Method for improving soluble expression of terminal deoxynucleotidyl transferase

By removing the BRCT domain and performing amino acid replacement, the soluble and activity problems of terminal deoxynucleotide transferase in E. coli expression are solved, and rapid expression and low-cost production are achieved at high temperature, which is suitable for industrial production.

CN120249240APending Publication Date: 2025-07-04EAST CHINA UNIV OF SCI & TECH
View PDF 0 Cites 1 Cited by

Patent Information

Application Number
CN202410007007.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-01-03
Publication Date
2025-07-04

AI Technical Summary

Technical Problem

The prior art is difficult to obtain high levels of soluble and active terminal deoxynucleotide transferase in the E. coli expression system, and low temperature induction leads to high production costs, which is not conducive to industrial production.

Method used

By removing the BRCT domain of terminal deoxynucleotide transferase and hydrophilic amino acid replacement on the protein surface, mutants can be obtained, which can be expressed quickly under high temperature conditions, avoiding the additional addition of pro-soluble protein tags and tag cleavage steps.

Benefits of technology

The soluble expression level and protein yield are significantly improved in the E. coli expression system, downstream processing steps are simplified, production costs are reduced, and it is suitable for industrial applications.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120249240A_ABST
    Figure CN120249240A_ABST
Patent Text Reader

Abstract

The invention discloses a method for improving the soluble expression of terminal deoxynucleotidyl transferase (TdT), and relates to the technical field of protein engineering and gene engineering, in particular to a method for improving the soluble expression of the TdT. TdT (TdT-B) with the BRCT structural domain removed serves as initial enzyme, hydrophilic amino acid replacement is conducted on hydrophobic amino acid on the surface of the TdT-B enzyme, and a TdT mutant is obtained. The mutant does not need any fusion tag and can be rapidly expressed under induction conditions of high temperatures such as 30 DEG C and 37 DEG C, the soluble protein expression level is remarkably improved, a large amount of soluble TdT is obtained in a short time, the soluble expression level of the TdT is remarkably improved, the fusion tag cutting step is not needed in subsequent downstream treatment, and the preparation method is simple and low in cost.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical fields of protein engineering and genetic engineering, and particularly relates to a method for designing and modifying terminal deoxynucleotidyl transferase to improve its soluble expression. Background Art

[0002] TdT belongs to the X family of DNA polymerases and is usually expressed in thymocytes (immature T cells) and bone marrow precursor B cells. During the gene rearrangement of V(D)J recombination, TdT is responsible for randomly adding a small number of nucleotides to the V-D-J or V-J junctions of immunoglobulins and T cell receptors. TdT is a template-independent single-stranded DNA polymerase. During the polymerization process, it does not require denaturation, renaturation, and extension reactions. Under the condition of metal ion assistance, it can use an oligonucleotide as a primer and randomly extend thousands of dNTPs at the 3'-OH end of the primer to generate a nucleic acid polymer. This template-independent property of TdT makes it have good application prospects in DNA de novo synthesis, DNA data storage, biological detection, etc.

[0003] TdT was first purified from calf thymus, and its molecular weight is approximately 60 kDa. However, it is extremely difficult to obtain relatively pure, complete, and highly active TdT from thymus. Chang et al. tried to express human TdT in a bacterial system but could not obtain soluble active protein (《EXPRESSION AND PROCESSING OF RECOMBINANT HUMAN TERMINAL TRANSFERASE IN THE BACULOVIRUS SYSTEM》). Until 1998, Boule et al. successfully obtained a relatively high level of murine TdT by using low-temperature induction in Escherichia coli overexpressing the argU gene (《High-level expression of murine terminal deoxynucleotidyl transferase in Escherichia coli grown at low temperature and overexpressing argU tRNA》). Palluk et al. reported a method for improving the soluble expression level of TdT in the Escherichia coli system by MBP fusion (《De novo DNA synthesis using polymerase-nucleotide conjugates》). Although the MBP fusion expression promoted the soluble expression of TdT in Escherichia coli, the complex purification, digestion, and re-purification steps brought a lot of inconvenience to the downstream process development.

