antibodies, thereby achieving specific, convenient and rapid detection of LI antibodies. The specific antibody detection system for Lawsonia intracellularis in pigs only has a specific binding reaction with LI antibodies, and does not have cross-reactions and non-specific reactions with antibodies of other infectious disease pathogens in pigs. Specific serum antibodies can be detected by the present invention 7 days after vaccination, and LI antibodies in the pig herd can be detected by the technical method of the present application. In view of the characteristics of strong specificity, good sensitivity and simple operation of the present invention, it is convenient for clinical promotion and application, and is expected to become an important technical means for evaluating the immune protection level of LI vaccines and detecting LI infections. Brief Description of the Drawings

[0024] Figure 1 It is a comparison result diagram of the conservation and specificity of the B-cell conserved epitope peptide of LatA;

[0025] Figure 2 It is a predicted result diagram of the three-dimensional structure of AlphaFold 3 of LatA;

[0026] Figure 3 It is an electrophoresis diagram of PCR amplification identification of the recombinant gene DNA fragment Peg-LatA-NN8 into which the B-cell conserved epitope peptide of LatA is introduced. Among them, lane M is Trans 2K Plus II DNA Marker, lane 1 is the PCR amplification product of the Peg pilus operon gene, and the template DNA comes from the standard strain CVCC 526 of Salmonella pullorum as a positive control. Lane 2 is the PCR amplification product of Peg-LatA-NN8 (4847bp), and lane 3 is the genome of the avian pathogenic Escherichia coli isolate APEC-XM as a negative control;

[0027] Figure 4Electrophoresis identification diagram of the recombinant vector pBR-Peg-LatA-NN8 containing Peg-LatA-NN8. Lane M1 is 1 kb DNA Ladder (TransGen Biotech); Lane 1 is the circular plasmid pBR322; Lane 2 is the recombinant vector pBR-Peg-LatA-NN8 (circular recombinant plasmid); Lane 3 is the product of double digestion of pBR-Peg-LatA-NN8 with Nhe I and BamH I; Lane M2 is Trans 2K Plus II DNA Marker (TransGen Biotech);

[0028] Figure 5 Schematic diagram of the recombinant vector pBR-Peg-LatA-NN8 containing Peg-LatA-NN8;

[0029] Figure 6 Results diagram of the agglutination reaction of the LI antibody specific detection system S9H-pBR-Peg-LatA-NN8 and the control system S9H-pBR-Peg with LI antibody positive serum, other pathogen antibody positive serum or negative serum respectively. A: Agglutination reaction results of S9H-pBR-Peg (left), S9H-pBR-Peg-LatA-NN8 (right) with LI immune antibody positive serum respectively, and the red arrow indicates agglutination particles; B: Neither S9H-pBR-Peg (left) nor S9H-pBR-Peg-LatA-NN8 (right) agglutinates with porcine reproductive and respiratory syndrome virus immune antibody positive serum; C: Neither S9H-pBR-Peg (left) nor S9H-pBR-Peg-LatA-NN8 (right) agglutinates with porcine mycoplasma pneumoniae immune antibody positive serum; D: Neither S9H-pBR-Peg (left) nor S9H-pBR-Peg-LatA-NN8 (right) agglutinates with porcine mycoplasma hyorhinis immune antibody positive serum; E: Neither S9H-pBR-Peg (left) nor S9H-pBR-Peg-LatA-NN8 (right) agglutinates with SPF pig serum; F: Neither S9H-pBR-Peg (left) nor S9H-pBR-Peg-LatA-NN8 (right) agglutinates with porcine pseudorabies virus immune antibody positive serum; G: Neither S9H-pBR-Peg (left) nor S9H-pBR-Peg-LatA-NN8 (right) agglutinates with classical swine fever virus immune antibody positive serum; H: Neither S9H-pBR-Peg (left) nor S9H-pBR-Peg-LatA-NN8 (right) agglutinates with murine Escherichia coli immune antibody positive serum. Detailed implementation methods

[0030] Before further describing the specific embodiments of the present invention, it should be understood that the protection scope of the present invention is not limited to the following specific embodiments. It should also be understood that the terms used in the embodiments of the present invention are for describing specific embodiments and not for limiting the protection scope of the present invention. For the test methods without specific conditions indicated in the following embodiments, they are generally carried out under conventional conditions or according to the conditions recommended by each manufacturer.

