Application of RNA (Ribonucleic Acid) binding protein SAMD4A or coding gene thereof in differentiation from stem cells to myocardial cells
By constructing SAMD4A knockdown and overexpression plasmids, using lentivirus to infect human embryonic stem cells, exploring the regulatory mechanism of SAMD4A in cardiomyocyte differentiation, solving the problem of unknown differentiation function of RNA binding protein in cardiomyocytes, and providing an effective way to treat congenital heart disease.
Patent Information
- Application Number
- CN202510334007.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-20
- Publication Date
- 2025-07-04
AI Technical Summary
In the prior art, the function of RNA binding proteins in the differentiation of cardiomyocytes is unknown, resulting in complex pathogenic mechanisms of congenital heart disease and are difficult to prevent and treat.
By constructing SAMD4A knockdown and overexpression plasmids, and using lentivirus to infect human embryonic stem cells, establishing SAMD4A knockdown and overexpression stable cell lines, exploring the role of SAMD4A in cardiomyocyte differentiation, it was found that it affects cardiomyocyte differentiation by regulating the expression of genes such as MYH6, MYH7 and TNNT2, and affects signaling pathways through binding to FGF2 mRNA.
SAMD4A plays a key role in cardiomyocyte differentiation, can promote or inhibit the differentiation process of cardiomyocytes, and provides an effective way to treat congenital heart disease.
Smart Images

Figure CN120249191A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and particularly to the use of an RNA-binding protein SAMD4A or its encoding gene in the differentiation of stem cells into cardiomyocytes. Background Art
[0002] The heart is the first organ to form during embryonic development, and its formation is jointly regulated by a series of signaling pathways and key regulatory factors. Any abnormality in any link may lead to congenital heart disease (referred to as CHD for short). CHD is the most common birth defect in China at present, with an incidence rate of about 1% in live-born neonates, and its pathogenic mechanism is complex.
[0003] Previous studies have shown that RNA-binding proteins (RBPs) are almost involved in the whole process of heart development, including the development of the heart tube, heart formation and development to maturity. Abnormalities in their differentiation into cardiomyocytes will affect the early development of the heart and are closely related to the occurrence of CHD. In recent years, only a few RBPs in the heart have been characterized and their roles in heart development have been verified. Mechanistically, most of the related abnormalities caused by these RBPs stem from abnormal alternative splicing. However, given the large number of identified cardiac RBPs, the functions of most RBPs and their target molecules during myocardial differentiation are unknown, and there is still a lack of research on the role of RBPs in post-transcriptional regulation of gene expression and potential regulatory mechanisms. Therefore, it has become very crucial to explore the role and mechanism of RNA-binding proteins during myocardial differentiation.
[0004] The differentiation process of human embryonic stem cells (hESCs) into cardiomyocytes (CMs) is a complex and highly regulated process, which can generally be divided into the following key stages: The initial stage of differentiation is the embryonic stem cell stage (hESCs), and hESCs have the potential for self-renewal and multi-directional differentiation. At this stage, the cells are in an undifferentiated state and express specific pluripotency markers, such as OCT4, SOX2, and NANOG. Under specific induction conditions (such as the action of signaling molecules like activin A and BMP4), hESCs begin to differentiate into mesoderm (MES). The mesoderm is an important intermediate stage in embryonic development and has the potential to differentiate into various cell types, including the heart, bones, muscles, and blood vessels. At this stage, the cells start to express mesoderm markers, such as T (Brachyury), MIXL1, and EOMES. Mesoderm cells further differentiate into cardiac progenitor cells (CPs), and these cells have the potential to differentiate into cardiomyocytes, smooth muscle cells, and endothelial cells. Cardiac progenitor cells express specific cardiac progenitor cell markers, such as NKX2-5, ISL1, and TBX5. Cardiac progenitor cells finally differentiate into mature cardiomyocytes (CMs). At this stage, the cells start to express cardiomyocyte-specific markers, such as cTnT (cardiac troponin T), MYH6 (α-myosin heavy chain), and MLC2v (myosin light chain 2v). Mature cardiomyocytes have a contractile function and can form organized cardiac tissue. By deeply studying the molecular mechanism of hESC differentiation into cardiomyocytes, it can provide important scientific basis for the treatment of heart diseases and the development of regenerative medicine. Summary of the Invention
[0005] The object of the present invention is to provide an application of an RNA-binding protein SAMD4A or its coding gene in the differentiation of stem cells into cardiomyocytes. The specific high expression of the RNA-binding protein SAMD4A in cardiomyocytes is of great significance in cardiomyocyte differentiation and function. The SAMD4A gene of the RNA-binding protein plays a key role in inducing the differentiation of stem cells into cardiomyocytes and is an effective way for the future treatment of congenital heart diseases. The present invention explores the key role of the RNA-binding protein in cardiomyocyte differentiation and its regulatory mechanism, which is of great significance for the prevention and treatment of congenital heart diseases.
[0006] The object of the present invention can be achieved by the following technical solutions:
[0007] The first object of the present invention is to provide an application of an RNA-binding protein SAMD4A or its coding gene, or a biological material containing its coding gene, which regulates cardiomyocyte differentiation, in the differentiation of stem cells into cardiomyocytes.
[0008] Furthermore, the reference sequence number of the SAMD4A gene on NCBI is NM_015589.
[0009] Furthermore, the structure of the RNA-binding protein SAMD4A is as follows: SAMD4A is located in the q22.2 region of human chromosome 14, and the genomic sequence length is 226,219 nucleotides.
[0010] Furthermore, the RNA-binding protein SAMD4A, its coding gene, or a biological material containing its coding gene upregulates cardiomyocyte differentiation by increasing the expression levels of the MYH6, MYH7, and TNNT2 genes.
[0011] Furthermore, the RNA-binding protein SAMD4A, its coding gene, or a biological material containing its coding gene reduces the cardiomyocyte differentiation efficiency by decreasing the expression levels of the mesoderm stage marker genes MESP1 and PDGFR in the heart muscle.
[0012] Furthermore, the RNA-binding protein SAMD4A, its coding gene, or a biological material containing its coding gene reduces the cardiomyocyte differentiation efficiency by decreasing the expression level of the key cardiomyocyte transcription factor NKX2-5 at the cardiomyocyte progenitor cell stage.
[0013] Furthermore, the RNA-binding protein SAMD4A, its coding gene, or a biological material containing its coding gene reduces the cardiomyocyte differentiation efficiency by decreasing the expression levels of the cardiomyocyte-specific marker genes MYH7 and ACTN2.
