Microorganism for producing oligomeric glucan as well as construction method and application of microorganism
Chaetomiumglobosum CGMCC 6882 was transformed through CRISPR-Cas9 gene editing and protoplast fusion technology, and a short-hyphae Chaetomiumglobosum XY1104 bacteria species was constructed, which solved the problem of mycelium entanglement, improved the yield and purity of dextran, and met market demand.
Patent Information
- Application Number
- CN202510403597.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-01
- Publication Date
- 2025-07-04
AI Technical Summary
The existing Gynostomata endophytic fungi have long hyphae, which leads to wrapping the fermentation tank stirring device during the fermentation process, affecting mass transfer and reducing glucan yield. The purity and yield of extracted yeast β-glucan are difficult to meet market demand.
The yeast Y1Ste20 homologous knockout plasmid was constructed through CRISPR-Cas9 gene editing technology, and Chaetomiumglobosum CGMCC 6882 was transformed using protoplast fusion technology to obtain Chaetomiumglobosum XY1104 bacteria with shorter mycelium. The screening was performed using hygromycin resistance medium to achieve mycelium control and enhance glucan purity.
The Chaetomiumglobosum XY1104 strain with short mycelium avoids the problem of entanglement, improves the mass transfer performance of the fermentation broth, increases the yield of dextran nearly 3 times, and reaches 100%. It is suitable as a raw material for health products and expands the application market.
Smart Images

Figure CN120249069A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of microorganisms and their applications, and relates to a microorganism for producing oligosaccharides, a method for constructing the same, and an application thereof. Background Art
[0002] Glucan is mainly derived from fungi, yeasts, plants, and algae, and is an important dietary fiber in food, having important nutritional value and biological functions. Among them, yeast β-glucan is one of the main components of the yeast cell wall, located in the inner layer of the yeast cell wall, accounting for about 60% of the dry weight of the cell wall, and is a rich natural source of glucan. The application of yeast β-glucan in the chemical industry, aquaculture, and food has received increasing attention. However, in the domestic market, yeast β-glucan still has problems such as low yield, poor quality, and low purity, and cannot meet the growing market demand. Currently, the commonly used extraction methods for yeast β-glucan include acid-base extraction, high-pressure microfluidic homogenization, and ultrasonic-assisted extraction. These methods still have problems such as low yield, difficulty in meeting market demand for purity, and serious pollution in the production process to varying degrees.
[0003] Therefore, finding a production method with simple process, high yield, and good quality of glucan is helpful to improve the commercial value of β-glucan. For example, extracting β-glucan from the metabolites of microorganisms is a new idea.
[0004] Chinese Patent No. 201310002710.3 discloses a Gynostemma pentaphyllum endophytic fungus and its uses, and its preservation registration number is CGMCC NO: 6882. This document discloses that various natural active substances including glucan, flavonoids, organic acids, quinones, sapogenins, etc. can be separated and extracted from the endophytic fungus and its fermentation broth. However, the mycelia of this strain are relatively long and will entangle the stirring device of the fermenter during fermentation, which not only damages the equipment but also causes mass transfer obstruction and affects the yield of glucan.
[0005] Therefore, the present invention hopes to transform the existing Gynostemma pentaphyllum endophytic fungus, namely Chaetomium globosum CGMCC6882, to obtain a new strain with shorter mycelia, which is more conducive to fermentation production, so as to meet the requirements of industrial production of glucan.
[0006] Existing research has shown that the Ste20 gene sequence can regulate hyphal growth. For example, Ste20 in Saccharomyces cerevisiae can regulate functions such as cell wall formation, conjugation process, osmotic regulation, and hyphal growth. In Basidiomycetous yeast and Cryptococcus neoformans, the deletion of the Ste20 homologous protein results in a decrease in sexual reproductive hyphae. In Cryptococcosis neoformans, the deletion of the Ste20 homologous protein leads to the loss of sexual reproductive ability of hyphae and a decrease in toxicity. In the A. flavus CA14 strain, the deletion of the Ste20 gene results in a significant decrease in strain growth, conidia formation, sclerotia formation, toxin biosynthesis, and infectivity. Excessively long hyphae will form hyphal pellets during the fermentation process. Hyphal pellets are a type of microbial aggregate formed under certain culture conditions. The formed hyphal pellets will affect the mass transfer of materials. Generally, the cells in the center of the pellet are not as good as the cells on the surface of the pellet in terms of growth and product formation.
[0007] Therefore, the present invention aims to construct a Ste20 knockout vector to transform the existing strains to obtain a new strain, achieving the purpose of regulating the length of hyphae, so as to solve the existing technical problems such as the long hyphae winding the stirring device of the fermenter and affecting the mass transfer of the fermentation broth. Summary of the Invention
[0008] The purpose of the present invention is to transform the strain based on Chaetomium globosum CGMCC 6882 to obtain a new strain with shorter hyphae, which is more conducive to fermentation production and meets the requirements of industrial production of glucan.
[0009] The technical solution adopted by the present invention provides a microorganism for producing oligosaccharide glucan. The key lies in that the above microorganism is Chaetomium globosum XY1104, and the preservation institution of the above microorganism is the China Center for Type Culture Collection, and the preservation registration number is CCTCC NO: M 20242389, and the preservation date is October 30, 2024;
[0010] The hyphal morphology of the above microorganism is white hyphae, short hyphae, growing adherent to the culture medium, growing to 2 / 3 of the culture dish plate in 7 to 10 days; the optimal growth pH is neutral, that is, pH is between 6.5 and 8.5.
[0011] A method for constructing a microorganism for producing oligosaccharides, which is used to construct the above-mentioned microorganism for producing oligosaccharides. The key lies in using the CRISPR-Cas9 gene editing technology and protoplast fusion technology to transform Chaetomium globosum CGMCC 6882 and obtaining the above-mentioned microorganism through secondary screening, specifically including four steps:
[0012] Step S1: Use the CRISPR-Cas9 gene editing technology to construct a yeast Y1Ste20 homologous gene knockout plasmid;
[0013] Step S2: Prepare protoplasts of Chaetomium globosum CGMCC 6882;
[0014] Step S3: Transformation and regrowth of protoplasts of Chaetomium globosum CGMCC 6882;
[0015] Step S4: Conduct secondary screening using a hygromycin-resistant medium.
