Heat treatment process of recombinant human FTH1 protein and application of recombinant human FTH1 protein in separation and purification

By diluting with specific buffers and Butyl hydrophobic chromatography before heat treatment, the ferritin isolation and purification steps are simplified, solving the cumbersome and time-consuming problems in the prior art, and achieving rapid preparation and biological activity maintenance of high-purity recombinant human FTH1 protein.

CN120248077APending Publication Date: 2025-07-04HANGZHOU STAR BIOTECHNOLOGY CO LTD
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202510406525.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-02
Publication Date
2025-07-04

AI Technical Summary

Technical Problem

In the prior art, the ferritin isolation and purification process is complicated, long time-consuming, and it is difficult to obtain high-purity label-free recombinant human FTH1 protein, which affects its application as an immunogen.

Method used

The recombinant human FTH1 protein solution was diluted with a buffer solution with pH 5.0 to 8.0 and NaCl concentration of 0 to 1.5M before heat treatment, and combined with Butyl hydrophobic chromatography, the separation and purification steps were simplified and the purity of the target protein was improved.

Benefits of technology

The purity of the target protein was achieved to 95%, the isolation and purification cycle was shortened to no more than 1 day, and the biological activity of the recombinant human FTH1 protein was ensured, which was suitable for the preparation of immunogens.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120248077A_ABST
    Figure CN120248077A_ABST
Patent Text Reader

Abstract

The invention discloses a heat treatment process of recombinant human FTH1 protein and application of the recombinant human FTH1 protein in separation and purification, and belongs to the technical field of protein purification. According to the process, a solution containing recombinant human FTH1 protein is diluted by using a buffer solution before heat treatment, and the purity of target protein after heat treatment can be improved by using the specific buffer solution. The process can be used for separation and purification of the recombinant human FTH1 protein, especially for separation and purification of target protein in a culture solution after engineering bacteria express the recombinant human FTH1 protein, and the purity of the target protein treated by a heat treatment process reaches 90% or above; butyl hydrophobic chromatography can be further combined, and the purity of the target protein is improved to 95% or above. In addition, the yield of the recombinant human FTH1 protein reaches 29mg / L or above. The prepared recombinant human FTH1 protein has good biological activity and can be used as an immunogen for immunization and antibody preparation and production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the technical field of protein separation and purification, and particularly relates to a heat treatment process for recombinant human FTH1 protein and its application in separation and purification. Background Art

[0002] Ferritin is the main iron storage protein almost existing in all life systems, responsible for iron storage, release and antioxidant function. It is a hollow spherical protein complex composed of 24 subunits (with a molecular weight of about 500 kDa). This structure enables multimeric ferritin to store more iron atoms and has higher stability. However, the relatively large molecular weight of monomeric ferritin poses certain obstacles to the research of ferritin. For example, when preparing anti-ferritin antibodies, monomeric ferritin, as a macromolecular antigen, although having strong immunogenicity, has too large a fragment and too complex a structure, and may also be difficult to be taken up, processed and presented by antigen-presenting cells, thus affecting immunogenicity. The molecular weight of an ideal antigen fragment is usually between 10 and 100 kDa. In view of this, the subunit of ferritin can be considered as an immunogen.

[0003] The subunits of ferritin mainly include two types: heavy chain (FTH) and light chain (FTL). FTH1 protein is one of the heavy chain subunits, containing about 180 amino acid residues and having a molecular weight of about 21 kDa, which is a worthy immunogen for screening anti-ferritin antibodies.

[0004] In order to study FTH1 protein, successfully preparing high-purity FTH1 protein is the first problem to be solved. In the prior art, the target protein (recombinant human protein) is usually obtained by constructing an engineering bacterium, inducing expression, and separating and purifying from the culture solution (and / or bacterial cells). In this process, for the need of separation and purification, a purification tag, such as His tag, is usually added to the target protein. However, due to the complexity of protein structure, adding a purification tag sometimes affects the expression of the target protein, or the expressed target protein containing the purification tag needs to be subjected to treatments such as enzymatic cleavage. Therefore, obtaining a tag-free target protein is also the goal pursued by those skilled in the art. However, as mentioned above, tag-free target proteins often have problems in separation and purification.

[0005] Fortunately, for the FTH protein, a method for separating and purifying a tag-free recombinant human ferritin H subunit is disclosed in the Chinese invention patent with the publication number CN102127166A. This method includes: collecting bacterial cells, collecting the supernatant after disruption and centrifugation; subjecting the supernatant to heat denaturation treatment at 70 - 75 °C for 20 min; quickly cooling the homogenate to room temperature at 4 °C and centrifuging to collect the supernatant; adding ammonium sulfate to precipitate the protein in the supernatant at a ratio of 52 g / 100 ml, placing it in a 4 °C refrigerator for 6 - 12 hours; centrifuging to collect the precipitate, dissolving the precipitate with 50 mM Tris-HCl (pH 7.25) buffer to obtain a crude protein solution, and then removing ammonium sulfate by dialysis (4 °C, 24 - 36 h); the obtained crude protein solution is first subjected to His nickel column affinity chromatography (adding the obtained crude protein solution to a Ni-NTA chromatography column to allow the protein to fully bind to Ni-NTA, washing the Ni-NTA bound to ferritin with 50 mM Tris buffer, about 10 - 15 column volumes; then adding a competitive 250 mM imidazole buffer to elute the target ferritin, collecting the eluate and concentrating and purifying the ferritin); then performing agarose sepHarose 6B molecular sieve chromatography to separate monomeric and multimeric (including dimeric and polymeric) ferritins (first equilibrating the molecular sieve with 0.25 M Tris-HCl buffer, after equilibration of the molecular sieve, filtering the protein solution through a 0.22 μm filter membrane externally connected to a disposable syringe and directly loading it onto the column, and then eluting with 0.025 M Tris-HCl buffer to collect the target protein. The ferritin purified by this method is of electrophoretic purity level (both Native and SDS-PAGE detections show characteristic ferritin bands), and the purity of the obtained monomer can reach up to 90 - 95% (still containing trace amounts of multimers).