[0014] Furthermore, the RNA-binding protein SAMD4A, its coding gene, or a biological material containing its coding gene reduces the cardiomyocyte differentiation efficiency by decreasing the expression level of the cardiomyocyte-specific protein MYH6.
[0015] Furthermore, the RNA-binding protein SAMD4A, its coding gene, or a biological material containing its coding gene affects cardiomyocyte lineage differentiation through the FGF2-mediated signaling pathway.
[0016] More specifically, the RNA-binding protein SAMD4A, its coding gene, or a biological material containing its coding gene binds to FGF2 mRNA through the binding sites BS137-145 and BS260-270, thereby affecting cardiomyocyte lineage differentiation.
[0017] Furthermore, the biological material is an expression cassette, a vector, a host cell, or a recombinant bacterium.
[0018] The second object of the present invention is to provide a vector for SAMD4A knockdown and overexpression plasmids, and the vector is a lentiviral vector containing SAMD4A.
[0019] Furthermore, the specific preparation steps of the lentiviral vector are as follows:
[0020] S1: Construct small hairpin ribonucleic acid molecules (shRNA) targeting the human SAMD4A gene. The shRNA includes shRNA1, shRNA2, and shRNA3, and the specific sequences of shRNA1, shRNA2, and shRNA3 are shown as SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3 respectively;
[0021] S2: Package the shRNA in S1 using lentivirus and infect human embryonic stem cells. Then, add puromycin to the infected human embryonic stem cells for drug screening to obtain SAMD4A knockdown stable transfected cell lines;
[0022] S3: Construct an overexpression plasmid targeting the human SAMD4A gene, and the sequence of the overexpression plasmid is shown as SEQ ID NO.4.
[0023] S4: Package the overexpression plasmid in S3 using lentivirus and infect human embryonic stem cells. Then, add puromycin to the infected human embryonic stem cells for drug screening to obtain SAMD4A overexpression stable transfected cell lines.
[0024] The third object of the present invention is to provide a cell model with SAMD4A knockdown and overexpression, and the cell model contains the above lentiviral vector containing SAMD4A.
[0025] The present invention provides an application of SAMD4A in cardiomyocyte differentiation, specifically as follows:
[0026] (1) Elucidate the important role of SAMD4A in cardiomyocyte lineage differentiation by inducing the directed differentiation of human embryonic stem cells into cardiomyocytes;
[0027] (2) Explore the function of the mRNA of FGF2 bound by SAMD4A;
[0028] (3) Explore the molecular mechanism by which SAMD4A targets FGF2 mRNA to affect cardiomyocyte differentiation.
[0029] Further, in step (2), the FGF2 is fibroblast growth factor and is related to the self-renewal and directed cardiomyocyte differentiation of human embryonic stem cells.
[0030] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0031] The importance of SAMD4A in cardiomyocyte lineage differentiation was elucidated by inducing the differentiation of human embryonic stem cells into cardiomyocytes. During cardiomyocyte-directed differentiation, the expression of SAMD4A gradually increased, and the expression of cardiomyocyte marker genes MYH6, MYH7, and TNNT2 also gradually increased with cardiomyocyte differentiation. This indicates that SAMD4A is a key gene during the stage transition and the entire differentiation process of cardiomyocyte differentiation, and plays an important role in cardiomyocyte differentiation and cardiomyocyte function;
[0032] By constructing SAMD4A knockdown and overexpression plasmids and using lentivirus to infect human embryonic stem cells to establish SAMD4A knockdown and overexpression stable cell lines, it was found that downregulation of SAMD4A expression significantly decreased the expression of mesoderm stage marker genes MESP1 and PDGFR in the heart, the key cardiomyocyte transcription factor NKX2-5 at the cardiomyocyte progenitor stage, and the cardiomyocyte-specific marker genes MYH7 and ACTN2; the protein level of the cardiomyocyte-specific protein MYH6 was significantly reduced, and the cardiomyocyte differentiation efficiency decreased. Overexpression of SAMD4A had the opposite result to the above, indicating that SAMD4 plays an important role in cardiomyocyte differentiation;
[0033] By upregulating the expression of SAMD4A in SAMD4A knockdown and overexpression human embryonic stem cell lines, it was found that the mRNA level of FGF2 was positively correlated with the expression of SAMD4A, and RIP-qPCR experiments demonstrated the direct binding of SAMD4A to FGF2, indicating that SAMD4A may affect cardiomyocyte lineage differentiation through the FGF2-mediated signaling pathway;
[0034] Using the dual-luciferase reporter system, four potential binding sites in the predicted FGF2 mRNA that may bind to SAMD4A: BS137-145, BS260-270, BS743-900, and BS2327-2453, were inserted downstream of the luciferase site 3’UTR to construct the pDuo-luciferase-FGF2 binding site dual-luciferase reporter gene vector. The SAMD4A knockdown and overexpression plasmids were co-transfected with the pDuo dual-luciferase reporter gene plasmid into HEK293T cells respectively. Fluorescence activity detection found that SAMD4A binds to FGF2 mRNA through these two binding sites, BS137-145 and BS260-270;
[0035] Treat SAMD4A - OE - hESCs and their control group cells with Actinomycin D respectively to inhibit mRNA synthesis, and use qRT - PCR experiments to detect the expression of FGF2 mRNA, that is, the remaining percentage of mRNA. The results show that after overexpression of SAMD4A, SAMD4A can significantly delay the degradation of FGF2 mRNA. This indicates that overexpression of SAMD4A inhibits the degradation of FGF2 mRNA, and SAMD4A has the effect of stabilizing FGF2 mRNA. Exogenous application of FGF2 inhibitor was found to significantly reduce the activation effect of SAMD4A on the AKT signaling pathway, indicating that SAMD4A regulates cardiomyocyte lineage differentiation through the FGF2 - mediated signaling pathway.
