Field effect transistor sensor based on CRISPR-Cas system and preparation method and application thereof
Coupling with field effect transistors through the CRISPR-Cas system, the transistor surface is modified by using Cas protein and guide RNA, solving the problem of long double-stranded DNA detection, achieving high sensitivity and accuracy nucleic acid detection, simplifying the detection process and reducing costs.
Patent Information
- Application Number
- CN202510388309.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-31
- Publication Date
- 2025-07-04
AI Technical Summary
The prior art cannot quickly and at low cost to detect nucleic acids with long molecular sizes and double-stranded helical structures, and conventional methods increase the economic cost and process complexity of the detection.
The CRISPR-Cas system is used to couple with field effect transistors, and the transistor surface is modified by using Cas protein and guide RNA, and high sensitivity detection is achieved by identifying and cleaving the target DNA fragments.
It realizes high sensitivity and accuracy detection of long double-stranded DNA, simplifies the detection process, reduces costs, and is suitable for the detection of single-stranded and double-stranded nucleic acids.
Smart Images

Figure CN120249249A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of biosensors, and particularly to a field-effect transistor sensor based on the CRISPR-Cas system, a preparation method thereof, and uses thereof. Background Art
[0002] Nucleic acid detection is of crucial significance for pathogen detection. It can provide direct and accurate pathogen identification, thus enabling early diagnosis and effective treatment. Using a field-effect transistor sensor for nucleic acid detection has advantages such as low cost, high sensitivity, high specificity, and real-time quantification. Its detection principle is to immobilize a specific nucleic acid sequence as a probe on the channel of the field-effect transistor. When the target nucleic acid undergoes complementary pairing with the probe, it will cause a change in the channel conductivity, thereby realizing the detection of nucleic acids. Although such a probe has the advantage of simple structure, it cannot be compatible with complex sample conditions. The nucleic acids in pathogen detection are usually genomic nucleic acids, which are characterized by long molecular sizes. The length of genomic DNA can usually reach millions of base pairs and presents a double-stranded helical structure. For conventional single-stranded probes, they cannot recognize double-stranded nucleic acids. Moreover, when detecting a longer target, the probability of the target being entangled and the probability of off-target after binding to the probe are also higher, greatly limiting its application in pathogen detection.
[0003] To solve this problem, researchers mainly use the PCR amplification technique to amplify the target sequence in the long-chain nucleic acid, and then use exonuclease to cleave the amplification product into single-stranded DNA for easy detection. However, this method not only increases the economic cost of detection in practical applications, but also makes the detection process more time-consuming and cumbersome.
[0004] Therefore, there is an urgent need to develop a method that is simple to operate, low in cost, and can perform highly sensitive detection on nucleic acids with long molecular sizes and a double-stranded helical structure. Summary of the Invention
[0005] In view of the above-mentioned disadvantages of the prior art, the purpose of the present invention is to provide a field-effect transistor sensor based on the CRISPR-Cas system, a preparation method thereof, and uses thereof, to solve the problem in the prior art that nucleic acids with long molecular sizes and a double-stranded helical structure cannot be rapidly detected, and to achieve highly sensitive and highly accurate detection of the target sequence in long double-stranded DNA.
[0006] In the first aspect of the present invention, a field effect transistor sensor based on the CRISPR-Cas system is provided. The field effect transistor sensor comprises a field effect transistor and a CRISPR-Cas system modified on its surface; the CRISPR-Cas system includes a Cas protein and a guide RNA, and the Cas protein is one or more selected from Cas9, Cas12a, Cas12b, and Cas12f; the guide RNA includes a scaffold sequence and a spacer sequence.
[0007] Preferably, the Cas protein is any one or more selected from SpCas9, AsCas12a, and AacCas12b.
[0008] In the present application, the scaffold sequence is a specific sequence for different Cas proteins, and the spacer sequence is designed according to the target DNA sequence. The spacer sequence needs to meet the following two points: the first sequence is complementary to the target DNA sequence, and there is and is adjacent to the PAM site on the complementary strand of the target DNA sequence; the second the PAM site is a DNA sequence with a length of 3-4 bases. For the Cas9 protein, the PAM site is downstream; for the Cas12 protein, the PAM site is upstream. For example, the PAM site recognized by SpCas9 is NGG, where N is any one of A, G, C, and T; the PAM site recognized by AsCas12a is TTTN, where N is any one of A, G, C, and T.