[0006] This method can achieve the purification of electrophoretically pure ferritin using conventional nickel column affinity chromatography, and this affinity chromatography does not require the addition of a His tag, overcoming the problem of the need to purify tags for recombinant protein expression. However, there are still some deficiencies in this method. First, the purity of the target protein after heat treatment is not given in this prior art, but it can be clearly seen from the Figure 4 of this patent application that the protein bands after heat treatment are relatively messy (lane 3), showing a significant difference from the bands of the finally separated and purified target protein sample; second, the entire separation and purification process is cumbersome, requiring steps such as heat treatment, ammonium sulfate precipitation, dialysis to remove ammonium sulfate, nickel column affinity chromatography, and agarose sepHarose 6B molecular sieve chromatography; finally, due to the large number of processes, the entire cycle takes about 3 - 4 days, which is a relatively long time. Summary of the Invention

[0007] 1. Problems to be Solved

[0008] In view of the problems in the prior art such as cumbersome steps and long time consumption in the separation and purification of ferritin, the present application provides an improved heat treatment process for recombinant human FTH1 protein and uses it for the separation and purification of recombinant human FTH1 protein. This process is simple to operate, can increase the purity of the target protein to about 50% - 90%, and combined with Butyl hydrophobic chromatography, the purity of recombinant human FTH1 protein can be increased to about 95% at most. In addition, this method does not require steps such as dialysis to remove ammonium sulfate, which can save a lot of time and shorten the entire separation and purification cycle.

[0009] 2. Technical Solution

[0010] In order to achieve the above-mentioned invention object, the technical solution adopted in the present application is as follows:

[0011] A heat treatment process for recombinant human FTH1 protein, which includes:

[0012] Before heat treatment, dilute the solution containing recombinant human FTH1 protein with a buffer solution having a pH of 5.0 - 8.0 and an NaCl concentration of 0 - 1.5 M. The amino acid sequence of recombinant human FTH1 protein is shown in SEQ ID NO.1.

[0013] Further, in the above dilution, the volume ratio of the buffer solution to the solution containing recombinant human FTH1 protein is 1:1.

[0014] Further, the above heat treatment includes: heat denaturation treatment at 70 - 80 °C for 5 - 15 min, and immediately cool in an ice-water bath for 5 - 15 min. Further still, the above heat treatment includes: heat denaturation treatment at 75 °C for 10 min, and immediately cool in an ice-water bath for 10 min.

[0015] Further, the pH of the above buffer solution is 5.0, 5.4, 5.8, 6.4, 7.0 or 8.0.

[0016] Further, the pH of the above buffer solution is 5.0 - 5.8.

[0017] Further, the pH of the above buffer solution is 5.0, 5.4 or 5.8.

[0018] Further, the pH of the above buffer solution is 5.8.

[0019] Further, the NaCl concentration of the above buffer solution is 0.5 - 1.5.

[0020] Further, the NaCl concentration of the above buffer solution is 0.5, 1.0 or 1.5.

[0021] Further, the NaCl concentration of the above buffer solution is 1.5.

[0022] Furthermore, the above buffer solution includes any one of NaAC buffer solution, sodium citrate buffer solution, Tris-HCl buffer solution, and sodium carbonate buffer solution, and its pH and NaCl concentration only need to meet the requirements.

[0023] Furthermore, the heat treatment process of the above-mentioned recombinant human FTH1 protein further includes: centrifuging after cooling, collecting the supernatant, the supernatant contains the recombinant human FTH1 protein, and compared with the initial solution containing the recombinant human FTH1 protein, the purity of the recombinant human FTH1 protein therein is improved.

[0024] Furthermore, the above centrifugation includes centrifuging at 10000 - 12000 rpm for 25 - 30 min. Further, the above centrifugation includes centrifuging at 12000 rpm for 30 min.

[0025] The present application also provides the application of the above heat treatment process of a recombinant human FTH1 protein in the separation and purification of the recombinant human FTH1 protein.

[0026] Furthermore, the above application includes: treating a solution containing the recombinant human FTH1 protein with the above heat treatment process; then performing Butyl hydrophobic chromatography on the supernatant collected after the heat treatment for separation and purification.

[0027] The present application also provides a method for separating and purifying a recombinant human FTH1 protein, and the method includes:

[0028] Treating a solution containing the recombinant human FTH1 protein with the above heat treatment process;

[0029] Performing Butyl hydrophobic chromatography on the supernatant collected after the heat treatment for separation and purification.