[0036] In summary, the specific high expression of SAMD4A in cardiomyocytes is of great significance in the differentiation and function of cardiomyocytes. The RNA - binding protein SAMD4A gene plays a key role in inducing the differentiation of stem cells into cardiomyocytes and is an effective way for future treatment of congenital heart diseases. Brief Description of the Drawings
[0037] Figure 1 Shows a schematic diagram of the establishment of a human embryonic stem cell - induced cardiomyocyte (hESCs - CM) model; among them, Figure 1 A is a flow chart for the establishment of a human embryonic stem cell - induced cardiomyocyte model; Figure 1 B is a cell morphology diagram at different time points during the differentiation of human embryonic stem cells into cardiomyocytes, with a scale bar of 500 μm; Figure 1 C is the detection of the expression of marker genes at different time points of differentiation by qRT - PCR during cardiomyocyte differentiation. The marker genes in the human embryonic stem cell stage (hESC) are NANOG, OCT4, and SOX2; the marker gene in the mesoderm stage (MES) is MESP1; the marker genes in the cardiac progenitor cell stage (CP) are ISL1, NKX2 - 5, and TBX5; the marker genes in the cardiomyocyte stage (CM) are TNNT2, MYH6, and MYH7, with GAPDH as the internal reference gene; Figure 1 D is the detection of cardiomyocyte differentiation efficiency by flow cytometry. Among them, the cells in the Q3 region are positive cells for the cardiomyocyte marker TNNT2, and the value represents the percentage of TNNT2 - positive cells in all cells. Isotype control is the isotype control; Figure 1 E is the detection of the expression of SAMD4A at different time points of differentiation by qRT - PCR during the differentiation of human embryonic stem cells into cardiomyocytes.
[0038] Figure 2 Shows a schematic diagram of the construction of the SAMD4A knockdown vector; among them, Figure 2After transfection with the control plasmid and three shRNAs, the transfection efficiency was determined by observing green fluorescence under a fluorescence microscope. Scale bar: 500 μm. Figure 2 B shows the knockdown efficiency of three SAMD4A-shRNAs detected by qRT-PCR, with GAPDH as the internal reference gene. Figure 2 C shows the protein expression of SAMD4A in the SAMD4A-KD-hESCs line detected by Western blot, with GAPDH as the internal reference gene.
[0039] Figure 3 The effects of SAMD4A knockdown on cardiomyocyte differentiation are shown. Among them, Figure 3 A shows the expression of SAMD4A at different stages during the induction of cardiomyocyte differentiation in SAMD4A-knockdown hESCs cell line and control hESCs detected by qRT-PCR, with GAPDH as the internal reference gene. Figure 3 B-3E show the expression of the mesoderm marker genes MESP1 and PDGFR, as well as the ectoderm (OTX2) and mesendoderm (MIXL1, FOXA2, SOX17, PITX2) marker genes, the cardiomyocyte progenitor marker gene NKX2-5, and the cardiomyocyte marker genes MYH7 and ACTN2 during the induction of cardiomyocyte differentiation in the SAMD4A-KD-hESCs line detected by qRT-PCR, with GAPDH as the internal reference gene. Figure 3 F shows the protein expression of MYH6 in cardiomyocytes generated from SAMD4A-knockdown hESCs cell line detected by Western blot, with GAPDH as the internal reference gene, N = 9. Figure 3 G shows the morphology of cardiomyocytes generated from SAMD4A-knockdown hESCs cell line and control cell line on day 20 of cardiomyocyte differentiation. Left: Scale bar: 200 μm. Right: Statistical chart of the beating frequency of cardiomyocytes in the SAMD4A-knockdown group and the control group. Figure 3 H shows immunofluorescence staining to obtain fluorescence images of cardiomyocytes derived from SAMD4A-knockdown hESCs cell line and control cell line. Red is the cardiomyocyte marker cardiac troponin T (cTnT), and blue is nuclear staining DAPI. The statistical results of fluorescence intensity were analyzed by ImageJ. Scale bar: 100 μm. Figure 3 I shows the analysis of the differentiation efficiency of cardiomyocytes derived from SAMD4A-knockdown hESCs cell line and control cell line by flow cytometry. The percentage of TNNT2-positive cardiomyocytes in the Q3 region was analyzed by FlowJo (v10.4.0), and the Isotype control was used as the isotype control.
[0040] Figure 4 The schematic diagram of the construction of the SAMD4A overexpression vector is shown. Among them, Figure 4A is the map of the overexpression vector GV367 of SAMD4A; Figure 4 B is the detection of PCR amplification products by agarose gel electrophoresis, and the DNA molecular weight maker ranges from 100 bp to 5 kb; Figure 4 C is the identification of recombinant plasmids by agarose gel electrophoresis. 1: negative control (ddH2O), 2: negative control (empty vector self-ligation control group), 3: positive control (GAPDH), M: Marker (100 bp - 5 kb), 4 - 11: transformants No. 1 - 8; Figure 4 D is the fluorescence imaging to record the morphology of SAMD4A-overexpressing hESCs. Among them, CTR: control group hESCs, OE: SAMD4A-overexpressing hESCs, Bright: bright field, GFP: green fluorescence, scale bar 500 μm; Figure 4 E is the detection of the mRNA expression level of SAMD4A in SAMD4A-overexpressing hESCs cell line by qRT-PCR; Figure 4 F is the detection of the protein expression of SAMD4A in SAMD4A-overexpressing cell line by Western blot.
[0041] Figure 5 Shows the effect of SAMD4A overexpression on cardiomyocyte differentiation; among them, Figure 5 A is the detection of the expression of SAMD4A at different stages during the induction of cardiomyocyte differentiation in SAMD4A-overexpressing hESCs cell line and control group hESCs by qRT-PCR, with GAPDH as the internal reference gene; Figure 5 B - 5E are the detections of the expressions of mesoderm marker genes PDGFR and NODAL, germ layer differentiation marker genes, ectoderm (OTX2) and mesendoderm (FOXA2, SOX17 and PITX2), cardiomyocyte progenitor marker genes (GATA4 and ISL1), cardiomyocyte marker genes (MYH7 and MYL2), and the ratio of cardiomyocyte maturation marker MYH7 / MYH6 during the induction of cardiomyocyte differentiation in SAMD4A - OE - hESCs cell line by qRT-PCR, with GAPDH as the internal reference; Figure 5 F is the morphological diagram of cardiomyocytes induced from SAMD4A-overexpressing hESCs cell line and control cell line on the 20th day of cardiomyocyte differentiation (left), scale bar 200 μm, and the statistical chart of the beating frequencies of cardiomyocytes in SAMD4A-overexpressing group and control group (right); Figure 5 G is the detection of the protein expressions of cardiomyocyte marker genes MYH6 and TNNT2 in cardiomyocytes induced from SAMD4A-overexpressing hESCs cell line by Western blot, with GAPDH as the internal reference gene.