[0031] When the embodiments give a numerical range, it should be understood that unless otherwise specified in the present invention, any value at both ends of each numerical range and any value between the two ends can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those skilled in the art of this technology. In addition to the specific methods, devices, and materials used in the embodiments, according to the knowledge of those skilled in the art of this technology and the description of the present invention, any methods, devices, and materials similar to or equivalent to the methods, devices, and materials described in the embodiments of the present invention can also be used to implement the present invention.

[0032] Example 1 Prediction of B-cell epitope peptides of Lawsonia intracellularis autotransporter protein A (LatA) in pigs and selection of dominant B-cell conserved epitope peptides

[0033] Currently, there are only three complete gene sequences of Lawsonia intracellularis in pigs published in the National Center for Biotechnology Information database (NCBI, https: / / www.ncbi.nlm.nih.gov / ), namely PHE / MN1-00 (NC008011.1), N343 (NC_020127.1), and PPE-GX01-2022 (NZ_CP107054.1). The amino acid sequences of LatA of the three strains are PHE / MN1-00 (WP_011526732.1), N343 (WP_011526732.1), and PPE-GX01-2022 (WP-113613183.1). The amino acid sequences of these 3 LatA proteins were aligned and analyzed for identity using (DNAStar MegAlign) software. The results showed that the identity of the amino acid sequences of the LatA protein was 99.9% ± 0.1%, indicating that the amino acid sequences of LatA are highly conserved among various strains.

[0034] The B-cell epitope peptide prediction of the above amino acid sequence was performed using the online B-cell epitope peptide prediction software BepiPred-2.0 (http: / / tools.iedb.org / bcell / ). This software scores each amino acid residue, sets a threshold of 0.6, and optimizes the amino acid residues. The polypeptide composed of consecutive amino acid residues with scores higher than the threshold is defined as the B-cell epitope peptide. The results showed that the LatA passenger domain (amino acids 35-546) contains 4 B-cell linear epitope peptides (Table 1), which are 62 VGPNPIAS 69 , 95 NGNGNPAN 102 , 165 PNEDQLVG 172 , 279 NRIANIFAS 287 . The conservation analysis of the above B-cell epitope peptides was performed using the MEGA 11 bioinformatics software. Among the 3 different LatA amino acid sequences, the amino acid sequences of the above epitope peptides are completely identical, showing good conservation.

[0035] To ensure the specificity of the selected B-cell conserved epitope peptide of LatA among other porcine intestinal bacterial pathogen epitope peptides and to avoid cross-reaction with other pathogen serum antibodies, the B-cell conserved epitope peptide of LatA was aligned with the amino acid sequences of self-transcribed proteins of Salmonella suis, Haemophilus parasuis, Escherichia coli, Actinobacillus suis, and Pasteurella multocida using the MEGA 11 bioinformatics software; and the B-cell conserved epitope peptide with the highest amino acid score (average amino acid residue score) was selected for constructing a specific detection method applicable to antibodies against multiple different LI strains. The above alignment results are shown in Figure 1 . Subsequently, the three-dimensional structure of LatA was predicted by AlphaFold 3 (https: / / deepmind.google / technologies / alphafold / alphafold-server / ). The analysis results showed that ( Figure 2 ), the predicted B-cell conserved epitope peptide 2 of LatA is located on the protein surface, with good exposure of hydrophilic amino acid residues and no other structural shielding. Finally, the specific B-cell conserved epitope peptide NN8 was determined for constructing the LI-specific antibody detection system. The amino acid sequence of the B-cell conserved epitope peptide NN8 is NGNGNPAN, and the DNA sequence is AATGGTAATGGAAATCCAGCCAAC.