[0030] The present application also provides a method for preparing a recombinant human FTH1 protein, and the method includes:

[0031] S1, constructing an engineering bacterium expressing the recombinant human FTH1 protein and using IPTG to induce its expression of the recombinant human FTH1 protein, and the amino acid sequence of the recombinant human FTH1 protein is as shown in SEQ ID NO.1;

[0032] S2, collecting the culture solution, centrifuging to obtain the bacterial cells, centrifuging after breaking the cell wall, and collecting the supernatant, and the supernatant contains the recombinant human FTH1 protein;

[0033] S3, treating the supernatant collected in S2 with the above heat treatment process; centrifuging and collecting the supernatant;

[0034] S4, performing Butyl hydrophobic chromatography on the supernatant collected after the heat treatment for separation and purification to obtain the recombinant human FTH1 protein.

[0035] Furthermore, the above-mentioned engineered bacteria include Escherichia coli.

[0036] 3. Beneficial effects

[0037] Compared with the prior art, the beneficial effects of this application are as follows:

[0038] (1) The heat treatment process of the recombinant human FTH1 protein provided by this application is an improvement of the existing heat treatment process. Before heat treatment, the solution containing the recombinant human FTH1 protein is first diluted with a buffer solution with a pH of 5.0 - 8.0 and an NaCl concentration of 0 - 1.5 M, and then heat treatment is carried out. By changing the pH and NaCl concentration in the system, the purity of the target protein after heat treatment is improved. Moreover, when the pH of the buffer solution is 5.0 - 5.8, clear target protein bands with relatively high purity can be obtained, and ferritin oligomers do not appear, realizing the separation of the two.

[0039] (2) The application of the heat treatment of the recombinant human FTH1 protein in the separation and purification of the recombinant human FTH1 protein combines the heat treatment process with Butyl hydrophobic chromatography, and the target protein with a maximum purity of about 95% can be separated and purified. Compared with the method in the Chinese invention patent of CN102127166A, only two steps of heat treatment and Butyl hydrophobic chromatography are required to obtain an effect with comparable purity, and the steps are very simple. At the same time, due to the simplification of the process, the entire separation and purification cycle is also shortened to no more than 1 day. Compared with the 3 - 4 days required by it, the separation and purification cycle is significantly shortened, and the separation and purification efficiency is improved.

[0040] (3) A method for preparing a recombinant human FTH1 protein provided by this application includes constructing an engineered bacterium expressing a tag-free recombinant human FTH1 protein and inducing its expression with IPTG, and then using the separation and purification method of this application to separate and purify the target protein. Its yield reaches more than 29 mg / L, which may be due to the interference of the tag-free and the separation and purification method of this application. In addition, the tag-free recombinant human FTH1 protein prepared by this method can be detected by the indirect ELISA method and found to be able to bind to Anti-Ferritin heavy chain 1 / FTH1 Antibody, having biological activity and the potential to be used as an immunogen to prepare antibodies. Description of the drawings

[0041] Figure 1 It is the plasmid map of PET28a.

[0042] Figure 2SDS-PAGE diagrams of the supernatant and precipitate collected after cell wall breaking, where: Lane M is the protein Marker indicator; Lanes 1 and 2 are the supernatant and precipitate collected after cell wall breaking of the culture solution of recombinant human FTH1 protein; Lanes 3 and 4 are the supernatant and precipitate collected after cell wall breaking of the culture solution of recombinant tagged FTH1 protein.

[0043] Figure 3 SDS-PAGE diagrams of the crude purified supernatant prepared by heat treatment processes under different conditions, where: Lane M is the protein Marker indicator; Lanes 1-4 are at pH 4.0, and the NaCl concentrations are 0, 0.5, 1, and 1.5 M respectively; Lanes 5-8 are at pH 4.4, and the NaCl concentrations are 0, 0.5, 1, and 1.5 M respectively; Lanes 9-12 are at pH 4.6, and the NaCl concentrations are 0, 0.5, 1, and 1.5 M respectively; Lanes 13-16 are at pH 5.0, and the NaCl concentrations are 0, 0.5, 1, and 1.5 M respectively; Lanes 17-20 are at pH 5.4, and the NaCl concentrations are 0, 0.5, 1, and 1.5 M respectively; Lanes 21-24 are at pH 5.8, and the NaCl concentrations are 0, 0.5, 1, and 1.5 M respectively; Lanes 25-28 are at pH 6.4, and the NaCl concentrations are 0, 0.5, 1, and 1.5 M respectively; Lanes 29-32 are at pH 7.0, and the NaCl concentrations are 0, 0.5, 1, and 1.5 M respectively; Lanes 33-36 are at pH 8.0, and the NaCl concentrations are 0, 0.5, 1, and 1.5 M respectively; Lanes 36-40 are at pH 9.5, and the NaCl concentrations are 0, 0.5, 1, and 1.5 M respectively.

[0044] Figure 4 SDS-PAGE diagrams of recombinant human FTH1 protein and recombinant tagged FTH1 protein after Butyl hydrophobic chromatography and His tag affinity chromatography, where: Lane M is the protein Marker indicator; Lane 1 is the recombinant tagged FTH1 protein after His tag affinity chromatography; Lane 2 is the SDS-PAGE diagram of the crude purified supernatant collected in Example 2 (i.e., heat treatment under the conditions of pH = 5.8 and NaCl concentration of 1.5 M); Lane 3 is the recombinant human FTH1 protein after Butyl hydrophobic chromatography (heat treatment conditions: pH = 5.8, NaCl concentration of 1.5 M).