[0042] Figure 6Shows the screening and identification of SAMD4A target mRNAs; among them, Figure 6 A shows the signaling pathways enriched with target mRNAs bound to SAMD4A by KEGG pathway analysis, Figure 6 B shows the intersection of DEGs in SAMD4A-KD-hESCs RNA-seq data and target mRNAs obtained from the database that bind to SAMD4A. A total of 72 genes overlap, and among them, FGF2 is one of the potential target mRNAs bound to SAMD4A; Figure 6 C shows the expression of FGF2 at different stages during the induction and differentiation of hESCs into cardiomyocytes by qRT-PCR, with GAPDH as the internal reference gene; Figure 6 D shows that RIP-qPCR confirms the direct binding of SAMD4A to the FGF2 mRNA transcript. IgG is the negative control, fold enrichment is the enrichment degree, and a target mRNA with a fold enrichment greater than 1 (calculated as 2 -ΔΔCt is considered a "confirmed target", while two non-target mRNAs with a fold enrichment less than or equal to 1 are considered to have no binding relationship.
[0043] Figure 7 Shows that SAMD4A regulates the mRNA stability and translation of FGF2 by binding to its mRNA; among them, Figure 7 A is a schematic diagram of the FGF2 mRNA, which contains four predicted binding sites of SAMD4A to the FGF2 mRNA. The position of the coding sequence (CDS) on the mRNA is: 345 nt - 812 nt; Figure 7 B is a schematic diagram of the construction of the dual-luciferase reporter assay vector to verify the effect of SAMD4A on the binding sites of the FGF2 mRNA; Figure 7 C-7D shows the transfection efficiency determined by observing the green fluorescence under a fluorescence microscope after transfecting SAMD4A knockdown / overexpression plasmids and control plasmids, as well as the successfully constructed dual-luciferase reporter gene plasmid (FGF2-BS) and empty plasmid. Scale bar: 500 μm; Figure 7 E-7F shows the effect of SAMD4A on the binding sites of the FGF2 mRNA verified by the dual-luciferase reporter assay under the conditions of SAMD4A knockdown and overexpression; Figure 7Schematic diagram of the effect of SAMD4A on the stability of FGF2 mRNA and experimental detection of FGF2 mRNA stability. FGF2 mRNA is stable in the presence of SAMD4A protein binding and degrades in the absence of SAMD4A binding (upper figure). After treating SAMD4A-OE-hESCs with actinomycin D (1 μM) at different time points of 0, 30, 60, and 90 min, qRT-PCR was used to quantitatively analyze the abundance of FGF2 mRNA, with GAPDH as the internal reference gene (lower figure). Figure 7 H-7I is at the protein level. The protein expression of FGF2 in SAMD4A-KD-hESCs, SAMD4A-OE-hESCs, and the control cell line was detected, with GAPDH as the internal reference.
[0044] Figure 8 It shows that SAMD4A regulates the differentiation of cardiomyocyte lineage through the FGF2-mediated signaling pathway; Western blot was used to detect the protein expression of the phosphorylation site of AKT-Ser473 (p-AKT) in the SAMD4A-OE-hESCs cell line and the control cell line under the treatment of DMSO and the FGF2 inhibitor SU5402, with GAPDH as the internal reference gene. Detailed implementation mode
[0045] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments. This embodiment is implemented on the premise of the technical solution of the present invention, and the detailed implementation mode and specific operation process are given, but the protection scope of the present invention is not limited to the following embodiments.
[0046] In the following embodiments, the sequences are as follows:
[0047] The sequence of SAMD4A-shRNA1-F is as shown in SEQ ID NO.4:
[0048] CCGGGCTCATAGACAAGTGTCTAATCTCGAGATTAGACACTTGTCTATGA GCTTTTTG;
[0049] The sequence of SAMD4A-shRNA1-R is as shown in SEQ ID NO.5:
[0050] AATTCAAAAAGCTCATAGACAAGTGTCTAATCTCGAGATTAGACACTTGT CTATGAGC;
[0051] The sequence of SAMD4A-shRNA2-F is as shown in SEQ ID NO.6:
[0052] CCGGGTGGAGGGTATTAGAGGAAATCTCGAGATTTCCTCTAATACCCTCC ACTTTTTG;
[0053] The sequence of SAMD4A-shRNA2-R is shown in SEQ ID NO.7:
[0054] AATTCAAAAAGTGGAGGGTATTAGAGGAAATCTCGAGATTTCCTCTAATA CCCTCCAC;
[0055] The sequence of SAMD4A-shRNA3-F is shown in SEQ ID NO.8:
[0056] CCGGCAGTGGTGTTCTACAATATTACTCGAGTAATATTGTAGAACACCAC TGTTTTTG;
[0057] The sequence of SAMD4A-shRNA3-R is shown in SEQ ID NO.9:
[0058] AATTCAAAAACAGTGGTGTTCTACAATATTACTCGAGTAATATTGTAGAA CACCACTG;
[0059] The qPCR primer sequences are shown in Table 7:
[0060] Table 7 qPCR primer sequences
[0061]
[0062]
[0063]
[0064] In the following examples, unless otherwise specified, the raw materials or processing techniques are conventional commercially available raw material products or conventional processing techniques in the art.
[0065] The following will describe in detail some embodiments of the present invention with reference to the accompanying drawings. Without conflict, the following embodiments and the features in the embodiments can be combined with each other.
[0066] Example 1
[0067] This example provides a method for establishing a human embryonic stem cell-induced cardiomyocyte (hESCs-CM) model, and the specific steps are as follows:
[0068] By replacing different culture media at different time points during the differentiation of human embryonic stem cells (hESCs), Figure 1 A), human embryonic stem cell (hESC) period (day 0), mesoderm (MES) period (day 5), cardiac progenitor cell (CP) period (day 10), and cardiomyocyte (CM) period (day 14). A stable human embryonic stem cell-induced cardiomyocyte differentiation model was constructed and the cell morphology at different periods was recorded ( Figure 1 B), and collected cell RNA at different time points to detect the expression of marker genes at different stages of myocardial differentiation ( Figure 1 C).
[0069] like Figure 1 As shown in C, the stem cell marker genes NANOG, OCT4 and SOX2 have the highest expression levels on day 0 and are gradually downregulated during the differentiation process, indicating that human embryonic stem cells tend to differentiate; MESP1 is highly expressed in the mesoderm period; cardiomyocyte-specific transcription factors ISL1, NKX2.5 and TBX5 are gradually upregulated during the differentiation process. In the model constructed in this example, the cardiomyocytes beat autonomously on the 14th day of differentiation, and the cardiomyocyte marker genes TNNT2, MYH6 and MYH7 are highly expressed.