[0016] Furthermore, the above-mentioned Step S1 specifically includes:
[0017] Step S1-1: Primer design and synthesis: In the database, obtain the nucleotide sequence of the yeast Y1Ste20 gene, design primers for the target gene and conduct synthesis. The above-mentioned primers for the target gene include 5SrRNA-F, 5SrRNA-R, gRNAscaffod-F, and gRNA scaffod-R;
[0018] Step S1-2: Amplify the 5SrRNA-Ste20gRNA fragment:
[0019] Using the pFC 332-P 5SrRNA-gRNA scaffod vector as a template, amplify the 5SrRNA-Ste20gRNA fragment through a PCR reaction program, use a PCR product purification kit to recover the band with the correct position, and obtain the correct 5SrRNA-Ste20gRNA fragment;
[0020] Step S1-3: Amplify the Ste20gRNA-gRNA scaffod fragment:
[0021] Using the pFC 332-P 5SrRNA-gRNA scaffod vector as a template, amplify the Ste20gRNA-gRNA scaffod fragment through a PCR reaction program, use a PCR product purification kit to recover the band with the correct position, and obtain the correct Ste20gRNA-gRNA scaffod fragment;
[0022] S1-4 Step, Fragment Fusion:
[0023] Dilute the recovered product of the 5SrRNA-Ste20gRNA fragment and the Ste20gRNA-gRNA scaffod fragment by 10 times. Take an equal amount of the diluted recovered product as the template and perform overlap extension PCR to obtain the 5SrRNA-gRNA scaffod fragment;
[0024] S1-5 Step, Purification of the Target Gene:
[0025] Perform agarose gel electrophoresis verification on the fusion fragment to be verified, and use a PCR product purification kit to recover the band with the correct position to obtain the 5SrRNA-gRNA scaffod fragment;
[0026] S1-6 Step, Digestion of the Vector:
[0027] Digest the pFC332 vector with BglⅡ. After the digestion, perform verification by agarose gel electrophoresis, and use a PCR product purification kit to recover the band with the correct position to obtain the digested pFC332 vector;
[0028] S1-7 Step, Ligate the 5SrRNA-gRNA scaffod fragment and the digested pFC332 vector in the ligation system to obtain the ligation product:
[0029] The above ligation system is an aqueous solution of 5×SE Cloning Buffer with a volume concentration of 15% - 25%. The above ligation system contains the digested pFC332 vector with a concentration of 4 ng / μL - 6 ng / μL and the 5SrRNA-gRNA scaffod fragment with a concentration of 20 ng / μL - 30 ng / μL; the above ligation system also contains a recombinase with a volume concentration of 8% - 12%;
[0030] S1-8 Step, Transformation of the Ligation Product and Identification of Positive Clones:
[0031] Add the ligation product to DH5α, perform ice bath, heat shock at 42℃, and ice bath again in sequence. Add LB liquid medium and shake culture to obtain the activated bacterial liquid;
[0032] Centrifuge the activated bacterial liquid to obtain the bacterial cell precipitate, coat and culture it on an LB solid medium containing 40 μg / mL - 60 μg / mL ampicillin to obtain single colonies;
[0033] Pick a single colony and add it to an LB liquid medium containing 40 μg / mL - 60 μg / mL ampicillin and shake culture,
[0034] Take 1 μL of the bacterial solution as a template for bacterial solution PCR identification to obtain a bacterial solution with correct sequencing.
[0035] Steps S1-9, plasmid extraction and sequencing verification:
[0036] Add the bacterial solution with correct sequencing to an LB liquid medium containing 40 μg / mL to 60 μg / mL ampicillin for expansion culture, and use a plasmid miniprep kit to extract the plasmid to obtain the yeast Y1Ste20 homologous gene knockout plasmid.
[0037] Specifically, the base sequences of the above-mentioned target gene primers in step S1-1 are:
[0038] 5SrRNA-F: TGGAACAAATGGTGCTTGAGAG;
[0039] 5SrRNA-R: CAGGCGTGCCGTCGGGAAGGCATACAACAGCGGGGATTCG;
[0040] gRNA scaffod-F: CCTTCCCGACGGCACGCCTGGTTTTAGAGCTAGAAATAGC;
[0041] gRNA scaffod-R: AGAGCATGATCAGCACAAAGGC.
[0042] Furthermore, the above step S2 specifically includes:
[0043] Step S2-1, take the mycelium of Chaetomiumglobosum CGMCC 6882, wash and collect the bacterial cells successively with sterile water and NaCl solution;
[0044] Step S2-2, add the enzymatic hydrolysis solution for digestion, and stop digestion when the number of protoplasts reaches 10 8 cells / mL. The above enzymatic hydrolysis solution is an aqueous solution of snailase, lysing enzyme and cellulase with a mass ratio of 3-5:2-3:1;
[0045] Step S2-3, filter to obtain protoplasts, wash successively with NaCl solution and STC buffer, centrifuge to obtain a bacterial cell precipitate, and add the bacterial cells resuspended with STC buffer to obtain the above-mentioned protoplasts of Chaetomiumglobosum CGMCC 6882.
[0046] Even further, the above step S3 specifically includes:
[0047] Step S3-1: Mix the protoplasts of Chaetomium globosum CGMCC 6882 and the plasmid with the Y1Ste20 homologous gene knocked out at a ratio of 8 - 12:1, add the PTC solution, add the PTC solution again after ice bath, and incubate at a temperature of 28°C - 32°C to obtain a mixture;
[0048] Step S3-2: Add the obtained mixture to the regeneration medium and perform constant temperature culture;
[0049] Step S3-3: Pour the hygromycin-resistant medium onto the regenerated medium after culture and continue constant temperature culture. The preparation method of the hygromycin-resistant medium is to dissolve 1 g - 1.5 g of agar powder in distilled water to a volume of 100 mL, and add 180 μg / mL - 220 μg / mL of hygromycin when sterilizing and pouring the plate.
[0050] Furthermore, the specific steps of the above Step S4 are as follows: After the transformants grow, take the block-shaped culture with hyphae and culture it on the plate of the hygromycin solid seed medium for secondary screening. The formula of the hygromycin solid seed medium is 0.3 g of beef extract, 2 g of sucrose, 0.1 g of yeast powder, 0.5 g of peptone, 3.5 g - 3.8 g of agar powder, and 100 mL of deionized water.
[0051] The application of a microorganism for producing oligosaccharides, using the microorganism for producing oligosaccharides as described above to prepare oligosaccharides. The key lies in that the prepared oligosaccharides are β-glucans with a weight-average molecular weight of 5200 - 5300 and a number-average molecular weight of 2200 - 2300.
[0052] Specifically, the application steps include inoculation, fermentation culture, extraction and purification of oligosaccharides; the above inoculation is to inoculate the seed liquid of the Chaetomium globosum XY1104 strain in the logarithmic phase into the fermentation broth, and the ratio of the seed liquid of the strain to the fermentation broth is 10 - 50:1000; the temperature of the above fermentation culture is 28°C - 32°C, the culture time is 2 - 3 days, the fermentation time is 6 - 8 days, and oxygen needs to be introduced during the fermentation process.
[0053] Preferably, the specific steps of the above extraction and purification are as follows:
[0054] After the fermentation is completed, remove the precipitate and insoluble substances, and retain the filtrate;
[0055] Concentrate the filtrate, add absolute ethanol for alcohol precipitation to obtain an alcohol precipitation;
[0056] Redissolve the alcohol precipitation with water, concentrate again, add Sevag reagent and shake and centrifuge to remove proteins to obtain the supernatant after protein removal;
[0057] The supernatant after deproteinization was dialyzed to remove salts, purified by gel chromatography, and freeze-dried to obtain the above-mentioned oligosaccharide glucan.
[0058] Compared with the prior art, the present invention has the following beneficial effects:
[0059] The present invention uses the CRISPR-Cas9 gene editing technology to construct a plasmid for knocking out the homologous gene of yeast Y1Ste20. At the same time, the protoplast fusion technology is used to fuse the protoplast of Chaetomium globosum CGMCC 6882 with the plasmid for knocking out the homologous gene of yeast Y1Ste20 to achieve the transformation of Chaetomium globosum CGMCC 6882. A new strain named Chaetomium globosum XY1104 was obtained through screening on a hygromycin-resistant medium.