[0045] Figure 5 Detection results of the expression levels of target proteins after induction expression of two kinds of engineering bacteria using different separation and purification processes. Among them, A260 / 280 is used to characterize the nucleic acid content in the sample, and the higher the value, the higher the nucleic acid concentration.

[0046] Figure 6These are the results of the bioactivity assays of recombinant human FTH1 protein (FTH1, no tag) and recombinant tagged FTH1 protein (FTH1, His tag). Detailed implementation manners

[0047] The present application will be further described below in conjunction with specific embodiments.

[0048] It should be noted that the terms such as "upper", "lower", "left", "right", "middle" cited in this specification are only for the convenience of description and are not used to limit the scope of implementation. The change or adjustment of their relative relationship, without substantial change in the technical content, should also be regarded as the scope within which the present application can be implemented.

[0049] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the technical field to which this application belongs; the term "and / or" used herein includes any and all combinations of one or more of the related listed items.

[0050] For those conditions not specified in the examples, they are carried out according to conventional conditions or the conditions recommended by the manufacturer. For reagents or instruments whose manufacturers are not specified, they are all conventional products that can be obtained through commercial purchase.

[0051] As used herein, the term "about" is used to provide flexibility and imprecision associated with a given term, measurement, or value. Those skilled in the art can easily determine the degree of flexibility of a specific variable.

[0052] As used herein, the term "at least one of..." is intended to be synonymous with "one or more of...". For example, "at least one of A, B, and C" clearly includes only A, only B, only C, and their respective combinations.

[0053] Concentrations, amounts, and other numerical data may be presented herein in a range format. It should be understood that such range formats are used only for convenience and brevity and should be interpreted flexibly as including not only the values explicitly recited as the limits of the range but also all individual values or sub-ranges subsumed within the stated range as if each value and sub-range were explicitly recited. For example, a numerical range of about 1 to about 4.5 should be interpreted as including not only the explicitly recited limit values of 1 to about 4.5 but also the individual numbers (such as 2, 3, 4) and sub-ranges (such as 1 to 3, 2 to 4, etc.). The same principle applies to ranges that recite only one numerical value, such as "less than about 4.5", which should be interpreted as including all of the above values and ranges. In addition, this interpretation should apply regardless of the breadth of the range or feature described.

[0054] As used in this application, Butyl hydrophobic chromatography separates proteins based on the hydrophobicity differences on the surface of proteins. The commonly used stationary phase is a filler made by coupling hydrophobic groups such as Butyl to a matrix such as agarose. As a medium-strength hydrophobic ligand, Butyl is suitable for separating proteins with different degrees of hydrophobicity.

[0055] In this application, the amino acid sequence of the human FTH1 protein is shown in SEQ ID NO.1, consisting of 183 amino acids (aa) without a purification tag, and the nucleotide sequence of its encoding nucleic acid is shown in SEQ ID NO.3:

[0056] MTTASTSQVRQNYHQDSEAAINRQINLELYASYVYLSMSYYFDRDDVALKNFAKYFLHQSHEEREHAEKLMKLQNQRGGRIFLQDIKKPDCDDWESGLNAMECALHLEKNVNQSLLELHKLATDKNDPHLCDFIETHYLNEQVKAIKELGDHVTNLRKMGAPESGLAEYLFDKHTLGDSDNES (SEQ ID NO.1);

[0057] ATGACCACCGCGAGCACCAGCCAGGTGCGCCAGAACTATCATCAGGATAGCGAAGCGGCGATTAACCGCCAGATTAACCTGGAACTGTATGCGAGCTATGTGTATCTGAGCATGAGCTACTACTTCGACCGCGATGACGTGGCGCTGAAAAACTTTGCGAAATATTTTCTGCATCAGAGCCATGAAGAGCGCGAACATGCGGAAAAACTGATGAAACTGCAGAACCAGCGCGGCGGCCGCATTTTTCTGCAGGATATTAAAAAGCCGGATTGCGATGATTGGGAAAGCGGCCTGAACGCGATGGAATGCGCGCTGCATCTGGAGAAAAACGTGAACCAGAGCCTGCTGGAACTGCATAAACTGGCGACCGATAAAAACGACCCGCATCTGTGCGATTTTATTGAAACCCATTACCTGAACGAACAGGTGAAAGCGATTAAGGAACTGGGCGATCATGTGACCAACCTGCGCAAAATGGGCGCGCCGGAAAGCGGCTTGGCGGAATATCTGTTTGATAAACATACCCTGGGCGATTCTGATAACGAAAGC(SEQ ID NO.3).