[0070] As the culture time increases, the induced cardiomyocytes will undergo contraction coupling. The cells in the well plate are coupled into a sheet under a microscope, and the beating frequency tends to be uniform. The culture time can be extended according to experimental needs to obtain relatively mature cardiomyocytes, or the cardiomyocytes can be frozen and subsequently resuscitated and cultured.
[0071] On the 20th day of culture, the cardiomyocytes were digested into single cells and the expression of the cardiomyocyte marker cTnT was detected by flow cytometry. The cardiomyocyte differentiation efficiency could reach 83.9% ( Figure 1 D) The above results indicate that this example constructs an effective model of human embryonic stem cell-induced differentiation into cardiomyocytes.
[0072] Using the above-mentioned induction of myocardial differentiation model, this example collected cell samples at four key time points during the differentiation process. It was found that during the differentiation of human embryonic stem cells into myocardial cells, the mRNA expression level of SAMD4A was high in the stem cell period, downregulated in the mesoderm period, and upregulated after the mesoderm period. It was highly expressed in the myocardial cell period ( Figure 1 E).
[0073] The above studies found that the RNA-binding protein SAMD4A is specifically and highly expressed in cardiomyocytes.
[0074] Example 2
[0075] This embodiment provides a method for constructing a human embryonic stem cell knockdown cell line of the RNA-binding protein SAMD4A gene, and the specific steps are as follows:
[0076] (1) shRNA sequence design
[0077] Design the shRNA sequence of the SAMD4A gene, as shown in Table 1.
[0078] Table 1 SAMD4A gene shRNA sequence
[0079]
[0080] (2) Construction of the SAMD4A shRNA knockdown plasmid
[0081] (2-1) Design primers SAMD4A-shRNA1, SAMD4A-shRNA2, and SAMD4A-shRNA3. The upstream and downstream sequences of the primers are as shown in SEQ ID NO.4 to SEQ ID NO.9.
[0082] (2-2) The primers are annealed to form sticky-end double-stranded fragments. The reaction system is shown in Table 2:
[0083] Table 2 PCR reaction system
[0084]
[0085] The annealing program is shown in Table 3:
[0086] Table 3 PCR annealing program
[0087]
[0088] (2-3) Preparation of linearized expression vector: The expression vector is digested with a restriction enzyme (the digestion system is shown in Table 4). The digestion temperature is 37 °C, the digestion time is 1-3 hours, the digestion product is detected by agarose gel electrophoresis, and the target vector band is recovered from the gel.
[0089] Table 4 Digestion system (20 μL)
[0090]
[0091]
[0092] (2-4) Ligation: Prepare according to the ligation system shown in Table 5 and ligate overnight at 16 °C.
[0093] Table 5 Ligation system
[0094]
[0095] (2-5) Transformation: Add 10 μL of plasmid DNA (diluted to 1 ng / μL) to 50 μL of competent cells, gently mix, incubate on ice for 30 min, heat shock in a 42 °C water bath for 90 s, immediately incubate on ice for 5 min, add 200 μL of antibiotic-free LB liquid medium to the EP tube, culture at 37 °C and 200 rpm on a shaker for 1 h to restore the normal growth state, evenly spread on plates (containing 50 μg / mL Ampicillin antibiotic), incubate upright for 1 h and then invert and culture overnight. Pick colonies from the transformed recombinant plasmid plates, use a pipette tip to pick a single colony, directly insert the pipette tip into 5 mL of Ampicillin-resistant LB culture medium, culture at 37 °C and 250 rpm for 14 h, and send the bacterial solution for testing.
[0096] (2-6) Plasmid extraction: Pick positive monoclonal colonies with correct sequencing for shaking culture and amplification, and perform endotoxin-free plasmid extraction for subsequent cell transfection.
[0097] (3) Construction of SAMD4A shRNA knockdown lentiviral cell line:
[0098] (3-1) Lentiviral packaging: Mix in the following ratio, target plasmid: MX192 (psPAX2): MX196 (pMD2G) = 4 μg: 3 μg: 2 μg, add to 600 μL of CaCl2 solution, and pipette to mix evenly.
[0099] (3-2) Dropwise add the DNA-CaCl2 mixture into 600 μL of BBS solution, pipette to mix evenly, incubate at room temperature for 20 min, evenly dropwise add the DNA-CaCl2-BBS mixture into a 10 cm dish, shake well, and culture overnight in the incubator. On the third day, take the transfected HEK293T, observe the transfection efficiency under a fluorescence microscope, aspirate the culture medium, add 15 mL of fresh virus harvest medium (DMEM, 10% FBS, 1% PS / L-glu, 1% Pyruvate), and culture in the incubator.
[0100] (3-3) Lentivirus concentration and purification: According to the cell status, collect the supernatant of HEK293T cells transfected for 48 h or 72 h, centrifuge at 4 °C and 500 g for 10 min, filter and collect with a 0.45 μm filter. If not purified, it can be temporarily stored at 4 °C. Add 0.25 times the volume of PEG-8000 virus concentrate, mix well and place at 4 °C, gently mix once every 20 - 30 min for a total of 3 - 5 times, and incubate overnight at 4 °C. The next day, centrifuge the virus at 4 °C and 4000 g for 30 min, discard the supernatant, add 1 / 200 volume of DMEM of the virus stock solution, gently pipette to mix evenly, aliquot and store at -80 °C.
[0101] (3-4) Lentiviral infection of target cells: Determine the optimal infection conditions and MOI (MOI = virus titer × virus volume) / number of cells in advance. The optimal MOI in this experiment is 100. Calculate the virus dosage according to the cell MOI value, add the virus for infection, and after 72 h of infection, confirm the infection effect under the microscope and observe GFP fluorescence. Select cells with good infection effect and good cell state for subsequent puromycin screening.
[0102] (3-5) Screening of drug concentration gradient to determine the optimal concentration of puromycin. The optimal concentration in this experiment is 2 μg / mL. Place the cells with good state after lentiviral infection in a medium containing 2 μg / mL puromycin, change the medium every 2 days, and decide whether to passage according to the cell state. After continuous screening for 7-14 days, observe the cell state and GFP fluorescence ( Figure 2 A), and detect the mRNA or protein expression by qPCR or Western Blot. Further pick appropriate monoclonal cells, digest them into single cells, use a flow cytometer to sort out GFP-positive cells, re-plate and culture for passage to complete the construction of stable transfected cell lines, as Figure 2 shown in B and 2C.