[0004] The ZaTdT reported by Lu et al. is currently the enzyme with the highest polymerization activity among the reported terminal deoxynucleotidyltransferases (《Enzymatic DNA Synthesis by Engineering Terminal DeoxynucleotidylTransferase》). ZaTdT consists of 513 amino acids, including 232 hydrophobic amino acids, showing strong hydrophobicity. In order to obtain active ZaTdT in the Escherichia coli expression system, Lu et al. adopted the method of inducing at a low temperature of 16 °C. However, there was still a large amount of insoluble expression during the induction at 16 °C. In addition, the induction at 16 °C significantly increased the production cost, which was not conducive to industrial production. Summary of the Invention

[0005] The present invention provides a method for improving the soluble expression of terminal deoxynucleotidyltransferase to solve the problems existing in the above-mentioned prior art. The present invention does not require the additional addition of any solubility-enhancing protein tags and molecular chaperones, and can rapidly express at higher temperature induction conditions such as 30 and 37 °C, obtaining a large amount of soluble TdT in a short time. The subsequent downstream processing does not require a fusion tag cleavage step. The engineering bacteria culture process is simple, the protein expression cycle is short, the downstream purification steps are simple, the cost is low, and the activity of the prepared TdT mutant remains good.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] A method for improving the soluble expression of terminal deoxynucleotidyltransferase, wherein the TdT mutant is obtained by replacing hydrophobic amino acids on the surface of the protease with hydrophilic amino acids, and includes the following steps:

[0008] S1: Remove the BRCT domain of the TdT protease to obtain TdT-B;

[0009] S2: Without changing the main spatial structure, replace the amino acids with a protein surface aggregation trend score greater than 0.1 on linear and loop 2 of TdT-B with hydrophilic amino acids to obtain the mutant L+L;

[0010] S3: Without changing the main spatial structure, replace the amino acids with a protein surface aggregation trend score greater than 0.2 on L+L with hydrophilic amino acids to obtain the mutant L+L 0.2;

[0011] S4: Without changing the main spatial structure, replace the amino acids with a protein surface aggregation trend score greater than 0.1 on L+L 0.2 with hydrophilic amino acids to obtain the mutant L+L 0.1;

[0012] S5: Insert the gene sequence of the TdT mutant into an expression vector without adding any solubilizing protein genes upstream or downstream of the gene sequence of the TdT mutant to obtain a TdT mutant cloning vector.

[0013] S6: Introduce the TdT mutant cloning vector obtained in step S4 into Escherichia coli, and screen for Escherichia coli with positive cloning vectors by streak plate culture on a solid medium.

[0014] Optional technical solutions are as follows:

[0015] The initial enzyme of the mutant is terminal deoxynucleotidyl transferase (ZaTdT) derived from Zonotrichia albicollis, and the amino acid sequence of ZaTdT is shown in SEQ ID NO.1.

[0016] Further, the mutant is obtained by mutating on the basis of removing the BRCT domain (ZaTdT-B) of ZaTdT, and the amino acid sequence of ZaTdT-B is shown in SEQ ID NO.2.

[0017] Further, mutant L+L is obtained by replacing amino acids with a protein surface aggregation trend score greater than 0.1 on linear and loop 2 of ZaTdT-B (see attachment Figure 1 ) with hydrophilic amino acids without changing the main spatial structure of ZaTdT-B, and the amino acid sequence of L+L is shown in SEQ ID NO.3.

[0018] Further, mutant L+L 0.2 is obtained by replacing amino acids with a protein surface aggregation trend score greater than 0.2 on L+L with hydrophilic amino acids without changing the main spatial structure of ZaTdT-B, and the amino acid sequence of L+L 0.2 is shown in SEQ ID NO.4.

[0019] Further, mutant L+L 0.1 is obtained by replacing amino acids with a protein surface aggregation trend score greater than 0.1 on L+L with hydrophilic amino acids without changing the main spatial structure of ZaTdT-B, and the amino acid sequence of L+L 0.1 is shown in SEQ ID NO.5.

[0020] The present invention also provides a method for replacing hydrophobic amino acids with hydrophilic amino acids, and the principles are as follows: the charge situation of the amino acid R group is preferably kept consistent, the size of the amino acid R group is as close as possible, and whether it is easy to form an α helix. For example, leucine can be replaced with asparagine, glutamine or lysine, etc.