[0058] In this application, the amino acid sequence of the tagged FTH1 protein is shown in SEQ ID NO.2, which is formed by linking the C-His purification tag and the human FTH1 protein. The nucleotide sequence of its encoding nucleic acid is shown in SEQ ID NO.4:

[0059] MTTASTSQVRQNYHQDSEAAINRQINLELYASYVYLSMSYYFDRDDVALKNFAKYFLHQSHEEREHAEKLMKLQNQRGGRIFLQDIKKPDCDDWESGLNAMECALHLEKNVNQSLLELHKLATDKNDPHLCDFIETHYLNEQVKAIKELGDHVTNLRKMGAPESGLAEYLFDKHTLGDSDNESGGSHHHHHHHH(SEQ ID NO.2);

[0060] ATGACCACCGCGAGCACCAGCCAGGTGCGCCAGAACTATCATCAGGATAGCGAAGCGGCGATTAACCGCCAGATTAACCTGGAACTGTATGCGAGCTATGTGTATCTGAGCATGAGCTACTACTTCGACCGCGATGACGTGGCGCTGAAAAACTTTGCGAAATATTTTCTGCATCAGAGCCATGAAGAGCGCGAACATGCGGAAAAACTGATGAAACTGCAGAACCAGCGCGGCGGCCGCATTTTTCTGCAGGATATTAAAAAGCCGGATTGCGATGATTGGGAAAGCGGCCTGAACGCGATGGAATGCGCGCTGCATCTGGAGAAAAACGTGAACCAGAGCCTGCTGGAACTGCATAAACTGGCGACCGATAAAAACGACCCGCATCTGTGCGATTTTATTGAAACCCATTACCTGAACGAACAGGTGAAAGCGATTAAGGAACTGGGCGATCATGTGACCAACCTGCGCAAAATGGGCGCGCCGGAAAGCGGCTTGGCGGAATATCTGTTTGATAAACATACCC TGGGCGATTCTGATAACGAAAGCGGCGGCAGCCATCATCATCATCATCATCATCAT(SEQ ID NO.4).

[0061] Example 1

[0062] This example provides the construction of an engineered bacterium expressing recombinant FTH1 protein and the induction of its expression of FTH1 protein.

[0063] In this example, the recombinant FTH1 protein includes recombinant human FTH1 protein and recombinant tag FTH1 protein, that is, engineered bacteria expressing human FTH1 protein and tag FTH1 protein are constructed respectively.

[0064] The construction of the engineered bacterium expressing recombinant FTH1 protein includes the following steps:

[0065] (1) Construction and preparation of the recombinant expression vector

[0066] The coding nucleic acid of human FTH1 protein and the coding nucleic acid of tag FTH1 protein (synthesized by Suzhou Huaxun Biotechnology Co., Ltd., with an XbaI restriction site added in front of the 5' end of the sequence, a stop codon and an Eco32I restriction site added at the 3' end) and the PET28a plasmid (Figure 1 , (purchased from Suzhou Huaxun Biotechnology Co., Ltd.) were double digested with restriction endonucleases XbaI and Eco32I, and then identified by agarose gel electrophoresis, and the target fragments were recovered by cutting the gel; the recovered target fragments were ligated with PET28a to obtain recombinant plasmids 1 and 2 carrying the coding nucleic acid of human FTH1 protein and the coding nucleic acid of tagged FTH1 protein, respectively;

[0067] The above recombinant plasmids 1 and 2 were respectively transformed into TOP competent cells. After culturing on the plate for 16 h, single colonies were picked for small-scale plasmid extraction. The extracted plasmids were double digested with restriction endonucleases XbaI and Eco32I, and then identified by agarose gel electrophoresis. The positive clones were sent to GenScript Biotechnology Co., Ltd. for sequencing; for the recombinant clones with correct sequences, large-scale plasmid extraction was carried out, and the extracted recombinant plasmids were stored at -20 °C for later use, that is, recombinant expression vectors expressing human FTH1 protein and tagged FTH1 protein were obtained, expressing untagged human FTH1 protein and tagged human FTH1 protein, respectively.

[0068] (2) Construction of engineering bacteria and induction expression

[0069] The recombinant expression vector was transformed into Escherichia coli by heat shock method, and the transformed cells were cultured to obtain recombinant FTH1 protein. The specific transformation and culture operations are as follows:

[0070] The BL21(DE3) competent cells (purchased from Shanghai Weidi Biotechnology Co., Ltd.) were ice-bathed with the recombinant expression vector for 5 - 10 min;

[0071] Take 100 μL of the ice-bathed BL21(DE3) competent cells and 0.5 μg of the recombinant expression vector, gently mix them on ice, and continue to ice-bathe for 20 min;

[0072] Heat shock in a 42 °C water bath for 45 s, quickly return to ice and let stand for 2 min;

[0073] Add 700 μL of sterile LB medium without antibiotics to the centrifuge tube, mix well, and resuscitate at 37 °C and 200 rpm for 60 min;

[0074] Centrifuge at 5000 rpm for 1 min to collect the bacteria, leave about 100 μL of the supernatant, gently pipette to resuspend the bacterial pellet and inoculate it into 50 mL of LB medium containing kanamycin (10 μg / mL), and culture overnight at 37 °C and 150 rpm;

[0075] Inoculate 4 mL of the overnight-cultured seed solution into a 200 mL shake flask containing LB medium (10 μg / mL) at an inoculation amount of 2%, shake at 37 °C and 150 rpm in a constant-temperature shaker for 2 h, add IPTG (final concentration: 1 mmol / L), and then induce high-efficiency expression at 20 °C for 14 h.

[0076] Example 2

[0077] This example provides the isolation and purification of the recombinant human FTH1 protein induced and expressed in Example 1.