[0009] More preferably, the length of the spacer sequence is 18-40 bp; including but not limited to 18 bp, 19 bp, 20 bp, 21 bp, 22 bp, 23 bp, 24 bp, 25 bp, 26 bp, 27 bp, 28 bp, 29 bp, 30 bp, 31 bp, 32 bp, 33 bp, 34 bp, 35 bp, 36 bp, 37 bp, 38 bp, 39 bp, or 40 bp.
[0010] In some preferred embodiments of the present invention, the spacer sequence is as shown in SEQ ID NO: 2.
[0011] More preferably, when the Cas protein is AsCas12a, the scaffold sequence is as shown in SEQ ID NO: 3, wherein the specific sequence of SEQ ID NO: 3 is: 5’-AAUUUCUACUCUUGUAGAU-3’.
[0012] Further preferably, when the Cas protein is SpCas9, the scaffold sequence is as shown in SEQ ID NO: 4, wherein the specific sequence of SEQ ID NO: 4 is: 5'-GUUUUAGAGCUAUGCUGAAAGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUG-3'.
[0013] Further preferably, when the Cas protein is AacCas12b, the scaffold sequence is as shown in SEQ ID NO: 5, wherein the specific sequence of SEQ ID NO: 5 is: 5'-GUCUAGAGGACAGAAUUUUUCAACGGGUGUGCCAAUGGCCACUUUCCAGGUGGCAAAGCCCGUUGAGCUUCUCAAAUCUGAGAAGUGGCAC-3'.
[0014] Further preferably, the guide RNA sequence is as shown in SEQ ID NO: 1.
[0015] Preferably, the field effect transistor is a silicon nanowire field effect transistor or a graphene field effect transistor.
[0016] In some specific embodiments, the sensor further comprises a PCB substrate.
[0017] The second aspect of the present invention provides a method for preparing a field effect transistor sensor based on the CRISPR-Cas system, the method comprising: chemically coupling a field effect transistor with the CRISPR-Cas system.
[0018] Preferably, the method comprises performing amino and aldehyde group modifications on the field effect transistor for chemical coupling with the CRISPR-Cas system.
[0019] Preferably, the amino modification of the field effect transistor uses an amino silane coupling agent.
[0020] In a specific embodiment, the silane coupling agent is APTES.
[0021] Preferably, the amino modification uses an organic solvent as a reaction medium.
[0022] Further preferably, the reaction medium is ethanol.
[0023] More preferably, an APTES ethanol solution with a concentration of 1 to 10 wt% is used; including but not limited to 1 wt%, 2 wt%, 3 wt%, 4 wt%, 5 wt%, 6 wt%, 7 wt%, 8 wt%, 9 wt% or 10 wt%.
[0024] In some specific embodiments, the concentration of the APTES ethanol solution is 2 wt%.
[0025] Preferably, the time for amino modification is 5 to 20 h, more preferably 5 to 15 h; including but not limited to 5 h, 6 h, 7 h, 8 h, 9 h, 10 h, 11 h, 12 h, 13 h, 14 h or 15 h.
[0026] Preferably, for the aldehyde group modification of the field-effect transistor, a coupling agent with an aldehyde group is used.
[0027] Further preferably, the coupling agent with an aldehyde group is glutaraldehyde.
[0028] Preferably, PBS solution is used as the reaction medium for the aldehyde group modification.
[0029] More preferably, a PBS solution of glutaraldehyde with a concentration of 1 to 10 wt% is used; including but not limited to 1 wt%, 2 wt%, 3 wt%, 4 wt%, 5 wt%, 6 wt%, 7 wt%, 8 wt%, 9 wt% or 10 wt%.
[0030] In some specific embodiments, the concentration of the PBS solution of glutaraldehyde is 2.5 wt%.
[0031] Preferably, the time for aldehyde group modification is 1 to 5 h, more preferably 1 to 3 h; including but not limited to 1 h, 1.5 h, 2 h, 2.5 h or 3 h.
[0032] In the present invention, the field-effect transistor is first subjected to amino modification and then aldehyde group modification.
[0033] Preferably, the method further includes dropping a PBS solution containing Cas protein onto the surface of the field-effect transistor modified with amino and aldehyde groups to cover the transistor and incubating for 1 to 3 h to complete the coupling of Cas protein.