[0021] The present invention discloses the following technical effects:

[0022] By replacing the hydrophobic amino acids on the surface of TdT protease with hydrophilic amino acids, the present invention obtained TdT mutants L+L, L+L 0.2, and L+L 0.1. In the Escherichia coli expression system, the soluble expression levels of all three mutants were significantly improved. Among them, mutant L+L 0.2 showed excellent soluble expression levels under induction conditions from 16°C to 37°C. This mutant can significantly increase the yield and purity of TdT produced by Escherichia coli fermentation, and has important industrial application value. Brief Description of the Drawings

[0023] Figure 1 It is a structural model diagram of ZaTdT and its mutants in Example 1 of the present invention;

[0024] Figure 2 It is a plasmid map of the expression vector of ZaTdT and its mutants in Example 1 of the present invention;

[0025] Figure 3 It is an SDS-PAGE electrophoresis identification diagram of the soluble expression of ZaTdT and its mutants induced at 16°C for 18 h in Example 2 of the present invention;

[0026] Figure 4 It is a growth curve of ZaTdT and mutant L+L 0.2 under induction at different temperatures in Example 6 of the present invention;

[0027] Figure 5 It is the soluble protein yield of ZaTdT and mutant L+L 0.2 in Example 6 of the present invention;

[0028] Figure 6 It is an SDS-PAGE electrophoresis identification diagram of the protein purification of ZaTdT and mutant L+L 0.2 in Example 7 of the present invention;

[0029] Figure 7 It is the enzyme activity measurement result of ZaTdT and mutant L+L 0.2 in Example 7 of the present invention. Detailed Embodiments

[0030] Now, various exemplary embodiments of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0031] It should be understood that the terms used in this invention are only for describing specific embodiments and are not intended to limit the invention. Additionally, for the numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0032] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which this invention pertains. Although this invention only describes alternative methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of this invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0033] Without departing from the scope or spirit of this invention, various improvements and changes can be made to the specific embodiments of this invention's specification, which are obvious to those skilled in the art. Other embodiments obtained from this invention's specification are also obvious to those skilled in the art. This invention's specification and examples are merely exemplary.

[0034] Regarding the use of "comprising", "including", "having", "containing", etc. in this article, they are all open-ended terms, meaning including but not limited to.

[0035] In the following examples, unless otherwise specified, the technical means used in the examples are conventional means well-known to those skilled in the art and commercially available common instruments and reagents. Reference can be made to "Molecular Cloning: A Laboratory Manual (3rd Edition)" (Science Press), "Microbiology Experiments (4th Edition)" (Higher Education Press), and the manufacturer's instructions of the corresponding instruments and reagents, etc.

[0036] The strains and vectors used in this invention can be purchased from commercial and publicly available culture collection institutions of strains and plasmids.

[0037] Example 1 Construction of Mutant Strains

[0038] The amino acid sequence of ZaTdT was subjected to gene sequence conversion and codon optimization for E. coli host preference. After synthesis by the company, the ZaTdT gene sequence was inserted between the BamHⅠ and XhoⅠ restriction enzyme cleavage sites of the pET-28a plasmid vector to obtain the recombinant plasmid ZaTdT-pET-28a. The plasmid was transferred into BL21(DE3) competent cells to obtain the expression strain ZaTdT containing the ZaTdT-pET-28a recombinant plasmid.

[0039] Using ZaTdT-pET-28a as a template, upstream primer H1 and downstream primer H2 were designed. The restriction endonuclease BamHⅠ site was introduced into the upstream primer, and the restriction endonuclease XhoⅠ site was introduced into the downstream primer. The ZaTdT-B gene sequence was obtained by PCR amplification using Novoprotein PhantaFlash high-fidelity DNA polymerase. After the PCR reaction, the PCR product was detected by gel electrophoresis, and the band with the correct size was cut out and recovered for purification and standby.

[0040] H1: CGGGATCCTCCCTGCCGCTGAACATG

[0041] H2: CCCTCGAGTTATGCATTACGTTCCCACGGCTC

[0042] The pET-28a plasmid and the amplified ZaTdT-B fragment were double-digested with BamHⅠ and XhoⅠ restriction endonucleases, and the digested gene fragments were recovered using a gel recovery kit. The digested pET-28a plasmid and the ZaTdT-B fragment were ligated with T4 ligase, transformed into DH5α competent cells, and positive transformants were screened after subculture. After plasmid extraction and sequencing verification, the recombinant plasmid ZaTdT-B-pET-28a was obtained. The plasmid was transferred into BL21(DE3) competent cells to obtain the expression strain ZaTdT-B containing the ZaTdT-B-pET-28a recombinant plasmid.