[0078] The isolation and purification of the recombinant human FTH1 protein includes the following steps:

[0079] (1) Collection of the original supernatant

[0080] Centrifuge the culture solution after induction and expression in Example 1 at 4 °C and 12,000 rpm for 10 min. Resuspend the precipitated bacterial cells in 50 mL of 10 mM PB (containing 1 mM EDTA, pH 7.0) lysis buffer, wash once, centrifuge at 4 °C and 12,000 rpm for 10 min. Resuspend the precipitate in 50 mL of 10 mM PB (containing 1 mM EDTA, pH 7.0) buffer, and perform cell wall breaking treatment (800 Bar, run 2 - 3 cycles) using an ATS high-pressure homogenizer (Antros Nano Technology (Suzhou) Co., Ltd.). Then centrifuge at 4 °C and 12,000 rpm for 15 min, collect the supernatant, which is the original supernatant, for subsequent purification; simultaneously, take the collected supernatant and precipitate for SDS-PAGE analysis;

[0081] (2) Heat treatment

[0082] Perform heat treatment on the original supernatant (without tags) using a heat treatment process to achieve preliminary isolation and purification of the recombinant human FTH1 protein. Specifically, it includes:

[0083] Filter the supernatant collected after cell wall breaking (original supernatant) through a 0.45 μm filter membrane (Merck Millipore, product number: SLHPR33RB), dilute it with different buffers at a volume ratio of 1:1. Different buffers are used to study the effects of pH and ionic strength on heat treatment. The buffers used are: 0.2 M NaAc buffer (containing 0 - 1.5 M NaCl, pH 4.0 - 5.4), 0.2 M sodium citrate buffer (containing 0 - 1.5 M NaCl, pH 5.8 - 6.4), 0.2 M Tris-HCl buffer (containing 0 - 1.5 M NaCl, pH 6.8 - 8.0), and 0.2 M sodium carbonate buffer (containing 0 - 1.5 M NaCl, pH 9.5);

[0084] The diluted supernatant was placed in a 75 °C water bath for 10 min, then immediately cooled in an ice-water bath for 10 min, centrifuged at 12,000 rpm for 30 min, and the supernatant was collected, which was the primary purified supernatant. Part of the sample was taken for SDS-PAGE analysis;

[0085] (3) Butyl hydrophobic chromatography

[0086] The primary purified supernatant collected after heat treatment was subjected to secondary separation and purification by Butyl hydrophobic chromatography. The packing material used in this example was Butyl Sefinose (TM) 4 Fast Flow (Sangon Biotech (Shanghai) Co., Ltd., catalog number: C600015), and the purification system used was AKTA go (cytiva, Sweden). Specifically, it included:

[0087] The primary purified supernatant collected after heat treatment was filtered through a 0.45 μm filter membrane (Merck Millipore, catalog number: SLHPR33RB), and then the supernatant was diluted with 20 mM PB buffer (containing 2 M ammonium sulfate, pH 7.4) at a volume ratio of 1:1, and then bound to a 1 mL Butyl hydrophobic chromatography column pre-equilibrated with 100% buffer B (20 mM PB buffer, containing 1 M ammonium sulfate, pH 7.4); after loading, it was washed with 100% buffer B until the UV280 signal baseline tended to be stable, and then the target protein was eluted with 80% buffer B, and the sample was collected, which was the recombinant human FTH1 protein. Part of the sample was analyzed by SDS-PAGE.

[0088] Example 3

[0089] This example provides the separation and purification of the recombinant tagged FTH1 protein induced and expressed in Example 2.

[0090] The separation and purification of the recombinant tagged FTH1 protein included: referring to Example 2, collecting the supernatant after cell disruption (raw supernatant), and separating and purifying the target protein (recombinant tagged FTH1 protein) with a C-His tag by His tag affinity chromatography. The packing material used was Ni-Smart (Changzhou Tiandi Renhe Biotechnology Co., Ltd., catalog number: SA036500). Specifically, it included:

[0091] After filtering the supernatant after cell wall breaking through a 0.45 μm filter membrane (Merck Millipore, product number: SLHPR33RB), it was bound to a 5 mL Ni-Smart chromatography column pre-equilibrated with PBS buffer, and then the miscellaneous proteins were washed off with PBS containing 10 mM imidazole at 5 times the column volume. Finally, the target protein was eluted with PBS containing 500 mM imidazole at 3 times the column volume, and the sample was collected, which was the recombinant tagged FTH1 protein. Part of the sample was analyzed by SDS-PAGE.

[0092] Example 4

[0093] This example provides SDS-PAGE analysis of the samples collected in Example 2 and Example 3.

[0094] The SDS-PAGE analysis includes the following steps:

[0095] (1) Sample pretreatment

[0096] Each collected sample was concentrated and desalted using a 15 mL, 10 kDa ultrafiltration tube (Merck Millipore, product number: UFC9010), and the buffer was replaced with 0.2 M PBS (pH 7.4). The centrifugation conditions were 4000 rpm, 10 min / time.

[0097] (2) SDS-PAGE analysis

[0098] The expression level and purity of the target protein were analyzed by SDS-PAGE. The specific steps were as follows: A 4-20% gradient gel was selected, 24 μL of the sample + 6 μL of 5X Loading Buffer, and 10 μL was loaded for SDS-PAGE electrophoresis. The electrophoresis was carried out in a constant voltage mode of 150 V, and the electrophoresis was terminated when the bromophenol blue reached the bottom of the gel.