[0060] The new strain constructed in the present invention is a kind of Chaetomium globosum, with shorter hyphae, no problem of hyphae entanglement during fermentation, which can avoid the damage of fermentation equipment caused by hyphae entanglement, improve the mass transfer performance of the fermentation broth, and increase the yield by nearly 3 times.
[0061] It was also unexpectedly found in the research that the new strain constructed in the present invention can metabolize β-glucan singly. This unexpected discovery enables the purity of glucan to reach 100%, fully meeting the purity requirements of β-glucan as a raw material for health products, and expanding the application market of β-glucan products.
[0062] In addition, by comparing the freeze-dried powder of the sample produced by Chaetomium globosum XY1104 of the present invention with the freeze-dried powder of the control product produced by Chaetomium globosum CGMCC 6882, it was found that its in vitro antioxidant activity and immune activity were also improved to varying degrees. Description of the Drawings
[0063] Figure 1 It is the gel electrophoresis result of the 5SrRNA-Ste20gRNA fragment, Ste20gRNA-gRNAscaffod fragment, and 5SrRNA-gRNA scaffod fragment constructed in Example 1 of the present invention.
[0064] Figure 2 It is the gel electrophoresis result of the bacterial liquid PCR of the vector constructed in Example 1 of the present invention.
[0065] Figure 3 It is the process photo of the screening in Example 1 of the present invention.
[0066] Figure 4It is the result of verifying the hygromycin resistance gene by agarose gel electrophoresis in Example 1 of the present invention.
[0067] Figure 5 It is a comparison diagram of the colony morphology of Chaetomium globosum CGMCC 6882 and Chaetomium globosum XY1104.
[0068] Figure 6 It is a comparison diagram of the mycelial morphology of Chaetomium globosum CGMCC 6882 and Chaetomium globosum XY1104 in liquid medium.
[0069] Figure 7 It is a comparison diagram of the extracellular polysaccharide extraction process of Chaetomium globosum CGMCC 6882 and Chaetomium globosum XY1104.
[0070] Figure 8 It is the scanning electron microscope and transmission electron microscope photos of the extracellular polysaccharide (reference) extracted from Chaetomium globosum CGMCC 6882.
[0071] Figure 9 It is the scanning electron microscope and transmission electron microscope photos of the extracellular polysaccharide (sample) extracted from Chaetomium globosum XY1104.
[0072] Figure 10 It is the Fourier transform infrared spectrum of the freeze-dried powder sample 1 and the freeze-dried powder reference.
[0073] Figure 11 It is the nuclear magnetic resonance spectrum - hydrogen spectrum of the freeze-dried powder sample 1.
[0074] Figure 12 It is the nuclear magnetic resonance spectrum - carbon spectrum of the freeze-dried powder sample 1.
[0075] Figure 13 It is the nuclear magnetic resonance spectrum - hydrogen spectrum of the reference.
[0076] Figure 14 It is the nuclear magnetic resonance spectrum - carbon spectrum of the reference.
[0077] Figure 15 It is the result of the DPPH scavenging ability test.
[0078] Figure 16 It is the result of the ABTS scavenging ability test.
[0079] Figure 17 It is the result of the hydroxyl radical scavenging ability test.
[0080] Figure 18 These are the results of the ferric reducing antioxidant power (FRAP) assay.
[0081] Figure 19 These are the results of the in vitro assay of the effect on nitric oxide secretion by RAW 264.7 macrophages.
[0082] Figure 20 These are the results of exploring the secretion of IL-6 by RAW 264.7 cells using enzyme-linked immunosorbent assay (ELISA).
[0083] Figure 21 These are the results of exploring the secretion of IL-1β by RAW 264.7 cells using ELISA.
[0084] Figure 22 These are the results of exploring the secretion of TNF-α by RAW 264.7 cells using ELISA.
[0085] In the attached figures, 1 is the colony morphology of Chaetomium globosum CGMCC 6882, 2 is the colony morphology of Chaetomium globosum XY1104, 3 is the hyphal morphology of Chaetomium globosum CGMCC 6882 at different culture days in liquid medium, 4 is the hyphal morphology of Chaetomium globosum XY1104 at different culture days in liquid medium, 5-1 is the color of the ethanol precipitation solution of the fermentation broth of Chaetomium globosum CGMCC 6882, 5-2 is the color of the ethanol-precipitated polysaccharide obtained by fermenting Chaetomium globosum CGMCC 6882, 5-3 is the freeze-dried powder reference product produced by fermenting Chaetomium globosum CGMCC 6882, 6-1 is the color of the ethanol precipitation solution of the fermentation broth of Chaetomium globosum XY1104, 6-2 is the color of the ethanol-precipitated polysaccharide obtained by fermenting
[0086] Chaetomium globosum XY1104, 6-3 is the freeze-dried powder sample 1 produced by fermenting
[0087] Chaetomium globosum XY1104, 7 is the infrared spectrum curve of freeze-dried powder sample 1, and 8 is the infrared spectrum curve of the freeze-dried powder reference product. Detailed implementation methods
[0088] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Apparently, the described embodiments are only a part of the embodiments of the present invention, rather than all embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.
[0089] For those conditions not specified in the embodiments, they can be carried out according to conventional conditions; for the reagents or instruments whose manufacturers are not specified, they are all conventional products that can be obtained by purchasing in the market.
[0090] In Embodiments 1 to 3, the Chaetomium globosum CGMCC 6882 is modified by using the CRISPR-Cas9 gene editing technology and the protoplast fusion technology and the obtained microorganism is obtained through secondary screening. Among them, Chaetomium globosum CGMCC 6882 is the gynostemma pentaphyllum endophytic fungus disclosed in the Chinese patent with the literature number of 201310002710.3.
[0091] Embodiment 1
[0092] Specifically, it includes four steps:
[0093] S1. Use the CRISPR-Cas9 gene editing technology to construct a yeast Y1Ste20 homologous gene knockout plasmid, specifically including:
[0094] Step S1-1. Primer design and synthesis: In the NCBI-Nucleotide database, obtain the nucleotide sequence of the yeast Y1Ste20 gene and design the primers for the target gene, which are synthesized by Beijing BGI Tech Solutions Co., Ltd. The primers for the target gene in the present invention include 5SrRNA-F, 5SrRNA-R, gRNA scaffod-F, and gRNA scaffod-R. The base sequences of the above primers for the target gene are shown in Table 1.
[0095] Table 1: Base sequence table of primers for the target gene
[0096]
[0097] Nucleotide sequence of the yeast Y1Ste20 gene: CCTTCCCGACGGCACGCCTG.