[0036] Table 1. Prediction results of B-cell epitope peptides of LatA

[0037]

[0038] Example 2: Construction of a recombinant strain presenting the B-cell conserved epitope peptide NN8 of LatA and verification of its functional expression

[0039] The nucleic acid molecule AC24 (AATGGTAATGGAAATCCAGCCAAC) of the B-cell conserved epitope peptide NN8 of LatA was introduced into the gene sequence encoding the Salmonella Peg pilus operon, and then ligated to the pBR322 plasmid to construct the recombinant vector pBR-Peg-LatA-NN8. Subsequently, the recombinant vector was transferred into an inert vector bacterium to verify the functional NN8 presented on the surface of the inert vector bacterium.

[0040] The specific implementation procedure is as follows: The recombinant gene DNA fragment obtained by replacing the site GTGAAACCGGATGAGGCGGGGAAT of the Peg pilus operon gene sequence (the reference sequence of the Peg pilus operon gene sequence is Salmonella enterica CYX strain, GenBank accession number CP 113540.1, 1702724-1707552) with LatA-NN8 was named Peg-LatA-NN8. The nucleotide sequence of the Peg-LatA-NN8 recombinant gene DNA fragment is shown in SEQ ID NO.1, and the Peg-LatA-NN8 (4829bp) recombinant gene was synthesized by Nanjing Tsingke Biotechnology Co., Ltd.

[0041] Based on the Salmonella enterica CYX strain Peg pilus operon gene sequence, primers for amplifying the Peg pilus operon were designed. The upstream primer Peg-F: 5'-CGC GCTAGC ATGAAACGTTCACTT ATTGCTGCT-3'; the downstream primer Peg-R: 5'-CGT GGATCCTTAATTATAAGATACCACG ATTAATGC-3'. The underlined sequences represent the Nhe I and BamH I restriction enzyme cleavage sites respectively, and were synthesized by Nanjing Tsingke Biotechnology Co., Ltd. Using the above recombinant gene DNA fragment as a template (SEQ ID NO.1, 1 μL, containing 1 ng of the chimeric gene), the genome of the standard strain CVCC 526 of Salmonella pullorum (purchased from the China Institute of Veterinary Drug Control, China Veterinary Microbial Culture Collection Center) was used as a positive control, and the genome of the avian pathogenic Escherichia coli isolate APEC-XM (Liu Jiaqi, Wu Hucong, Yin Yi, Zhang Dong, Xia Pengpeng, Ren Wenkai, Zhu Guoqiang. Construction of a mouse model of neonatal Escherichia coli meningitis caused by avian Escherichia coli [J]. China Poultry, 2019, 41(10): 26-30.) was used as a negative control. PCR amplification was carried out using upstream and downstream primers. The amplification system was: pfu high-fidelity DNA Polymerase (Beijing TransGen Biotech Co., Ltd., 2.5 U / μL) 2 μL, 5×pfu DNA polymerase buffer 10 μL, dNTPs 5 μL, upstream and downstream primers (10 mM) 2 μL each, recombinant gene DNA fragment (1 ng / μL) or APEC-XM genome (250 ng / μL) or CVCC 526 genome (250 ng / μL) 2 μL, ultrapure water 27 μL. After mixing the above system evenly, PCR amplification was carried out using a thermal cycler (Bio-Red). The program was as follows: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 52 °C for 30 s, and extension at 72 °C for 2 min, for a total of 30 cycles, followed by further amplification at 72 °C for 10 min. After the amplification was completed, the temperature was lowered to 12 °C. A 1.5% agarose gel was prepared, electrophoresed at 100 V for 50 min, stained with ethidium bromide, and imaged under a UV imager. The PCR results were as Figure 3 shown. The PCR product of Peg-LatA-NN8 was: 4847 bp; the amplification size of the positive control was 4850 bp; there was no amplification band in the negative control. The PCR amplification product (4847 bp) of Peg-LatA-NN8 was recovered using a universal DNA purification kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.).