[0099] Result analysis:

[0100] (a) SDS-PAGE analysis of the supernatant and precipitate collected after cell wall breaking

[0101] The SDS-PAGE diagrams of the supernatant and precipitate collected after cell wall breaking are as Figure 2 shown, where: Lane M is the protein Marker indicator; Lanes 1 and 2 are the supernatant and precipitate collected after cell wall breaking of the recombinant human FTH1 protein culture solution; Lanes 3 and 4 are the supernatant and precipitate collected after cell wall breaking of the recombinant tagged FTH1 protein culture solution.

[0102] It can be seen that the electrophoresis bands in lane 1 and lane 3, and those in lane 2 and lane 4 are similar, indicating that the protein expressions of the two engineered bacteria are similar; the proteins in lane 1 and lane 3 are significantly more than those in lane 2 and lane 4, suggesting that most proteins are soluble proteins; there are very obvious bands (red arrows) near 25 kDa in lane 1 and lane 3, which are close to the size of FTH1 protein (about 21.2 kDa without tags), indicating that both engineered bacteria have successfully expressed FTH1 protein (recombinant human FTH1 protein or recombinant tagged FTH1 protein).

[0103] (b) Effects of pH and ionic strength on heat treatment

[0104] The SDS-PAGE diagram of the crude purified supernatant collected in Example 2 is as Figure 3 shown, where: lane M is the protein Marker indicator; lanes 1-4 are at pH 4.0, and the NaCl concentrations are 0, 0.5, 1, and 1.5 M respectively; lanes 5-8 are at pH 4.4, and the NaCl concentrations are 0, 0.5, 1, and 1.5 M respectively; lanes 9-12 are at pH 4.6, and the NaCl concentrations are 0, 0.5, 1, and 1.5 M respectively; lanes 13-16 are at pH 5.0, and the NaCl concentrations are 0, 0.5, 1, and 1.5 M respectively; lanes 17-20 are at pH 5.4, and the NaCl concentrations are 0, 0.5, 1, and 1.5 M respectively; lanes 21-24 are at pH 5.8, and the NaCl concentrations are 0, 0.5, 1, and 1.5 M respectively; lanes 25-28 are at pH 6.4, and the NaCl concentrations are 0, 0.5, 1, and 1.5 M respectively; lanes 29-32 are at pH 7.0, and the NaCl concentrations are 0, 0.5, 1, and 1.5 M respectively; lanes 33-36 are at pH 8.0, and the NaCl concentrations are 0, 0.5, 1, and 1.5 M respectively; lanes 36-40 are at pH 9.5, and the NaCl concentrations are 0, 0.5, 1, and 1.5 M respectively. The protein purity detection results of each sample are shown in Table 1.

[0105] Table 1 Detection results of the purity of recombinant human FTH1 protein prepared by heat treatment under different conditions

[0106]

[0107] From Figure 3As can be seen from Table 1, when the pH is less than 4.6, the target protein cannot be separated and purified; when the pH is equal to 4.6, a small amount of the target protein can be separated and purified; when the pH is between 5.0 and 5.8, clear bands of the target protein can be obtained, and its purity is relatively high. Especially under the conditions of pH = 5.8 and a NaCl concentration of 1.5 M, the purity reaches 90.5% (the sample obtained under these conditions was further subjected to Butyl hydrophobic chromatography); when the pH is between 6.4 and 8.0, clear bands of the target protein can be obtained, and its purity is also relatively high, but at this time, ferritin oligomers also appear in the sample (molecular size is about 500 kDa, Figure 3 the green arrow in

[0108] (c) SDS-PAGE analysis of the samples after Butyl hydrophobic chromatography and His tag affinity chromatography

[0109] The SDS-PAGE diagrams of the recombinant human FTH1 protein and the recombinant tagged FTH1 protein after Butyl hydrophobic chromatography and His tag affinity chromatography are as Figure 4 shown. Among them: Lane M is the protein Marker indicator; Lane 1 is the recombinant tagged FTH1 protein after His tag affinity chromatography; Lane 2 is the SDS-PAGE diagram of the initially purified supernatant collected in Example 2 (i.e., heat treatment under the conditions of pH = 5.8 and a NaCl concentration of 1.5 M); Lane 3 is the recombinant human FTH1 protein after Butyl hydrophobic chromatography (heat treatment conditions: pH = 5.8, NaCl concentration 1.5 M).

[0110] From Figure 4 it can be seen that the purity of the target protein in the sample obtained by His tag affinity chromatography is relatively low, lower than that of the target protein in the sample after heat treatment; in addition, after treatment with Butyl hydrophobic chromatography, the residual impurities and nucleic acids in the sample are removed, further improving the purity of the target protein in the sample (above 95%).

[0111] Example 5

[0112] This example provides the expression levels (yields) of the target proteins of two engineering bacteria (engineering bacteria expressing human FTH1 protein and tagged FTH1 protein), and their separation and purification methods are as shown in Example 2 and Example 3 respectively.

[0113] After the two engineering bacteria were induced to express, different separation and purification processes were used, and the detection results of the expression levels of their target proteins are as Figure 5As shown, it can be seen that although Butyl hydrophobic chromatography caused loss of the protein sample (but with higher purity), whether or not Butyl hydrophobic chromatography was performed, the expression level of the tag-free recombinant human FTH1 protein was much higher than that of the recombinant tagged FTH1 protein, probably because the presence of the tag affected the expression of the FTH1 protein.