[0043] Based on ZaTdT-B, several amino acids in the primary structure amino acid sequence of ZaTdT-B were replaced without changing the main spatial structure of ZaTdT-B to obtain ZaTdT mutants. There are 3 ZaTdT mutants in this example, namely L+L, L+L 0.2, and L+L 0.1. The amino acid sequence of L+L is shown in SEQ ID NO.3, the amino acid sequence of L+L 0.2 is shown in SEQ ID NO.4, and the amino acid sequence of L+L 0.1 is shown in SEQ ID NO.5. The structural model of the ZaTdT mutant is shown in Figure 1 。

[0044] The amino acid sequences of ZaTdT mutants L+L, L+L 0.2, and L+L 0.1 were subjected to gene sequence conversion and codon optimization for Escherichia coli host preference. After synthesis by the company, the gene sequences of the three mutants were respectively inserted between the BamHⅠ and XhoⅠ restriction sites of the pET-28a plasmid vector to obtain recombinant plasmids L+L-pET-28a, L+L0.2-pET-28a, and L+L 0.1-pET-28a. The plasmids containing the ZaTdT mutants were respectively transformed into BL21(DE3) competent cells to obtain the expression strains L+L, L+L 0.2, and L+L 0.1 containing the recombinant plasmids with the mutants. The plasmid maps of ZaTdT and its mutant expression vectors are shown in Figure 2 .

[0045] Example 2 Induced expression of ZaTdT and its mutants at 16°C

[0046] The preserved bacterial solutions of the ZaTdT and its mutant expression strains were respectively inoculated into 5 mL of LB medium containing kanamycin and activated overnight (12 h) at 37°C and 220 rpm. The activated bacterial solutions were inoculated into 50 mL of TB medium containing 50 μg / mL kanamycin at a ratio of 1% (V / V) and cultured at 37°C and 250 rpm for about 2 h until the OD 600 nm reached approximately 0.6. Then, the culture temperature was reduced to 16°C to induce the expression of the recombinant genes on the plasmid. After 18 h of induction, the culture was terminated. The cells were harvested by centrifugation, sonicated, and centrifuged to obtain the broken supernatant and precipitate, which were subjected to SDS-PAGE detection. See attached Figure 3 . In the figure, bands 2 and 3, bands 4 and 5, bands 6 and 7, and bands 8 and 9 represent the bands in the broken supernatants and precipitates of ZaTdT, L+L, L+L 0.2, and L+L 0.1, respectively. The proportions of the target proteins in the bacterial broken supernatants and precipitates are shown in Table 1. The results show that the soluble expression levels of the mutants L+L, L+L 0.2, and L+L0.1 have been significantly improved.

[0047] Table 1 Proportions of ZaTdT and its mutant proteins in the broken supernatants and precipitates after 18 h of induction at 16°C

[0048] Protein Supernatant of disruption (%) Precipitate of disruption (%) ZaTdT 59.3 40.7 L+L 92.6 7.4 L+L0.2 96.4 3.6 L+L0.1 96.6 3.4

[0049] Example 3 Induced expression of ZaTdT and its mutants at 23°C

[0050] The preservation solutions of the recombinant engineering bacteria of ZaTdT and its mutants were respectively inoculated into 5 mL of LB medium containing kanamycin and activated overnight (12 h) at 37 °C and 220 rpm. The activated bacterial solutions were inoculated into 50 mL of TB medium containing 50 μg / mL kanamycin at a ratio of 1% (V / V), and cultured at 37 °C and 250 rpm for about 2 h until the OD 600 nm reached about 0.6. Then, the culture temperature was reduced to 23 °C to induce the expression of the recombinant gene on the plasmid. After 12 h of induction, the culture was terminated. The cells were harvested by centrifugation, sonicated, and centrifuged to obtain the cell-free supernatant and precipitate, which were detected by SDS-PAGE. The ratios of the target protein in the cell-free supernatant and precipitate of the bacteria are shown in Table 2. The results showed that with the increase of the induction temperature to 23 °C, the soluble expression level of wild-type ZaTdT decreased significantly, while the soluble expression level of the mutant decreased slightly, but still showed a high soluble expression level.