[0042] The PCR amplification products of Peg-LatA-NN8 and the pBR322 plasmid were respectively double digested with Nhe I and BamH I restriction endonucleases (NEB), and then the above linear DNA fragments were ligated overnight at 16 °C in a metal bath using T4 DNA ligase (NEB). Ligation system: 2 μL of pBR322 plasmid (27.4 ng / μL), 6 μL of Peg-LatA-NN8 fragment (45.5 ng / μL), 1 μL of T4 DNA ligase (NEB, 400 U / μL), 2.5 μL of 10×T4 DNA Ligase Reaction Buffer, 13.5 μL of ddH2O, for a total of 25 μL ligation system. The next day, the ligation product was transformed into S9H competent cells (S9H inert vector bacteria are from Chinese invention patent ZL202010427735.8, a pan-type inert vector Salmonella and its potential applications), and resistance screening was carried out by spreading on a solid medium containing 100 μg / mL ampicillin. Single colonies on the plate were picked and inoculated into LB liquid medium containing 100 μg / mL ampicillin and grown to the stationary phase. After recovering the plasmid, it was identified by double digestion with two restriction endonucleases, Nhe I and BamH I. Prepare a 1.0% agarose gel, electrophorese at 100 V for 50 min, stain with ethidium bromide, and image under an ultraviolet imager. The results are as Figure 4 shown. The double digestion products of Nhe I and BamH I of the recombinant vector pBR-Peg-LatA-NN8 contain a 4215 bp linear vector and a 4835 bp Peg-LatA-NN8 linear DNA fragment, which are consistent with the expected size. The schematic diagram of the recombinant vector pBR-Peg-LatA-NN8 is as Figure 5 shown, and the recombinant bacterium S9H-pBR-Peg-LatA-NN8 was screened.

[0043] The recombinant bacterium S9H-pBR-Peg-LatA-NN8 was grown to the stationary phase in LB liquid medium containing 100 μg / mL ampicillin, centrifuged at 4000 rpm for 5 min, and the supernatant was discarded. It was resuspended with an equal volume of sterile normal saline, and this method was continuously centrifuged and washed 2 times to prepare a bacterial suspension (final concentration was 1×10 10 CFU / mL). The bacterial suspension of the recombinant bacterium S9H-pBR-Peg-LatA-NN8 was respectively subjected to glass slide agglutination tests with LI antibody-negative serum (20 parts of SPF pig serum provided by the Animal Hospital of Zhejiang A&F University), Salmonella Peg antibody-positive serum (10 parts, prepared and stored by this experiment), and LI immune antibody-positive serum (10 clinical samples, provided by Nanjing Agricultural University and Jiangsu Huawit Biopharmaceutical Co., Ltd. respectively), and the S9H engineering bacteria containing only pBR-Peg (final concentration was 1×1010 The bacterial suspension of S9H engineered bacteria containing pBR-Peg (derived from Chinese Invention Patent ZL202211488632.8, the target antigen of the B cell epitope of the novel coronavirus receptor binding domain and its expression and application in the display of Peg pili) was used as a negative control. The results are shown in Table 2. The bacterial suspensions of both strains did not react with the LI antibody negative serum; the bacterial suspensions of both strains showed agglutination reactions with the Peg antibody positive serum, indicating that functional Peg was successfully displayed on the surface of the inert carrier bacteria; the bacterial suspension of the recombinant S9H engineered bacteria S9H-pBR-Peg-LatA-NN8 carrying the recombinant vector pBR-Peg-LatA-NN8 showed obvious agglutination with the LI antibody positive serum, with large agglutination particles and a clear background; while the bacterial suspension of the S9H engineered bacteria S9H-pBR-Peg containing only pBR-Peg did not show agglutination with the LI antibody positive serum, without agglutination particles, and the background was uniformly turbid. The results indicate that the B cell conserved epitope peptide NN8 from the LatA protein can achieve functional display expression on the cell surface through Peg pili and can specifically recognize and detect the LI antibody.