[0034] Further preferably, the incubation time can be 1 h, 1.5 h, 2 h, 2.5 h or 3 h.
[0035] Further preferably, the concentration of Cas protein in the PBS solution containing Cas protein is 0.1 to 10 μM, more preferably 0.5 to 3 μM; including but not limited to 0.5 μM, 0.8 μM, 1 μM, 1.5 μM, 2 μM, 2.5 μM or 3 μM.
[0036] Preferably, the method further includes dropping the DEPC aqueous solution containing guide RNA onto the surface of the Cas protein-coupled field-effect transistor to cover the transistor and incubating for 0.5 to 2 hours to complete the binding of the guide RNA to the Cas protein.
[0037] More preferably, the incubation time can be 0.5 h, 0.6 h, 0.7 h, 0.8 h, 0.9 h, 1 h, 1.5 h or 2 h.
[0038] More preferably, the concentration of the guide RNA in the DEPC aqueous solution containing guide RNA is 0.1 to 10 μM, more preferably 0.5 to 3 μM; including but not limited to 0.5 μM, 0.8 μM, 1 μM, 1.5 μM, 2 μM, 2.5 μM or 3 μM.
[0039] Preferably, the method further includes rinsing with a DEPC solution and drying after the guide RNA binds to the Cas protein.
[0040] In the present invention, the Cas protein can be first coupled with the amino- and aldehyde-modified field-effect transistor, and then the guide RNA is bound to the Cas protein; alternatively, the Cas protein can be first bound to the guide RNA to form a complex, and then the complex is coupled to the surface of the amino- and aldehyde-modified field-effect transistor.
[0041] In some specific embodiments, the chemical coupling occurs on a partial surface of the field-effect transistor.
[0042] In some specific embodiments, the chemical coupling occurs on the entire surface of the field-effect transistor.
[0043] The third aspect of the present invention provides a use of a field-effect transistor sensor based on the CRISPR-Cas system in nucleic acid detection, and the nucleic acid is any one or more selected from synthetic DNA, genomic DNA of bacteria, genomic DNA of viruses, and genomic DNA of fungi.
[0044] The synthetic DNA described in the present invention can be single-stranded DNA or double-stranded DNA, preferably double-stranded DNA.
[0045] Preferably, the length of the nucleic acid is 0.01 to 150 Mb; including but not limited to 0.01 Mb, 0.1 Mb, 1 Mb, 5 Mb, 10 Mb, 20 Mb, 30 Mb, 40 Mb, 50 Mb, 60 Mb, 70 Mb, 80 Mb, 90 Mb, 100 Mb, 110 Mb, 120 Mb, 130 Mb, 140 Mb or 150 Mb.
[0046] Preferably, the nucleic acid is genomic DNA of bacteria, and the bacteria are any one or more selected from Bacillus anthracis, Bacillus subtilis, Bacillus cereus, Bacillus licheniformis, and Bacillus polymyxa.
[0047] More preferably, the bacteria are Bacillus anthracis.
[0048] The fourth aspect of the present invention provides a method for detecting nucleic acid concentration, using the above-mentioned field-effect transistor sensor based on the CRISPR-Cas system. The detection method includes: applying voltages to the source, drain, and gate of the sensor to generate a current response value. Drop PBS solution on the surface of the sensor, and record the current at this time as I0.
[0049] Replace the PBS solution with the solution to be detected, so that the Cas protein cuts forward and binds to the target DNA fragment of the target substance in the solution to be detected.
[0050] After the current of the sensor is balanced, replace the solution to be detected with PBS solution. After the current of the sensor is balanced, record the current at this time as I1; the current response value △I = I1 - I0.
[0051] Using the standard curve method, according to the standard curve of the target substance concentration - current response and the current response value △I of the solution to be detected, obtain the concentration of the target substance in the solution to be detected.
[0052] Preferably, the magnitude of the gate voltage is -15 to -5V, and the magnitude of the source-drain voltage is -10 to 10V.
[0053] Preferably, the detection temperature is 20 to 30°C; including but not limited to 20°C, 21°C, 22°C, 23°C, 24°C, 25°C, 26°C, 27°C, 28°C, 29°C, or 30°C.