[0103] Figure 3 showed the effect of SAMD4A knockdown on cardiomyocyte differentiation. In this example, a monolayer culture method was used to induce a cardiomyocyte differentiation model. The above constructed SAMD4A knockdown hESCs were induced to differentiate into cardiomyocytes, and cell samples were collected at different stages of cardiomyocyte differentiation, RNA was extracted and qRT-PCR was used to detect the expression of marker genes during cardiomyocyte differentiation. Compared with the control group, the expression of SAMD4A was down-regulated throughout the process of inducing cardiomyocyte differentiation in SAMD4A knockdown hESCs ( Figure 3 A). At the same time, during the process of inducing cardiomyocyte differentiation in SAMD4A knockdown hESCs, the expression of the mesoderm marker genes MESP1 and PDGFR in the myocardium was significantly down-regulated ( Figure 3 B), and the expression of the endoderm marker genes FOXA2 and SOX17 was significantly down-regulated ( Figure 3 C); during the cardiomyocyte progenitor cell stage, the expression of the key cardiomyocyte transcription factor NKX2-5 was down-regulated ( Figure 3 D); the expression of the cardiomyocyte-specific marker genes MYH7 and ACTN2 was significantly down-regulated ( Figure 3 E). Observation by Western blot immunoblot found that the protein level of MYH6 in SAMD4A knockdown cardiomyocytes was significantly down-regulated ( Figure 3 F).
[0104] On the 20th day of cardiomyocyte differentiation, it was observed that the cardiomyocytes in the control group were almost coupled into sheets and beat vigorously, while in the SAMD4A knockdown group, the beating amplitude of cardiomyocytes decreased and the frequency slowed down.Figure 3 G). For immunofluorescence staining analysis, it was found that compared with the control group, the number of cTnT-positive cells in cardiomyocytes at day 20 of cardiomyocyte differentiation with SAMD4A knockdown was significantly reduced ( Figure 3 H); Flow cytometry analysis found that the TNNT2-positive cells in cardiomyocytes at day 20 of differentiation in SAMD4A-knockdown cardiomyocytes were approximately 24.3%, and the differentiation efficiency was significantly reduced compared with the control group ( Figure 3 I).
[0105] The above research found that knockdown of the RNA-binding protein SAMD4A inhibits cardiomyocyte differentiation.
[0106] Example 3
[0107] This example provides a method for constructing an SAMD4A-overexpressing human embryonic stem cell line. The specific steps are the same as those for constructing the SAMD4A-knockdown cell line, and the vector used is GV367, which will not be elaborated here.
[0108] Figure 4 Shows a schematic diagram of the construction of the SAMD4A overexpression vector. Using the GV367 vector ( Figure 4 A), primers were designed, and the target gene fragment was obtained by PCR amplification. Agarose gel electrophoresis showed that the size of the PCR product was 2204 bp ( Figure 4 B). Figure 4 C shows the PCR identification results. The size of the PCR product of the positive transformant was 847 bp, and finally sequencing alignment proved that the vector construction was successful. The plasmid of the overexpressed SAMD4A target and the packaging plasmid were co-coated on HEK293T cells for lentivirus packaging, infected human embryonic stem cells, and positive clones were screened using puromycin and GFP fluorescence, and then expanded in culture to obtain the SAMD4A-overexpressing human embryonic stem cell (SAMD4A-OE-hESCs) line ( Figure 4 D). Total RNA samples were extracted and reverse transcribed into cDNA. Using GAPDH as an internal reference, the overexpression efficiency of SAMD4A was detected. Compared with the control group, the expression level of SAMD4A mRNA was significantly upregulated by about 2.5 times ( Figure 4 E). Cell samples were lysed to extract proteins, and the expression level of SAMD4A protein was detected by Western blot. Compared with the control group, the expression of SAMD4A protein was significantly upregulated ( Figure 4 F), indicating that the overexpressed SAMD4A stable transfected cell line was successfully constructed.
[0109] Detect the effect of overexpressing SAMD4A on cardiomyocyte differentiation as follows:
[0110] The constructed SAMD4A-OE-hESCs line was induced to differentiate into cardiomyocytes using the monolayer culture method, and RNA samples were collected at different time points during differentiation and reverse transcribed into cDNA. The changes in the expression levels of different molecules at different stages were detected by qRT-PCR. After overexpressing SAMD4A, compared with the control group, the expression of SAMD4A was upregulated during the induction of cardiomyocyte differentiation in SAMD4A-OE-hESCs ( Figure 5 A). At the same time, it was found that during the induction of cardiomyocyte differentiation in SAMD4A-overexpressing hESCs, in the cells of the mesoderm stage (MES), the mRNA levels of the mesoderm marker genes PDGFR and NODAL were significantly increased ( Figure 5 B). Among the three germ layer marker genes, the mRNA levels of the endoderm and mesoderm marker genes (FOXA2, SOX17, and PITX2) were significantly increased, while the mRNA levels of the ectoderm marker genes (such as OTX2) were significantly decreased, indicating that overexpressing SAMD4A effectively promoted the differentiation of hESCs into cardiac mesoderm ( Figure 5 C); at the cardiomyocyte progenitor stage (CP), the expressions of the key cardiac transcription factors GATA4 and ISL1 were significantly upregulated, indicating that overexpressing SAMD4A significantly promoted the differentiation of human embryonic stem cells into cardiac progenitor cells ( Figure 5 D); at the cardiomyocyte stage (CM), the expression levels of the cardiomyocyte-specific marker genes MYH7 and MYL2 were significantly increased, and the ratio of MYH7 / MYH6 was significantly increased ( Figure 5 E). In human cardiomyocytes, the transition from MYH6 to MYH7 occurs during myocardial maturation, indicating that overexpressing SAMD4A significantly promoted cardiomyocyte differentiation and further promoted the maturation of cardiomyocytes. When cardiomyocytes differentiated to day 20, it was observed that the cardiomyocytes were almost coupled into sheets and beat vigorously, and in the SAMD4A-overexpressing cardiomyocyte group, the beating frequency of the cardiomyocytes was significantly increased ( Figure 5 F). At the same time, Western blot was used to detect the changes in the protein levels of cardiomyocyte-specific genes, and it was found that the protein levels of MYH6 and TNNT2 were significantly increased in SAMD4A-overexpressing cardiomyocytes ( Figure 5 G). These results clearly indicate that overexpressing SAMD4A promotes the differentiation of human embryonic stem cells into cardiomyocytes and further promotes the maturation of cardiomyocytes.