[0098] Step S1-2. Amplify the 5SrRNA-Ste20gRNA fragment:
[0099] Using the pFC 332-P 5SrRNA-gRNA scaffod vector as a template, amplify the 5SrRNA-Ste20gRNA fragment through the PCR reaction procedure;
[0100] The amplification system used was: dNTP Mixture (4 μL), 10× Taq Buffer (5 μL), Ex Taq (0.25 μL), pFC 332 empty vector (2 μL), 5S rRNA-F (1 μL), 5S rRNA-R (1 μL), sterile water (36.75 μL);
[0101] In this step, the PCR reaction program was 95 °C for 5 min, 95 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s, 72 °C for 10 min, and the number of cycles was 30;
[0102] Use the San Prep column PCR product purification kit to recover the correctly positioned band according to the method described in the instruction manual of this kit and obtain the correct 5S rRNA-Ste20 gRNA fragment. The gel electrophoresis pattern of this fragment is shown in the appendix Figure 1 。
[0103] Steps S1-3, amplify the Ste20 gRNA-gRNA scaffod fragment:
[0104] Using the pFC 332-P 5S rRNA-gRNA scaffod vector as a template, amplify the Ste20 gRNA-gRNA scaffod fragment through the PCR reaction program. The amplification system and PCR reaction program used are the same as those in step S1-2;
[0105] Use the San Prep column PCR product purification kit to recover the correctly positioned band according to the method described in the instruction manual of this kit and obtain the correct Ste20 gRNA-gRNA scaffod fragment. The gel electrophoresis pattern of this fragment is shown in the appendix Figure 1 。
[0106] Steps S1-4, fragment fusion:
[0107] Dilute the recovered products of the 5S rRNA-Ste20 gRNA fragment and the Ste20 gRNA-gRNA scaffod fragment by 10 times. Take equal amounts of the diluted recovered product as templates and perform overlap extension PCR to obtain the 5S rRNA-gRNA scaffod fragment.
[0108] Steps S1-5, purification of the target gene:
[0109] Perform agarose gel electrophoresis verification on the fusion fragment to be verified. Use the San Prep column PCR product purification kit to recover the correctly positioned band according to the method described in the instruction manual of this kit to obtain the 5S rRNA-gRNA scaffod fragment. The gel electrophoresis pattern of this fragment is shown in the appendixFigure 1 。
[0110] Step S1-6, digesting the vector:
[0111] Digest the pFC332 vector with BglⅡ at 37 °C for 30 min;
[0112] After digestion, verify by agarose gel electrophoresis, and use the San Prep column PCR product purification kit to recover the band with the correct position to obtain the digested pFC332 vector.
[0113] Step S1-7, ligating the 5SrRNA-gRNA scaffod fragment with the digested pFC332 vector in the ligation system to obtain a ligation product:
[0114] The ligation system is: an aqueous solution of 5×SE Cloning Buffer with a volume concentration of 20%, the ligation system contains the digested pFC332 vector with a concentration of 5 ng / μL and the 5SrRNA-gRNA scaffod fragment with a concentration of 25 ng / μL; the ligation system also contains recombinant enzyme SE Recombinase with a volume concentration of 10%. For the components and dosages of the ligation system used in this example, see Table 2.
[0115] Table 2: Composition and dosage table of the ligation system
[0116]
[0117] Step S1-8, transformation of the ligation product and identification of positive clones:
[0118] Add the ligation product to DH5α, perform ice bath for 30 min, heat shock at 42 °C for 90 s, ice bath for 5 min in sequence, add LB liquid medium, and shake culture at 37 °C and 180 rpm for 1 h to obtain the activated bacterial liquid;
[0119] Centrifuge the activated bacterial liquid at 12000 rpm for 1 min to obtain a bacterial cell precipitate, coat it on an LB solid medium containing 50 μg / mL ampicillin and culture it in an incubator at 37 °C for 16 h to obtain single colonies;
[0120] Pick a single colony and add it to an LB liquid medium containing 50 μg / mL ampicillin, shake culture at 37 °C and 180 rpm for 6 h, take 1 μL of the bacterial liquid as a template for bacterial liquid PCR identification to obtain a bacterial liquid with the correct band. The PCR reaction program in this step is the same as that in Step S1-2;
[0121] The bacterial liquid PCR system is as follows: 2×Phanta Master Mix (5 μL), template (1 μL), 5S rRNA-F (0.5 μL), gRNA scaffold-R (0.5 μL), sterile water (3 μL);
[0122] The obtained bacterial liquid PCR products were verified by agarose gel electrophoresis. The bands in the correct positions were recovered and sequenced to obtain the bacterial liquid with correct sequencing. The results of gel electrophoresis verification are shown in the appendix Figure 2 .
[0123] Appendix Figure 2 In the appendix, lane 1 is the negative control, and lanes 2-10 are the sample bacterial liquids.
[0124] Steps S1-9, plasmid extraction and sequencing verification:
[0125] The bacterial liquid with correct sequencing was added to the LB liquid medium containing 50 μg / mL ampicillin, and shaken at 37 °C and 180 rpm for 16 h for enlarged culture. A plasmid miniprep kit was used to extract the plasmid to obtain the yeast Y1 Ste20 homologous gene knockout plasmid;
[0126] The obtained yeast Y1 Ste20 homologous gene knockout plasmid was sequenced, and the results were correct, proving that the recombinant plasmid Y1 Ste20 KO was successfully constructed.
[0127] Step S2, preparation of Chaetomium globosum CGMCC 6882 protoplasts, specifically including:
[0128] Step S2-1, scrape the mycelia of Chaetomium globosum CGMCC 6882, and wash and collect the cells with sterile water and 0.7 M NaCl solution in sequence.
[0129] Step S2-2, add 20 mL of enzyme digestion solution and digest at 37 °C and 120 rpm. During the experiment, the digestion time was controlled according to the growth of the cells. The digestion time in this example was 3.5 h. Stop digestion when the number of protoplasts reached 10 8 cells / mL;
[0130] In this example, the enzyme digestion solution was prepared by weighing 0.48 g of snail enzyme, 0.3 g of lysing enzyme, and 0.12 g of cellulase and dissolving them in 30 mL of deionized water, that is, the mass ratio of snail enzyme, lysing enzyme and cellulase was 4:2.5:1.
[0131] Step S2-3: Filter to obtain protoplasts. Wash the obtained protoplasts first with 0.7 M NaCl solution, then with STC buffer. Centrifuge at 4°C and 2000 rpm for 5 min, resuspend the cells with STC buffer, and store at 4°C to obtain Chaetomium globosum CGMCC 6882 protoplasts.
[0132] Step S3: Transformation and regrowth of Chaetomium globosum CGMCC 6882 protoplasts, specifically including:
[0133] Step S3-1: Mix the Chaetomium globosum CGMCC 6882 protoplasts prepared in Step S2 with the Y1Ste20 homologous gene knockout plasmid at a ratio of 10:1, add them to 150 μL of PTC solution, incubate on ice for 10 min, then add 1 mL of PTC solution, and incubate at 28°C for 30 min to obtain a mixture.
[0134] Step S3-2: Add the mixture to the regeneration medium and culture at 28°C for 12 h;
[0135] The composition of the regeneration medium is Flask A:Flask B:Flask C = 1:10:9 (volume ratio), where Flask A: Weigh 1 g of yeast extract powder and 1 g of enzymatically hydrolyzed casein, dissolve them in 50 mL of deionized water, mix well by magnetic stirring, and adjust the pH to 8.5; Flask B: Weigh 34.2 g of sucrose and dissolve it in 50 mL of deionized water; Flask C: Weigh 1.78 g of agar powder and dissolve it in 50 mL of deionized water.