[0114] Example 6

[0115] In this example, the indirect ELISA method was used to detect the biological activities of the recombinant human FTH1 protein and the recombinant tagged FTH1 protein prepared in this application.

[0116] The indirect ELISA detection includes:

[0117] Take 50 μL / well of the recombinant FTH1 protein diluted with 50% glycerol at 200 ng / well and coat the ELISA plate overnight at 4°C. The next day, block it with 1% bovine serum albumin for 2 h at 37°C. Dilute the Anti-Ferritin heavy chain 1 / FTH1 Antibody (SinoBiological, catalog number: 13217-MM06T) as the primary antibody (dilute 1:400 in the first well, and then perform serial dilution, measure two wells in parallel for each concentration). Use 1% BSA TBS solution as the primary antibody for the negative control. After incubating in a water bath at 37°C for 1 h, add the secondary antibody Goat Anti-Mouse IgG(H+L)-HRP (Jackson ImmunoResearch, catalog number: 115-035-003) at 1:8000, add the chromogenic solution for color development, and detect the OD450 signal value of the ELISA plate.

[0118] Result analysis:

[0119] The detection results of the biological activities of the recombinant human FTH1 protein (FTH1, No tag) and the recombinant tagged FTH1 protein (FTH1, His tag) are as Figure 6 shown. Among them, the half maximal effective concentration (EC50) of the recombinant human FTH1 protein was 10.94 ng / mL, and the EC50 of the recombinant tagged FTH1 protein was 9.58 ng / mL. This indicates that the purification and separation method of this application has no significant effect on the biological activity of the recombinant human FTH1 protein, and both the recombinant human FTH1 protein and the recombinant tagged FTH1 protein prepared in this application can serve as immunogenic proteins and bind to the mouse monoclonal antibody against human FTH1, and the two have similar immunogenicity and specificity.

Claims

1. A heat treatment process for recombinant human FTH1 protein, characterized in that, The heat treatment process includes: Before heat treatment, dilute the solution containing recombinant human FTH1 protein with a buffer solution having a pH of 5.0 - 8.0 and an NaCl concentration of 0 - 1.5 M. The amino acid sequence of the recombinant human FTH1 protein is as shown in SEQ ID NO.

1.

2. The heat treatment process of a recombinant human FTH1 protein according to claim 1, wherein, The pH of the buffer solution is 5.0 - 5.8; the NaCl concentration of the buffer solution is 0.5 - 1.

5.

3. The heat treatment process of a recombinant human FTH1 protein according to claim 2, characterized in that, The buffer solution includes any one of NaAC buffer solution, sodium citrate buffer solution, Tris-HCl buffer solution, and sodium carbonate buffer solution.

4. A heat treatment process for recombinant human FTH1 protein according to claims 1-3, characterized in that, The heat treatment includes: heat denaturation treatment at 70 - 80 °C for 5 - 15 min, and immediately cooling in an ice-water bath for 5 - 15 min.

5. The heat treatment process of a recombinant human FTH1 protein according to claim 4, characterized in that, The heat treatment process further includes: centrifuging after cooling to collect the supernatant.

6. Use of the heat treatment process of a recombinant human FTH1 protein according to any one of claims 1 - 4 in the separation and purification of the recombinant human FTH1 protein.

7. The application according to claim 6, wherein The use includes: treating the solution containing the recombinant human FTH1 protein with the heat treatment process; then performing Butyl hydrophobic chromatography on the supernatant collected after heat treatment to separate and purify the recombinant human FTH1 protein.

8. A method for separating and purifying recombinant human FTH1 protein, characterized in that, The method includes: Treating the solution containing the recombinant human FTH1 protein with the heat treatment process of a recombinant human FTH1 protein according to any one of claims 1 - 4; Performing Butyl hydrophobic chromatography on the supernatant collected after heat treatment to separate and purify the recombinant human FTH1 protein.

9. A method for preparing recombinant human FTH1 protein, characterized in that, The method includes: S1, constructing an engineering bacterium expressing recombinant human FTH1 protein and inducing its expression of recombinant human FTH1 protein using IPTG; S2, collecting the culture solution, centrifuging to obtain bacterial cells, centrifuging after cell disruption, and collecting the supernatant; S3, treating the supernatant collected in S2 with the heat treatment process of a recombinant human FTH1 protein according to any one of claims 1 - 4; centrifuging and collecting the supernatant; S4, performing Butyl hydrophobic chromatography on the supernatant collected after heat treatment to separate and purify to obtain the recombinant human FTH1 protein.

10. The preparation method of a recombinant human FTH1 protein according to claim 9, characterized in that, The engineering bacterium includes Escherichia coli.

Citation Information

Patent Citations

  • Method for separating purified ferritins from biological tissues or engineering bacteria

    CN102127166A

  • Efficient preparation method of reversible self-assembled protein

    CN110759986A

  • Preparation method of ferritin

    CN115948308A

  • Method for controlling intracellular constant-proportion expression and co-self-assembly of multiple granula protein subunit assembly homoequivalents by single promoter in prokaryotic system

    CN116334118A

  • Expression and purification of recombinant human isoferritins using a novel expression system

    US20230348916A1