[0111] Example 4
[0112] In this example, the SAMD4A target mRNA was screened and identified, and the specific steps are as follows:
[0113] (1) Using the RNAact website ( http: / / rnact.crg.eu / )Predict the potential target mRNAs of SAMD4A, perform pathway enrichment analysis on the obtained target mRNAs, and find that these targets are mainly involved in pathways related to stem cell differentiation and are related to heart development. Figure 6 A). Next, take the intersection of the differentially expressed genes (DEGs) in SAMD4A-KD-hESCs RNA sequencing and these target mRNAs, and analyze that FGF2 is a potential target of SAMD4A. Figure 6 B). It is known that FGF2 is a key factor in the PI3K / AKT / mTOR signaling axis and its expression gradually decreases in the hESCs-derived cardiomyocyte differentiation model constructed in Example 1. Figure 6 C).
[0114] (2) Verify the binding relationship between the two by RNA Binding Protein Immunoprecipitation (RIP).
[0115] 1) Lyse cells: The required cell density is at least 5×10 7 cells. Wash the cells twice with pre-cooled PBS, digest the cells with digestive enzymes, collect them into a 1.5 mL EP tube, centrifuge at 1500 rpm at 4 °C for 5 min, discard the supernatant, and collect the cell pellet. Resuspend the cells with pre-cooled RIP lysis buffer of the same volume as the cells, pipette evenly, let stand on ice for 5 min, aliquot 200 μL of cell lysate into each tube, and store at -80 °C.
[0116] 2) Prepare RIP lysis buffer: Add 0.5 μL of protease inhibitor mixture and 0.25 μL of ribonuclease inhibitor to every 100 μL of RIP lysis buffer, and place on ice for use.
[0117] 3) Prepare magnetic bead-antibody: Resuspend the magnetic beads, pipette 50 μL into a 1.5 mL EP tube, after resuspension, add 500 μL of RIP Wash Buffer to each tube, vortex, place on a magnetic stand, discard the supernatant, repeat once, and resuspend the magnetic beads with 100 μL of RIP Wash Buffer. Add about 5 μg of the target antibody to the centrifuge tube. Incubate at room temperature for 30 min, place the EP tube on the magnetic stand, discard the supernatant, add 500 μL of RIP Wash Buffer, vortex and discard the supernatant, repeat once, add 500 μL of RIP Wash Buffer, vortex and place on ice.
[0118] 4) RNA Binding Protein Immunoprecipitation: Prepare RIP Immunoprecipitation Buffer. Place the EP tubes from the previous step on a magnetic stand, discard the supernatant, add 900 μL of RIP Immunoprecipitation Buffer to each tube, quickly thaw the cell lysate prepared in the first step, and centrifuge. Pipette 100 μL of the supernatant into the magnetic bead-antibody complex from the previous step to make the total volume 1 mL, and incubate at 4 °C for 3 h to overnight. Briefly centrifuge, place the EP tube on the magnetic stand, and discard the supernatant. Add 500 μL of RIP Wash Buffer, vortex, place the EP tube on the magnetic stand, discard the supernatant, and repeat the washing 6 times.
[0119] 5) RNA Purification: Resuspend the above magnetic bead-antibody complex with 150 μL of Proteinase K Buffer and incubate in a metal bath at 55 °C for 30 min. Place the EP tube on the magnetic stand and transfer the supernatant to a new 1.5 mL EP tube. Add 250 μL of RIP Wash Buffer to the supernatant of each tube, and at the same time add 400 μL of phenol:chloroform:isoamyl alcohol (125:24:1 pH = 4.3) to each tube, vortex, and centrifuge at 14000 rpm for 10 min at room temperature. Carefully pipette 350 μL of the upper aqueous phase and transfer it to a new EP tube. Add 50 μL of Salt SolutionⅠ, 15 μL of Salt SolutionⅡ, 5 μL of Precipitate Enhancer, and 850 μL of anhydrous ethanol (RNase-free) to each tube, mix well, store at -80 °C for 1 h to overnight, centrifuge at 14000 rpm at 4 °C for 30 min, and carefully remove the supernatant. Rinse once with 80% ethanol, centrifuge at 14000 rpm at 4 °C for 15 min, carefully remove the supernatant, and dry in air. Dissolve with 10 - 20 μL of DEPC water and store at -80 °C.
[0120] 6) Analyze the RNA obtained by immunoprecipitation subsequently, synthesize cDNA and perform real-time fluorescence quantitative PCR analysis to verify the binding relationship between the RNA and the target RNA-binding protein, or further perform high-throughput sequencing to obtain other targets bound to the RNA-binding protein.
[0121] Collect hESCs and lyse the cells. Incubate the cell lysate (protein-RNA mixture) with the prepared magnetic bead-SAMD4A antibody complex, purify the RNA, and identify the enrichment degree using real-time fluorescence quantitative PCR (RIP-qPCR).
[0122] As Figure 6 D shows that compared with the IgG group, the enrichment degree (fold enrichment) of SAMD4A is as high as about 40 times, confirming that SAMD4A directly binds to FGF2.
[0123] (3) The dual-luciferase reporter gene system was used to verify the binding of SAMD4A to the binding sites of FGF2 mRNA. The specific steps were as follows:
[0124] Construct a dual-luciferase reporter gene plasmid for the FGF2 binding site. SAMD4A binds to target mRNAs, and the binding sequence preference is CNGG / CNGGN. Four binding sites were found on FGF2 mRNA, and these sites were inserted downstream of the 3'UTR of the luciferase site, and the FGF2-Binding site reporter gene plasmids were constructed respectively. The vector used was: pDuo-Luciferase-Reporter. Primers were designed, and the primer sequences are shown in Table 6:
[0125] Table 6 Primer sequences of FGF2 mRNA binding sites
[0126]
[0127] Plasmids were constructed by homologous recombination or ligation according to the fragment size. The transformation and plasmid extraction steps were the same as those in Example 2, as Figure 7 shown in A, 7B.