[0136] Step S3-3: Pour an equal volume of hygromycin-resistant medium onto the regeneration medium and incubate upright at 28°C for 15 days; The preparation method of the hygromycin-resistant medium is 1 g of agar powder, made up to 100 mL with distilled water, and add 200 μg / mL hygromycin when sterilizing and pouring the plate.
[0137] Step S4: Conduct secondary screening using the hygromycin-resistant medium, specifically:
[0138] After the transformants grow, take a 0.5 cm × 0.5 cm block of culture with hyphae and culture it on the plate of the hygromycin solid seed medium for secondary screening to obtain a strain with a stable growth type. The process of secondary screening is shown in Appendix Figure 3 The result of verifying the hygromycin resistance gene using agarose gel electrophoresis is shown in Appendix Figure 4 After the sequencing result is correct, it proves that the transformed strain is successfully constructed.
[0139] Among them, Appendix Figure 3In the photo taken on the 14th day, the colonies at the lower left of each culture medium are the screened transformed strain colonies;
[0140] In this step, the preparation method of the hygromycin solid seed medium is as follows: weigh 0.3 g of beef extract, 2 g of sucrose, 0.1 g of yeast powder, 0.5 g of peptone, add 100 mL of deionized water, adjust the pH to 7.2, add 3.6 g of agar powder, and add 200 μg / mL hygromycin when sterilizing and pouring the plate.
[0141] The constructed transformed strain was named Chaetomium globosum XY1104, deposited in the China Center for Type Culture Collection, with the deposit registration number CCTCC NO: M 20242389, and the deposit date was October 30, 2024.
[0142] Example 2
[0143] The implementation method of this example is the same as that of Example 1, except that the parameters of some steps in Example 1 are adjusted, including:
[0144] There are differences in the ligation system in step S1-7. The ligation system of this example is an aqueous solution of 5×SE Cloning Buffer with a volume concentration of 15%. The ligation system contains the digested pFC332 vector with a concentration of 6 ng / μL and the 5SrRNA-gRNA scaffod fragment with a concentration of 20 ng / μL; the ligation system also contains the recombinase SERecombinase with a volume concentration of 12%;
[0145] The LB solid or liquid medium containing ampicillin in step S1-8 or S1-9 is the LB solid medium containing 60 μg / mL ampicillin and the LB liquid medium containing 60 μg / mL ampicillin, respectively;
[0146] The digestion time in step S2-2 is 4 h, and the mass ratio of snailase, lywallzyme, and cellulase in the enzyme solution is 5:2:1;
[0147] In step S3-1, the protoplasts of Chaetomium globosum CGMCC 6882 and the Y1Ste20 gene knockout plasmid are mixed at a ratio of 12:1, and the incubation temperature is 32°C;
[0148] In step S3-3, the preparation method of the hygromycin-resistant medium is 1.2 g of agar powder, made up to 100 mL with distilled water, and 180 μg / mL hygromycin is added when sterilizing and pouring the plate.
[0149] In the preparation process of the hygromycin solid seed medium in step S4, 3.8 g of agar powder is added.
[0150] This example can construct the transformed strain of Chaetomium globosum XY1104.
[0151] Example 3
[0152] The implementation method of this example is the same as that of Example 1, except that the parameters of some steps in Example 1 are adjusted, including:
[0153] There are differences in the ligation system in step S1-7. The ligation system in this example is an aqueous solution of 5×SE Cloning Buffer with a volume concentration of 25%. The ligation system contains the digested pFC332 vector with a concentration of 4 ng / μL and the 5SrRNA-gRNA scaffod fragment with a concentration of 30 ng / μL; the ligation system also contains the recombinase SE Recombinase with a volume concentration of 8%.
[0154] In step S1-8 or S1-9, it is the LB solid medium containing 40 μg / mL ampicillin and the LB liquid medium containing 40 μg / mL ampicillin;
[0155] The digestion time in step S2-2 is 3 h, and the mass ratio of snailase, lywallzyme and cellulase in the enzyme solution is 3:3:1;
[0156] In step S3-1, the protoplasts of Chaetomium globosum CGMCC 6882 and the Y1Ste20 gene knockout plasmid are mixed in a ratio of 8:1, and the incubation temperature is 8°C;
[0157] In step S3-3, the preparation method of the hygromycin-resistant medium is 1.5 g of agar powder, made up to 100 mL with distilled water, and 220 μg / mL hygromycin is added when sterilizing and pouring the plate.
[0158] In step S4, 3.5 g of agar powder is added during the preparation process of the hygromycin solid seed medium.
[0159] This example can also construct the transformed strain of Chaetomium globosum XY1104.
[0160] Example 4
[0161] In Example 4 of the present invention, the characteristics of Chaetomium globosum XY1104 are identified. During the research process of the present invention, the Chaetomium globosum XY1104 screened in Examples 1 to 3 were all identified, and the identification results were consistent; the strain screened in Example 1 of the present invention is taken as an example for description.
[0162] There are significant differences between Chaetomium globosum XY1104 and Chaetomium globosum CGMCC 6882 in colony morphology, hyphal morphology, and the color of the fermentation broth. For the results, see the appendix Figure 5 and 6 .
[0163] It can be clearly seen from Figure 5 and Figure 6 that on solid medium, the hyphal growth rate and colony diameter of Chaetomium globosum XY1104 are both smaller than those of Chaetomium globosum CGMCC 6882; in liquid medium, Chaetomium globosum XY1104 shows dense and fine hyphae, while the hyphae of Chaetomium globosum CGMCC 6882 are intertwined.
[0164] It can be seen that the hyphae of Chaetomium globosum XY1104 constructed in the present invention are shorter. Applying it to the fermentation production of dextran can avoid the problem of hyphal entanglement.
[0165] Example Five
[0166] Fermentation was carried out using the new strain Chaetomium globosum XY1104 constructed in Example One. The specific steps include inoculation, fermentation culture, extraction and purification of oligosaccharide dextran, specifically as follows:
[0167] The seed liquid of Chaetomium globosum XY1104 in the logarithmic phase was inoculated into the fermentation broth. 25 mL of the seed liquid was inoculated into every 1 L of the fermentation broth. The temperature of the fermentation culture was 30 °C, the culture time was 2.5 days, and the fermentation time was 7 days. Oxygen needed to be introduced during the fermentation process;
[0168] After the fermentation was completed, centrifugation and filtration were carried out to remove the precipitate and insoluble substances, and the filtrate was retained;
[0169] The filtrate was concentrated to 1 / 5 of the original volume to obtain a concentrated solution. Absolute ethanol was added to the concentrated solution to obtain an alcohol precipitation solution. Alcohol precipitation was carried out overnight at 4 °C, and the supernatant was discarded to obtain an alcohol precipitation precipitate;
[0170] The obtained alcohol precipitation precipitate was redissolved in water, and then concentrated again to a volume of 100 mL. 300 mL of Sevage reagent was added and shaken and centrifuged to remove proteins, and the supernatant after protein removal was obtained;
[0171] The supernatant after protein removal was dialyzed to remove salts, purified by gel chromatography, and freeze-dried to obtain oligosaccharide dextran, denoted as freeze-dried powder sample 1.