[0051] Table 2 Ratios of ZaTdT and its mutant proteins in the cell-free supernatant and precipitate after 12 h of induction at 23 °C

[0052]

[0053]

[0054] Example 4 Induced expression of ZaTdT and its mutants at 30 °C

[0055] The preservation solutions of the recombinant engineering bacteria of ZaTdT and its mutants were respectively inoculated into 5 mL of LB medium containing kanamycin and activated overnight (12 h) at 37 °C and 220 rpm. The activated bacterial solutions were inoculated into 50 mL of TB medium containing 50 μg / mL kanamycin at a ratio of 1% (V / V), and cultured at 37 °C and 250 rpm for about 2 h until the OD 600 nm reached about 0.6. Then, the culture temperature was reduced to 30 °C to induce the expression of the recombinant gene on the plasmid. After 10 h of induction, the culture was terminated. The cells were harvested by centrifugation, sonicated, and centrifuged to obtain the cell-free supernatant and precipitate, which were detected by SDS-PAGE. The ratios of the target protein in the cell-free supernatant and precipitate of the bacteria are shown in Table 3. The results showed that with the increase of the induction temperature to 30 °C, wild-type ZaTdT was almost all expressed in an insoluble form, the soluble expression level of mutant L+L decreased significantly, and mutants L+L 0.2 and L+L 0.1 still maintained a high soluble expression level.

[0056] Table 3 Ratios of ZaTdT and its mutant proteins in the cell-free supernatant and precipitate after 10 h of induction at 30 °C

[0057] Protein Supernatant of disruption (%) Precipitate of disruption (%) ZaTdT 1.2 98.8 L+L 69.6 30.4 L+L0.2 96.1 3.9 L+L0.1 95.9 4.1

[0058] Example 5 Induced Expression of ZaTdT and Its Mutants at 37°C

[0059] The glycerol stocks of the recombinant engineering bacteria expressing ZaTdT and its mutants were respectively inoculated into 5 mL of LB medium containing kanamycin, and activated overnight (12 h) at 37°C and 220 rpm. The activated bacterial solutions were inoculated into 50 mL of TB medium containing 50 μg / mL kanamycin at a ratio of 1% (V / V), and cultured at 37°C and 250 rpm for about 2 h until the OD 600 nm reached approximately 0.6, then the recombinant genes on the induction plasmid were induced to express. After 10 h of induction, the culture was terminated, the cells were harvested by centrifugation, sonicated, and centrifuged to obtain the cell-free supernatant and precipitate, which were detected by SDS-PAGE. The ratios of the target proteins in the cell-free supernatant and precipitate of the bacteria are shown in Table 4. The results showed that with the induction temperature increased to 37°C, the wild-type ZaTdT was expressed in an insoluble form, the soluble expression level of the mutant L+L continued to decline, the soluble expression level of the mutant L+L 0.1 decreased significantly, while L+L 0.2 still maintained a high soluble expression level.

[0060] Table 4 Ratios of ZaTdT and Its Mutant Proteins in the Cell-Free Supernatant and Precipitate after 10 h of Induction at 37°C

[0061]

[0062]

[0063] Example 6 Protein Expression Yields of ZaTdT and Its Mutant L+L 0.2

[0064] The glycerol stocks of the recombinant engineering bacteria expressing ZaTdT and its mutant L+L 0.2 were respectively inoculated into 5 mL of LB medium containing kanamycin, and activated overnight (12 h) at 37°C and 220 rpm. The activated bacterial solutions were inoculated into 50 mL of TB medium containing 50 μg / mL kanamycin at a ratio of 1% (V / V), and cultured at 37°C and 250 rpm for about 2 h until the OD 600 nm reached approximately 0.6. Then, ZaTdT was induced at 16°C for 18 h and the culture was terminated, while the mutant L+L 0.2 was induced at 30 and 37°C for 10 h and the culture was terminated. The growth curves of ZaTdT and its mutant L+L 0.2 are shown in Appendix Figure 4 , and the yields of soluble proteins are shown in Appendix Figure 5 . The results showed that compared with the wild-type ZaTdT, the yield of soluble protein of the mutant L+L 0.2 was significantly increased, and the induction period was shortened.