[0044] In this antibody detection system, the S9H-pBR-Peg bacterial suspension was used as a control system. Only the B cell conserved epitope peptide NN8 of LatA was added to the antibody detection system. S9H-pBR-Peg-LatA-NN8 can specifically recognize and bind to specific antibodies, thus ensuring accurate diagnosis of each sample and verifying that the B cell conserved epitope peptide NN8 is the key structure for recognizing and binding to specific antibodies of Lawsonia intracellularis in pigs.

[0045] Table 2. Functional verification of the display expression of Peg-LatA-NN8 on the surface of the inert carrier bacteria S9H

[0046]

[0047] Note: “-(100%)” indicates a negative agglutination reaction (no agglutination particles, turbid background), and all samples showed no agglutination at 100%; “+(100%)” represents a positive agglutination reaction (large agglutination particles, clear background), and all samples showed agglutination at 100%.

[0048] Example 3. Cross-reaction test and specificity evaluation of the LI antibody specific detection system

[0049] Based on the functional verification of the S9H-pBR-Peg-LatA-NN8 recombinant strain with the LatA functional B cell conserved epitope peptide NN8 displayed and expressed on the surface of the inert carrier bacteria S9H, the cross-reaction of the LI antibody specific detection system was tested and its detection specificity was evaluated. The specific implementation procedures are as follows:

[0050] Prepare the control system S9H-pBR-Peg bacterial suspension and S9H-pBR-Peg-LatA-NN8 bacterial suspension (both with a final concentration of 1×10 10 CFU / mL) according to the method described in Example 2. Conduct agglutination tests with antibody-positive sera of different pathogens respectively. The sera to be detected include: 4 portions of porcine sera positive for LI immune antibodies (provided by Taizhou Huawit Biotechnology Co., Ltd.), 5 portions of porcine sera positive for porcine reproductive and respiratory syndrome virus (PRRSV) immune antibodies (provided by Zhejiang Meibaolong Biotechnology Co., Ltd.), 20 portions of porcine sera positive for Mycoplasma hyopneumoniae immune antibodies (provided by Taizhou Huawit Biotechnology Co., Ltd.), 4 portions of porcine sera positive for Mycoplasma hyorhinis immune antibodies (provided by Yangzhou Youbang Biopharmaceutical Co., Ltd.), 20 portions of SPF porcine sera (provided by the Animal Hospital of Zhejiang A&F University), 5 portions of porcine sera positive for pseudorabies virus immune antibodies (provided by Zhejiang Meibaolong Biotechnology Co., Ltd.), 2 portions of porcine sera positive for classical swine fever virus immune antibodies (provided by Jilin University), and 6 portions of murine sera positive for Escherichia coli immune antibodies (prepared and stored in our laboratory). The test results are shown in Table 3, and the agglutination results of some samples are shown in the appendix Figure 6 . The LI antibody-specific detection system only has specific agglutination reactions with LI immune antibody-positive sera and does not have cross-reactions with other infectious disease vaccine immune antibody-positive sera, indicating that the detection system has good specificity.

[0051] Table 3. Specificity verification results of the LI antibody-specific detection system

[0052]

[0053] Note: "-" indicates that all sample agglutination reactions are negative; "+(100%)" indicates that all sample agglutination reactions are positive.

[0054] Example 4. Sensitivity test of the LI antibody-specific detection system

[0055] To evaluate the detection sensitivity of the LI antibody-specific detection system, design the following animal experiment. Immunize four-week-old female Balb / c mice (female Balb / c mice are purchased from the Experimental Animal Center of Yangzhou University) with the live porcine ileitis vaccine ( Ileitis) of Boehringer Ingelheim. The oral immunization dose for each mouse is 0.5 mL, and a total of 4 mice are immunized. Collect mouse sera (at 0 day, 7 days, and 14 days) to evaluate the early detection ability of the detection system and its detection sensitivity. Prepare the control system S9H-pBR-Peg bacterial suspension and the detection system S9H-pBR-Peg-LatA-NN8 bacterial suspension (both with a final concentration of 1×10 10CFU / mL). Agglutination tests were performed on the above two bacterial suspensions with mouse serum respectively, and the test results are shown in Table 4.