[0172] Example Six
[0173] The implementation method of this example is the same as that of Example 5, except that the fermentation conditions are adjusted. 50 mL of seed liquid is inoculated into every 1 L of fermentation broth. The temperature for fermentation culture is 28 °C, the culture time is 2 days, and the fermentation time is 6 days. The subsequent process is the same as that of Example 5, and the freeze-dried powder sample 2 is prepared.
[0174] Example 7
[0175] The implementation method of this example is the same as that of Example 5, except that the fermentation conditions are adjusted. 10 mL of seed liquid is inoculated into every 1 L of fermentation broth. The temperature for fermentation culture is 32 °C, the culture time is 3 days, and the fermentation time is 8 days. The subsequent process is the same as that of Example 5, and the freeze-dried powder sample 3 is prepared.
[0176] Comparative Example
[0177] Using Chaetomium globosum CGMCC 6882 as the fermentation strain, the implementation method is the same as that of Example 5, and the freeze-dried powder reference substance is prepared.
[0178] The color of the freeze-dried powder sample 1 and the freeze-dried powder reference substance was compared, and the results are shown in the appendix Figure 7 .
[0179] During the fermentation process, it was found that mycelial entanglement occurred in Chaetomium globosum CGMCC 6882 on the fourth day; while in the whole fermentation process of Chaetomium globosum XY1104 of the present invention in Example 5, Example 6 and Example 7, no mycelial entanglement occurred.
[0180] From Figure 8 and Figure 9 it can be seen that the exopolysaccharides of Chaetomium globosum XY1104 and Chaetomium globosum CGMCC 6882 show different states at different magnifications:
[0181] Under the scanning electron microscope, the exopolysaccharide (reference substance) of Chaetomium globosum CGMCC 6882 is in the form of solid large flakes, while the exopolysaccharide (sample) of Chaetomium globosum XY1104 presents smooth bubble-like shapes;
[0182] Under the transmission electron microscope, the exopolysaccharide (reference substance) of Chaetomium globosum CGMCC 6882 is in the form of irregular flakes and dense dots, while the exopolysaccharide (sample) of Chaetomium globosum XY1104 is mainly in the form of dense dots, with fewer irregular flakes.
[0183] Analysis and Inspection
[0184] I. Basic Structure Analysis
[0185] The basic structures of the extracellular polysaccharides in the freeze-dried powder sample 1 and the freeze-dried powder reference sample were analyzed using Fourier transform infrared spectroscopy and nuclear magnetic resonance. The relevant spectra are shown in Appendix Figure 10 ~Appendix Figure 14 .
[0186] In Appendix Figure 10 , obvious characteristic absorption peaks of polysaccharides are present at 3375 cm -1 and 2945 cm -1 , indicating that the main structure of the polysaccharide remains unchanged. The absorption peak at 3375 cm -1 is the stretching vibration of O-H, indicating the presence of hydrogen bonds within the polysaccharide. The absorption peak at 2945 cm -1 is the stretching vibration absorption peak of C-H. The peak at 1622 cm -1 is caused by the stretching of C=O and is an aldehyde group peak. The peak at 1416 cm -1 is the contraction vibration of -COOH. The peak at 1112 cm -1 is the stretching vibration of C-O-C glycosidic bonds and C-O-H side groups, which is the characteristic absorption peak of the pyran ring and also the characteristic absorption peak of glucose.
[0187] Figures 11 - 12
[0188]
[0189] Monosaccharide composition (mol%) In Figures 11 - 12 , through structural confirmation of the hydrogen spectrum and carbon spectrum of the freeze-dried powder sample 1, the freeze-dried powder of the sample of the present invention is a single β-glucose, while the freeze-dried powder of the reference sample is a heteropolysaccharide. The components were analyzed, and the specific results are shown in Table 3.
[0188] Table 3: Monosaccharide composition of freeze-dried powder sample 1 and freeze-dried powder reference sample
[0189] Monosaccharide composition (mol%) Lyophilized powder sample 1 Lyophilized powder sample 2 Lyophilized powder sample 3 Lyophilized powder reference Glucose 100 100 100 81.87 Mannose Not detected Not detected Not detected 10.85 Galactose Not detected Not detected Not detected 5.37 Galacturonic acid Not detected Not detected Not detected 1.91
[0190] As shown in Table 3, all components in all freeze-dried powder samples are glucose, but the freeze-dried powder reference sample is a heteropolysaccharide, and its components include glucose, mannose, galactose, and galacturonic acid. Moreover, the proportions of mannose and galactose in the freeze-dried powder reference sample are high, and the purity of glucose is only 81.87 Mol%. It can be seen that the glucan purity in the freeze-dried powder of the present invention is higher.
[0191] It was also found in the experiment that the yields of the freeze-dried powder sample 1, freeze-dried powder sample 2, and freeze-dried powder sample 3 of the present invention were 5.65 g, 5.54 g, and 5.36 g per liter of fermentation broth, respectively, all exceeding 5 g / L, while the yield of the freeze-dried powder reference sample was 1.93 g per liter of fermentation broth. It can be seen that the strain constructed in the present invention greatly improves the product yield.
[0192] The freeze-dried powder sample and the freeze-dried powder reference substance were used for the determination of molecular weight, and the results are shown in Table 4.
[0193] Table 4: Molecular weights of the freeze-dried powder sample and the freeze-dried powder reference substance
[0194] Index Lyophilized powder sample 1 Lyophilized powder sample 2 Lyophilized powder sample 3 Lyophilized powder reference Weight-average molecular weight, Mw (Da) 5231 5298 5201 51975 Number-average molecular weight, Mn (Da) 2285 2297 2211 26654 Polydispersity (Mw / Mn) 2.289 2.265 2.221 1.95
[0195] As can be seen from the results in Table 4, the β-glucan prepared by the present invention is an oligo-glucan, with a weight-average molecular weight of 5200 - 5300 and a number-average molecular weight of 2200 - 2300.
[0196] In summary, the present invention constructs a new strain named Chaetomium globosum XY1104. It not only has short hyphae and will not cause the problem of hyphae tangling the stirring device during the fermentation process, but also can improve the mass transfer effect during the fermentation process and increase the yield of glucan by nearly 3 times. The present invention also unexpectedly discovers that the strain constructed by the present invention can metabolize β-glucan alone, rather than heteropolysaccharide. Since the purity of the freeze-dried powder of β-glucan prepared by the present invention is 100%, it is more suitable as a raw material for health products, expanding the application market of β-glucan products.
[0197] Application effect test
[0198] In this test, the in vitro antioxidant activity and immune activity of the freeze-dried powder sample 1 and the freeze-dried powder reference substance were studied and compared.
[0199] I. In vitro antioxidant activity
[0200] The scavenging abilities of the freeze-dried powder sample 1, the freeze-dried powder reference substance on DPPH, ABTS, hydroxyl radicals and the iron-reducing power at the concentration of 0 Mg / mL - 5 Mg / mL were tested in vitro, with vitamin C at the same concentration as the control group.