[0128] The plasmids for knocking down and overexpressing SAMD4A were co-transfected with the pDuo dual-luciferase reporter gene plasmid into HEK293T cells ( Figure 7 C and Figure 7 D). The results of fluorescence activity detection showed that for the two binding sites BS137-145 and BS260-270, compared with the control group and the empty vector group, the fluorescence intensity was significantly reduced in the SAMD4A knockdown group ( Figure 7 E); on the contrary, in the SAMD4A overexpression group, the fluorescence activity of these two binding sites increased significantly ( Figure 7 F). The above results suggest that SAMD4A binds to FGF2 mRNA through these two binding sites BS137-145 and BS260-270.
[0129] Example 5
[0130] In this example, the effects of SAMD4A on the stability of FGF2 mRNA and the protein translation process of FGF2 were detected as follows:
[0131] (1) Detect the effect of SAMD4A on the stability of FGF2 mRNA.
[0132] Actinomycin D was used to treat SAMD4A-OE-hESCs and their control group cells respectively to inhibit mRNA synthesis. 7×10 were seeded in a 6-well plate coated with Matrigel5 Cells were inoculated, and when the cell density reached 90% 1 - 2 days after inoculation, 1 μmol / L Actinomycin D was added. Cell RNA samples were collected every 0.5 h for a total of 4 times over 2 h, and the mRNA expression was detected by qRT - PCR. Figure 7 G showed that overexpression of SAMD4A inhibited the degradation of FGF2 mRNA, and SAMD4A had the effect of stabilizing FGF2 mRNA.
[0133] (2) Detect the effect of SAMD4A on the protein translation process of FGF2
[0134] Detection by Western blot confirmed that SAMD4A promoted the protein translation process of FGF2 ( Figure 7 H and Figure 7 I).
[0135] The above research found that SAMD4A regulates the mRNA stability and translation of FGF2 by binding to its mRNA.
[0136] Example 6
[0137] In this example, the study on how SAMD4A regulates cardiomyocyte lineage differentiation was carried out as follows:
[0138] By detecting the changes in the protein levels of the AKT signaling pathway in SAMD4A - overexpressing stem cells and control group cells containing DMSO and FGF2 inhibitor respectively, it was found that after applying the FGF2 inhibitor SU5402 to SAMD4A - CTR - hESCs, the protein phosphorylation level of AKT was significantly down - regulated compared with the control group (i.e., SAMD4A - OE - hESCs with DMSO added) ( Figure 8 ). Therefore, SAMD4A mainly mediates the regulation of cardiomyocyte lineage differentiation by binding to FGF2 mRNA and mediating the signaling pathway.
[0139] In summary, through extensive and in-depth research, the present invention has for the first time discovered that the RNA-binding protein SAMD4A is upregulated during the differentiation of human embryonic stem cells into cardiomyocytes and is highly expressed in the induced cardiomyocytes. Knockdown of SAMD4A in human embryonic stem cells inhibits the differentiation of human embryonic stem cells into cardiomyocytes. On the contrary, overexpression of SAMD4A promotes cardiomyocyte differentiation, indicating that SAMD4A is essential for cardiomyocyte lineage differentiation. Subsequently, this example found that SAMD4A regulates the AKT signal transduction mediated by FGF2. It was confirmed by RIP experiments that SAMD4A binds to FGF2 mRNA to play a regulatory role. As an RNA-binding protein, SAMD4A affects the stability of FGF2 mRNA and protein translation by specifically binding to the binding site containing the CNGG / CNGGN motif. At the same time, the application of an FGFR2 inhibitor can weaken the activation effect of SAMD4A overexpression on the AKT signaling pathway. Therefore, the present invention has confirmed that the RNA-binding protein SAMD4A gene plays a key role in inducing the differentiation of stem cells into cardiomyocytes and is an effective approach for the future treatment of congenital heart diseases.
[0140] The above description of the embodiments is to enable those of ordinary skill in the art to understand and use the invention. It is obvious that those skilled in the art can easily make various modifications to these embodiments and apply the general principles described herein to other embodiments without creative efforts. Therefore, the present invention is not limited to the above embodiments, and all improvements and modifications made by those skilled in the art without departing from the scope of the present invention according to the disclosure of the present invention should be within the protection scope of the present invention.
Claims
1. Use of an RNA-binding protein SAMD4A or its coding gene, or a biological material containing its coding gene in the differentiation of stem cells into cardiomyocytes.
2. The application according to claim 1, characterized in that, The RNA-binding protein SAMD4A or its coding gene, or the biological material containing its coding gene up-regulates cardiomyocyte differentiation by increasing the expression levels of the MYH6, MYH7, and TNNT2 genes.
3. The application according to claim 1, wherein The RNA-binding protein SAMD4A or its coding gene, or the biological material containing its coding gene reduces the efficiency of cardiomyocyte differentiation by decreasing the expression levels of the mesoderm stage marker genes MESP1 and PDGFR in the myocardium.
4. The application according to claim 1, characterized in that, The RNA-binding protein SAMD4A or its coding gene, or the biological material containing its coding gene reduces the efficiency of cardiomyocyte differentiation by decreasing the expression level of the key cardiomyocyte transcription factor NKX2-5 at the cardiomyocyte progenitor stage.
5. The application according to claim 1, characterized in that The RNA-binding protein SAMD4A or its coding gene, or the biological material containing its coding gene reduces the efficiency of cardiomyocyte differentiation by decreasing the expression levels of the cardiomyocyte-specific marker genes MYH7 and ACTN2.
6. The application according to claim 1, wherein The RNA-binding protein SAMD4A or its coding gene, or the biological material containing its coding gene reduces the efficiency of cardiomyocyte differentiation by decreasing the expression level of the cardiomyocyte-specific protein MYH6.
7. The application according to claim 1, characterized in that The RNA-binding protein SAMD4A or its coding gene, or the biological material containing its coding gene affects cardiomyocyte lineage differentiation through the FGF2-mediated signaling pathway.
8. The application according to claim 7, wherein The RNA-binding protein SAMD4A or its coding gene, or the biological material containing its coding gene binds to the FGF2 mRNA through the binding sites BS137-145 and BS260-270, thereby affecting cardiomyocyte lineage differentiation.
9. A vector for SAMD4A knockdown and overexpression plasmid, characterized in that, The vector is a lentiviral vector containing SAMD4A.
10. A cell model for SAMD4A knockdown and overexpression, characterized in that, The cell model contains the lentiviral vector containing SAMD4A as described in claim 9.