[0056] Table 4. Sensitivity test results of the LI antibody specific detection system

[0057]

[0058] Note: Control system: S9H-pBR-Peg, detection system: S9H-pBR-Peg-LatA-NN8; "-" indicates negative agglutination reaction; dpi: days post-immunization.

[0059] As can be seen from Table 4, the LI antibody specific detection system detected serum antibodies 7 days after immunization. As time went by, the serum antibody titer increased steadily. This detection method has good sensitivity and can quantify the dynamic trend of serum antibody production.

Claims

1. B cell conserved epitope peptide of Lawsonia intracellularis surface autotranscription protein A of swine, characterized in that, The amino acid sequence of the B-cell conserved epitope peptide is NGNGNPAN.

2. A nucleic acid molecule encoding the B cell conserved epitope peptide according to claim 1, characterized in that, The DNA sequence of the nucleic acid molecule of the B-cell conserved epitope peptide is AATGGTAATGGAAATCCAGCCAAC.

3. A recombinant gene DNA fragment, characterized in that, The recombinant gene DNA fragment is obtained by introducing the nucleic acid molecule described in claim 2 into the Peg pilus operon coding gene sequence, and the sequence of the recombinant gene DNA fragment is as shown in SEQ ID NO.

1.

4. An expression cassette, recombinant vector, recombinant cell or recombinant strain, which contains the nucleic acid molecule of the B-cell conserved epitope peptide described in claim 2 or the recombinant gene DNA fragment described in claim 3.

5. The recombinant strain according to claim 4, characterized in that, The recombinant strain is obtained by introducing the recombinant vector into a vector bacterium.

6. A detection system for specific antibodies against Lawsonia intracellularis in pigs, characterized in that, The specific antibody detection system for Lawsonia intracellularis in pigs comprises the expression cassette, recombinant vector, recombinant cell or recombinant strain described in claim 4.

7. The method for constructing the recombinant vector according to claim 4, characterized in that, Comprising the following steps: (1) Obtaining the DNA sequence of the nucleic acid molecule of the B-cell conserved epitope peptide of the surface autotranscriptional protein A of Lawsonia intracellularis in pigs, and the DNA sequence of the nucleic acid molecule is AATGGTAATGGAAATCCAGCCAAC; (2) Introducing the DNA sequence obtained in step (1) into the Peg pilus operon coding gene sequence to construct a recombinant gene DNA fragment; the sequence of the recombinant gene DNA fragment is as shown in SEQ ID NO.1; (3) Connecting the recombinant gene DNA fragment obtained in step (2) to a vector to construct a recombinant vector.

8. The method for constructing the recombinant strain according to claim 4 or 5, characterized in that, The recombinant vector described in claim 4 is transformed and introduced into a vector bacterium to obtain the same.

9. Use of the B-cell conserved epitope peptide described in claim 1, the nucleic acid molecule described in claim 2, the recombinant gene DNA fragment described in claim 3, the expression cassette, recombinant vector, recombinant cell, recombinant strain described in claim 4 or the detection system described in claim 6 in the preparation of a specific antibody detection reagent or kit for Lawsonia intracellularis in pigs.

10. A detection reagent or kit for specific antibodies against Lawsonia intracellularis in pigs, characterized in that, The reagent or kit comprises the B-cell conserved epitope peptide described in claim 1, the nucleic acid molecule described in claim 2, the recombinant gene DNA fragment described in claim 3, the expression cassette, recombinant vector, recombinant cell, recombinant strain described in claim 4 or the detection system described in claim 6.

Images