[0201] 1. DPPH scavenging ability test
[0202] A series of solutions of the freeze-dried powder sample 1, the freeze-dried powder reference substance, vitamin C solution with concentrations to be measured and 0.40 mmol / L DPPH-ethanol solution were prepared; 180 μL of the DPPH-ethanol solution and 20 μL of the test solution were respectively pipetted into a 96-well plate, shaken and reacted in the dark for 30 min, and the absorbance was measured at 517 nm;
[0203] Using vitamin C as the positive control, the DPPH scavenging rate was calculated, and the results are shown in the appendix Figure 15 。
[0204] 2. ABTS scavenging ability test
[0205] Prepare a series of freeze-dried powder solutions of samples with concentrations to be measured, a freeze-dried powder solution of reference substance, a vitamin C solution, and an ABTS solution diluted with absolute ethanol to an absorbance of about 0.70 at 734 nm; use a pipette to measure 180 μL of the ABTS solution and 20 μL of the test solution into a 96-well plate respectively, shake well and react in the dark for 6 min, and measure the absorbance at 734 nm;
[0206] Using vitamin C as a positive control, calculate its scavenging rate, and the results are shown in the appendix Figure 16 .
[0207] 3. Hydroxyl radical scavenging ability test
[0208] Prepare a series of freeze-dried powder solutions of samples with concentrations to be measured, a freeze-dried powder solution of reference substance, a vitamin C solution, a 0.15 mmol / L FeSO4 solution, a 2 mmol / L salicylic acid-ethanol solution, and a 6 mmol / L H2O2 solution; use a pipette to measure 0.10 mL of the test solution, 0.50 mL of the FeSO4 solution, 0.20 mL of the salicylic acid-ethanol solution, 0.50 mL of the H2O2 solution, and 0.20 μL of distilled water into a 2 mL centrifuge tube respectively, shake well and incubate at 37 °C for 1 h, and measure the absorbance at 510 nm;
[0209] Using vitamin C as a positive control, calculate the hydroxyl radical scavenging rate, and the results are shown in the appendix Figure 17 .
[0210] 4. Iron reducing power test
[0211] Determine the iron ion reducing ability by the Prussian blue method. Mix 1 mL of the freeze-dried powder solution of the sample, 1 mL of the freeze-dried powder of the reference substance, 1 mL of PBS, and 1 mL of potassium ferricyanide (10 mg / mL), and react at 50 °C for 20 min; add 1 mL of trichloroacetic acid, gently invert and mix well, and centrifuge at 10000 rpm for 2 min;
[0212] Take 0.5 mL of the supernatant into a clean 2 mL EP tube, add 0.5 mL of distilled water and 100 μL of ferric chloride, mix well and react at room temperature for 10 min, and centrifuge at 10000 rpm for 2 min;
[0213] Take the supernatant to detect the absorbance at 700 nm, using vitamin C as a positive control, and the results are shown in the appendix Figure 18 .
[0214] II. Immunological activity
[0215] In vitro, test the ability of the freeze-dried powder sample 1 and the freeze-dried powder reference substance to release NO from RAW 264.7 cells and the ability of RAW 264.7 cells to secrete IL-1β, IL-6, and TNF-α at concentrations of 0-5 mg / mL.
[0216] 1. In vitro test on the effect of RAW264.7 macrophages on nitric oxide production
[0217] The concentration of NO in the cell culture medium was determined by Griess reagent.
[0218] RAW264.7 cells were inoculated into 96-well plates at a cell density of 1×10 5 cells / mL. According to the grouping, the control drug and freeze-dried samples and reference substance freeze-dried powder solutions with different concentrations were added. Six parallels were set in each group and incubated in an incubator for 24 h. The cell growth conditions and status of the blank group and experimental groups were observed under a microscope. Then, 50 μL of the supernatant from each well was taken, and 50 μL of Griess reagent solutions I and II were added successively. The plate was gently tapped horizontally to allow sufficient reaction, and the absorbance was measured at a wavelength of 540 nm. A standard curve was plotted by combining with the standard solution concentration, and the NO concentration of each experimental group was calculated. The results are shown in the appendix Figure 19 .
[0219] 2. Enzyme-linked immunosorbent assay
[0220] RAW264.7 cells were inoculated into 96-well plates at a cell density of 1×10 5 cells / mL. After 24 h, polysaccharides with different concentrations were added. After culturing for 24 h, the culture medium in the culture plate was aspirated, and the plate was rinsed 3 times with pre-cooled PBS to ensure that the old culture medium was rinsed clean;
[0221] After aspirating the excess PBS, an appropriate amount of cell lysate (containing 1% protease inhibitor and 0.5% phosphatase inhibitor) was added, and the cells were lysed by shaking on ice for 10 min;
[0222] After lysis, the cells were gently and fully pipetted with a pipette gun, and all the lysate was transferred to a sterile centrifuge tube. The centrifuge was pre-cooled in advance. After the temperature dropped to 4°C, the mixture was centrifuged at 12,000 rpm for 5 min;
[0223] The supernatant after centrifugation was detected using an ELISA kit (IL-6, IL-1β, and TNF-α). The results are shown in the appendix Figures 20 - 22 .
[0224] As can be seen from the above results, the in vitro antioxidant activity and immunological activity of the freeze-dried samples prepared by the present invention are superior to those of the reference substance freeze-dried powder.
Claims
1. A microorganism for producing oligosaccharide, characterized in that, The microorganism described is Chaetomium globosum XY1104. The preservation institution of the microorganism is the China Center for Type Culture Collection, and the preservation registration number is CCTCC NO: M 20242389. The preservation date is October 30, 2024; The hyphal morphology of the microorganism is white hyphae, short hyphae, growing adherently to the culture medium, and growing to 2 / 3 of the culture dish plate in 7 to 10 days; the optimal growth pH is neutral.
2. A method for constructing a microorganism for producing oligosaccharide dextran, which is used to construct a microorganism for producing oligosaccharide dextran as described in claim 1, characterized in that, The microorganism was obtained by modifying Chaetomium globosum CGMCC 6882 using CRISPR-Cas9 gene editing technology and protoplast fusion technology and through secondary screening, which specifically includes four steps: Step S1: Construct a yeast Y1Ste20 homologous gene knockout plasmid using CRISPR-Cas9 gene editing technology; Step S2: Prepare protoplasts of Chaetomium globosum CGMCC 6882; Step S3: Transformation and regrowth of protoplasts of Chaetomium globosum CGMCC 6882; Step S4: Conduct secondary screening using a hygromycin-resistant culture medium.