[0065] Example 7 Enzyme Activity Assay of ZaTdT and Its Mutant L+L 0.2

[0066] Collect the ZaTdT and its mutant L+L 0.2 bacteria obtained in Example 6, ultrasonically disrupt them, and purify the target protein in the disrupted supernatant using a Ni-NTA 6FF pre-packed gravity column (Sangon Biotech, Shanghai). Identify the purification result by SDS-PAGE. The results are shown in the appendix Figure 6 , where Figure 6 in 1: Protein molecular weight Marker; 2: Supernatant of ZaTdT lysate; 3: Purified sample of ZaTdT; 4: Supernatant of L+L 0.2 lysate; 5: Purified sample of L+L 0.2. Perform enzyme activity assays on the purified ZaTdT and its mutant L+L0.2. The reaction system for enzyme activity assays is shown in Table 5. After reacting at 37°C for 1 min, immediately inactivate at 90°C for 5 min, and detect the activity results by 8% urea-PAGE. The enzyme activity assay results are shown in the appendix Figure 7 , where Figure 7 in 1: DNA molecular weight Marker; 2: Reaction solution without added enzyme; 3: Results of ZaTdT activity assay; 4: Results of L+L 0.2 activity assay. The results show that the polymerization activity of the mutant L+L 0.2 has been significantly improved compared to the wild-type ZaTdT.

[0067] Table 5 Reaction system for enzyme activity assay

[0068]

[0069] *10×Buffer: 20 mM Tris, 10 mM MgCl2, 50 mM C2H3KO2, PH 7.2

[0070] SEQ ID NO.1:

[0071] MDRFKAPAVISQRKRQKGLHSPKLSCSYEIKFSNFVIFIMQRKMGLTRRMFLMELGRRKGFRVESELSDSVTHIVAENNSYLEVLDWLKGQAVGDSSRFELLDISWFTACMEAGRPVDSEVKYRLMEQSQSLPLNMPALEMPAFIATKVSQYSCQRKTTLNNYNKKFTDAFEVMAENYEFKENEIFCLEFLRAASLLKSLPFSVTRMKDIQGLPCVGDQVRDIIEEIIEEGESSRVNEVLNDERYKAFKQFTSVFGVGVKTSEKWYRMGLRTVEEVKADKTLKLSKMQKAGLLYYEDLVSCVSKAEADAVSLIVKNTVCTFLPDALVTITGGFRRGKNIGHDIDFLITNPGPREDDELLHKVIDLWKKQGLLLYCDIIESTFVKEQLPSRKVDAMDHFQKCFAILKLYQPRVDNSTCNTSEQLEMAEVKDWKAIRVDLVITPFEQYPYALLGWTGSRQFGRDLRRYAAHERKMILDNHGLYDRRKRIFLKAGSEEEIFAHLGLDYVEPWERNA*

[0072] SEQ ID NO.2:

[0073] SLPLNMPALEMPAFIATKVSQYSCQRKTTLNNYNKKFTDAFEVMAENYEFKENEIFCLEFLRAASLLKSLPFSVTRMKDIQGLPCVGDQVRDIIEEIIEEGESSRVNEVLNDERYKAFKQFTSVFGVGVKTSEKWYRMGLRTVEEVKADKTLKLSKMQKAGLLYYEDLVSCVSKAEADAVSLIVKNTVCTFLPDALVTITGGFRRGKNIGHDIDFLITNPGPREDDELLHKVIDLWKKQGLLLYCDIIESTFVKEQLPSRKVDAMDHFQKCFAILKLYQPRVDNSTCNTSEQLEMAEVKDWKAIRVDLVITPFEQYPYALLGWTGSRQFGRDLRRYAAHERKMILDNHGLYDRRKRIFLKAGSEEEIFAHLGLDYVEPWERNA*

[0074] SEQ ID NO.3:

[0075] SQNQNQNNQEQNNYNATKVSQYSCQRKTTLNNYNKKFTDAFEVMAENYEFKENEIFCLEFLRAASLLKSLPFSVTRMKDIQGLPCVGDQVRDIIEEIIEEGESSRVNEVLNDERYKAFKQFTSVFGVGVKTSEKWYRMGLRTVEEVKADKTLKLSKMQKAGLLYYEDLVSCVSKAEADAVSLIVKNTVCTFLPDALVTITGGFRRGKNIGHDIDFLITNPGPREDDELLHKVIDLWKKQGLLLYCDIIESTFVKEQLPSRKVDAMDHFQKCFAILKLYQNRNDNSTCNTSEQQEQNENKDWKAIRVDLVITPFEQYPYALLGWTGSRQFGRDLRRYAAHERKMILDNHGLYDRRKRIFLKAGSEEEIFAHLGLDYVEPWERNA*

[0076] SEQ ID NO.4:

[0077] SQNQNQNNQEQNNYNATKVSQYSCQRKTTLNNYNKKFTDAFEVMAENYEFKENENFCLEFLRAASLLKSLNFSVTRMKDIQGLPCVGDQVRDIIEEIIEEGESSRVNEVLNDERYKAFKQFTSVFGVGVKTSEKWYRMGLRTVEEVKADKTLKLSKMQKAGLLYYEDLVSCVSKAEADAVSQIVKNTVCTFLPDAQVTITGGFRRGKNNGHDIDFLITNPGPREDDELLHKVIDLWKKQGLLLYCDIIESTFNKEQLPSRKNDAMDHFQKCFAILKLYQNRNDNSTCNTSEQQEQNENKDWKAIRVDLVITPFEQYPYALLGWTGSRQFGRDLRRYAAHERKMILDNHGLYDRRKRNYLKAGSEEEIFAHLGLDYVEPWERNA*

[0078] SEQ ID NO.5:

[0079] SQNQNQNNQEQNNYNATKVSQYSCQRKTTQNNYNKKFTDAFEVMAENYEFKENENYCLEFLRAASLLKSLNYSVTRMKDIQGLPCVGDQVRDIIEEIIEEGESSRVNEVQNDERYKAFKQFTSVFGVGVKTSEKWYRMGLRTVEEVKADKTLKLSKMQKAGLQYYEDLNSCVSKAEADAVSQIVKNTVCTFQNDAQVTITGGFRRGKNNGHDIDFLITNNGNREDDELLHKVIDLWKKQGLLLYCDINESTFNKEQQPSRKNDAQDHFQKCFAILKLYQNRNDNSTCNTSEQQEQNENKDWKAIRVDLVITPYEQYPYALLGWTGSRQFGRDLRRYAAHERKQILDNHGLYDRRKRNYLKAGSEEEIFAHLGLDYVEPWERNA*

[0080] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A method for improving the soluble expression of terminal deoxynucleotidyl transferase, characterized in that, The mutant was obtained by replacing the hydrophobic amino acids on the surface of the protease with hydrophilic amino acids.

2. The mutant according to claim 1, wherein The mutant was mutated after removing the BRCT domain of TdT (TdT-B). The amino acid sequence of TdT is shown in SEQ ID NO.1, and the amino acid sequence of TdT-B is shown in SEQ ID NO.

2.

3. A method for improving the soluble expression of terminal deoxynucleotidyl transferase according to claim 1, characterized in that, It includes the following steps: S1: Without changing the main spatial structure, hydrophilic amino acids were used to replace the amino acids with a protein surface aggregation tendency score greater than 0.1 on linear and loop 2 of TdT-B to obtain the mutant L+L. The amino acid sequence of the mutant L+L is shown in SEQ ID NO.

3. S2: Without changing the main spatial structure, hydrophilic amino acids were used to replace the amino acids with a protein surface aggregation tendency score greater than 0.2 on L+L to obtain the mutant L+L 0.

2. The amino acid sequence of the mutant L+L 0.2 is shown in SEQ ID NO.

4. S3: Without changing the main spatial structure, hydrophilic amino acids were used to replace the amino acids with a protein surface aggregation tendency score greater than 0.1 on L+L 0.2 to obtain the mutant L+L 0.

1. The amino acid sequence of the mutant L+L 0.1 is shown in SEQ ID NO.

5. S4: The gene sequence of the TdT mutant was inserted into an expression vector, and no solubilizing protein gene was added upstream or downstream of the gene sequence of the TdT mutant to obtain the TdT mutant cloning vector. S5: The TdT mutant cloning vector obtained in step S4 was introduced into Escherichia coli, and Escherichia coli with a positive cloning vector was screened by streaking and culturing on a solid medium.

4. The replacement of the surface hydrophobic amino acids of the protease with hydrophilic amino acids according to claim 3, wherein The amino acid replacement principle is as follows: The charge situation of the amino acid R group is preferably kept consistent, the size of the amino acid R group is as similar as possible, and whether it is easy to form an α helix. For example, leucine can be replaced with asparagine, glutamine or lysine, etc.

5. The TdT mutant according to claim 3, wherein A 6×His tag was added to the N-terminus of the TdT mutant, and the TdT mutant can be separated and purified by a nickel column.

Citation Information

Cited By

  • Culture medium for fermenting terminal deoxynucleotidyl transferase and application of culture medium

    CN120699876A