3. The construction method of a microorganism for producing oligosaccharide dextran according to claim 2, characterized in that, The specific content of the above Step S1 includes: Step S1-1: Primer design and synthesis: In the database, obtain the nucleotide sequence of the yeast Y1Ste20 gene, design primers for the target gene and conduct synthesis. The primers for the target gene include 5SrRNA-F, 5SrRNA-R, gRNA scaffod-F, and gRNA scaffod-R; Step S1-2: Amplify the 5SrRNA-Ste20gRNA fragment: Using the pFC 332-P 5SrRNA-gRNA scaffod vector as a template, amplify the 5SrRNA-Ste20gRNA fragment through a PCR reaction program. Use a PCR product purification kit to recover the band with the correct position and obtain the correct 5SrRNA-Ste20gRNA fragment; Step S1-3: Amplify the Ste20gRNA-gRNAscaffod fragment: Using the pFC 332-P 5SrRNA-gRNAscaffod vector as a template, amplify the Ste20gRNA-gRNA scaffod fragment through a PCR reaction program. Use a PCR product purification kit to recover the band with the correct position and obtain the correct Ste20gRNA-gRNA scaffod fragment; Step S1-4: Fragment fusion: Dilute the recovered products of the 5SrRNA-Ste20gRNA fragment and the Ste20gRNA-gRNA scaffod fragment by 10 times. Take equal amounts of the diluted recovered product solutions as templates and perform overlap extension PCR to obtain the 5SrRNA-gRNA scaffod fragment; Step S1-5: Purification of the target gene: The fusion fragment to be verified was subjected to agarose gel electrophoresis verification. The band with the correct position was recovered using a PCR product purification kit to obtain the 5S rRNA-gRNA scaffold fragment; Steps S1-6, digesting the vector: The pFC332 vector was digested with Bgl II. After the digestion, agarose gel electrophoresis was used for verification. The band with the correct position was recovered using a PCR product purification kit to obtain the digested pFC332 vector; Steps S1-7, ligating the 5S rRNA-gRNA scaffold fragment and the digested pFC332 vector in the ligation system to obtain a ligation product: The ligation system is an aqueous solution of 5×SE Cloning Buffer with a volume concentration of 15% - 25%. The ligation system contains the digested pFC332 vector with a concentration of 4 ng / μL - 6 ng / μL and the 5S rRNA-gRNA scaffold fragment with a concentration of 20 ng / μL - 30 ng / μL; the ligation system also contains a recombinase with a volume concentration of 8% - 12%; Steps S1-8, transformation of the ligation product and identification of positive clones: The ligation product was added to DH5α, followed by ice bath, heat shock at 42°C, and ice bath again. LB liquid medium was added and cultured with shaking to obtain the activated bacterial solution; The activated bacterial solution was centrifuged to obtain a bacterial cell pellet, which was spread and cultured on an LB solid medium containing 40 μg / mL - 60 μg / mL ampicillin to obtain single colonies; Single colonies were picked and added to an LB liquid medium containing 40 μg / mL - 60 μg / mL ampicillin and cultured with shaking. 1 μL of the bacterial solution was taken as a template for bacterial solution PCR identification to obtain a bacterial solution with correct sequencing; Steps S1-9, plasmid extraction and sequencing verification: The bacterial solution with correct sequencing was added to an LB liquid medium containing 40 μg / mL - 60 μg / mL ampicillin for scale-up culture. A plasmid miniprep kit was used to extract the plasmid to obtain the yeast Y1 Ste20 homologous gene knockout plasmid.
4. The construction method of a microorganism for producing oligosaccharides according to claim 3, characterized in that, The base sequences of the target gene primers in step S1-1 are: 5S rRNA-F: TGGAACAAATGGTGCTTGAGAG; 5S rRNA-R: CAGGCGTGCCGTCGGGAAGGCATACAACAGCGGGGATTCG; gRNA scaffold-F: CCTTCCCGACGGCACGCCTGGTTTTAGAGCTAGAAATAGC; gRNA scaffold-R: AGAGCATGATCAGCACAAAGGC.
5. The construction method of a microorganism for producing oligosaccharides according to claim 2, characterized in that, The specific steps of step S2 include: Steps S2-1, taking the mycelium of Chaetomium globosum CGMCC 6882, washing and collecting the bacterial cells with sterile water and NaCl solution in sequence; Step S2-2: Add the enzymatic hydrolysate for digestion and stop digestion when the number of protoplasts reaches 10 8 cells / mL. The enzymatic hydrolysate is an aqueous solution of snailase, lysing enzyme, and cellulase with a mass ratio of 3-5:2-3:
1. Step S2-3: Filter to obtain protoplasts, wash them successively with NaCl solution and STC buffer, centrifuge to obtain cell pellet, add STC buffer to resuspend the cells, and obtain the protoplasts of Chaetomium globosum CGMCC 6882 as described above.
6. The construction method of a microorganism for producing oligosaccharide dextran according to claim 2, characterized in that, The specific steps of Step S3 are as follows: Step S3-1: Mix the protoplasts of Chaetomium globosum CGMCC 6882 and the Y1Ste20 homologous gene knockout plasmid at a ratio of 8 - 12:1, add PTC solution, add PTC solution again after ice bath, and incubate at a temperature of 28°C - 32°C to obtain a mixture; Step S3-2: Add the above-mentioned mixture to the regeneration medium and incubate at a constant temperature; Step S3-3: Pour the hygromycin resistance medium onto the regenerated medium after culturing and continue to incubate at a constant temperature. The preparation method of the hygromycin resistance medium is to dissolve 1g - 1.5g agar powder in distilled water to a volume of 100 mL, and add 180 μg / mL - 220 μg / mL hygromycin when sterilizing and pouring the plate.
7. The construction method of a microorganism for producing oligosaccharides according to claim 2, characterized in that, The specific Step S4 is: Wait for the transformants to grow, take the block of culture with hyphae and culture it on the plate of the hygromycin solid seed medium for secondary screening. The formula of the hygromycin solid seed medium is 0.3g beef extract, 2g sucrose, 0.1g yeast powder, 0.5g peptone, 3.5g - 3.8g agar powder, and 100 mL deionized water.
8. Use of a microorganism for producing oligo-glucan, wherein oligo-glucan is prepared by using the microorganism for producing oligo-glucan as described in claim 1, characterized in that, The prepared oligosaccharide glucan is a β-glucan with a weight-average molecular weight of 5200 - 5300 and a number-average molecular weight of 2200 - 2300.
9. Use of a microorganism for producing oligosaccharides according to claim 8, characterized in that, The specific application steps include inoculation, fermentation culture, extraction and purification of oligosaccharide glucan; the inoculation is to inoculate the seed liquid of Chaetomium globosum XY1104 strain in the logarithmic phase into the fermentation broth, and the ratio of the seed liquid of the strain to the fermentation broth is 10 - 50:1000; the temperature of the fermentation culture is 28°C - 32°C, the culture time is 2 - 3 days, the fermentation time is 6 - 8 days, and oxygen needs to be introduced during the fermentation process.
10. Use of a microorganism for producing oligo-glucan according to claim 9, characterized in that, The specific steps of the extraction and purification are as follows: After the fermentation is completed, remove the precipitate and insoluble matter, and retain the filtrate; Concentrate the filtrate, add absolute ethanol for alcohol precipitation to obtain an alcohol precipitation; Redissolve the alcohol precipitation with water, concentrate again, add Sevag reagent and shake and centrifuge to remove proteins to obtain the supernatant after protein removal; Dialyze and desalt the supernatant after protein removal, purify by gel chromatography, and freeze-dry to obtain the oligosaccharide glucan as described above.
Citation Information
Patent Citations
Endophytic Fungi of Gynostemma Gynostemma and Its Application
CN103409323B