[0054] Preferably, the detection time is 10 to 30 min; more preferably 10 to 20 min; including but not limited to 10 min, 11 min, 12 min, 13 min, 14 min, 15 min, 16 min, 17 min, 18 min, 19 min, or 20 min.
[0055] Preferably, the detection method further includes mixing the solution to be detected with an endonuclease and standing for 5 to 15 min before detection.
[0056] More preferably, the time for mixing the solution to be detected with the endonuclease and standing can be 5 min, 6 min, 7 min, 8 min, 9 min, 10 min, 11 min, 12 min, 13 min, 14 min, or 15 min.
[0057] Preferably, the endonuclease is any one selected from AccI enzyme, EcoRI enzyme, BamHI enzyme, HindIII enzyme, XhoI enzyme or NotI enzyme.
[0058] In the present application, the target DNA fragment can be cleaved at both ends using a Cas protein, or can be cleaved in cooperation with an endonuclease using a Cas protein.
[0059] In some specific embodiments of the present application, an endonuclease is used to perform pre-enzyme digestion treatment near the upstream of the non-complementary strand of the target sequence, so that one end of the target DNA fragment is broken from the genomic DNA of the target substance.
[0060] Preferably, the length of the target DNA fragment is 30 - 100 bp.
[0061] More preferably, the length of the target DNA fragment is 50 - 70 bp, including but not limited to 50 bp, 52 bp, 55 bp, 57 bp, 58 bp, 59 bp, 60 bp, 61 bp, 62 bp, 63 bp, 64 bp, 65 bp, 67 bp or 70 bp.
[0062] In the present application, the target DNA fragment can be any fragment on the genomic DNA, but needs to include a PAM site, and an endonuclease cleavage site is present at a position about 40 bases upstream (left) of the PAM site.
[0063] Most preferably, the target DNA fragment is as shown in SEQ ID NO: 6 and SEQ ID NO: 7.
[0064] As described above, a field effect transistor sensor based on the CRISPR-Cas system of the present invention, its preparation method and use have the following beneficial effects:
[0065] 1) The field effect transistor sensor based on the CRISPR-Cas system of the present invention has a simple structure, low cost, short detection time, and does not require high detection conditions, does not need heating, and has strong practicability.
[0066] 2) When using the sensor of the present invention for substance detection, by utilizing the specific recognition and precise forward cleavage ability of the CRISPR-Cas system for the target DNA fragment, the binding of the Cas protein to the target DNA fragment causes a change in the current in the field effect transistor, thereby quickly and sensitively realizing the concentration detection of the target substance. The forward cleavage of the target DNA fragment by the CRISPR-Cas system effectively avoids the problem of target bending and entanglement caused by target extension, thereby reducing the detection difference and ensuring the accuracy and reliability of the detection.
[0067] 3) The detection method of the present invention has strong versatility and is applicable to the detection of both single-stranded nucleic acids and double-stranded nucleic acids. There is no requirement for the molecular size of the target substance, and it is applicable to the detection of short molecular nucleic acids at the kb level as well as long molecular nucleic acids at the Mb level. Brief Description of the Drawings
[0068] Figure 1 It shows a schematic diagram of the principle and process for the CRISPR-Cas system-modified field-effect transistor sensor of the present invention to achieve the detection of the concentration of the target substance in the solution.
[0069] Figure 2 It shows a schematic diagram of the silicon nanowire field-effect transistor prepared in Example 1 of the present invention.
[0070] Figure 3 It shows a schematic longitudinal cross-sectional view of the CRISPR-Cas12a system-modified field-effect transistor sensor prepared in Example 2 of the present invention.
[0071] Figure 4 It shows an overall schematic diagram of the CRISPR-Cas12a system-modified field-effect transistor sensor prepared in Example 2 of the present invention.
[0072] Figure 5 It shows the drain current results when the CRISPR-Cas12a system-modified silicon nanowire field-effect transistor sensor of the present invention detects different solutions and the standard concentration-current response curve plotted.
[0073] Figure 6 It shows a schematic diagram of the cleavage of the target DNA fragment on the genome DNA sequence of Bacillus anthracis by AccI endonuclease and AsCas12a protein when the CRISPR-Cas12a system-modified silicon nanowire field-effect transistor sensor of the present invention detects the genome DNA of Bacillus anthracis.
[0074] Figure 7 It shows a comparison of the detection performance between the CRISPR-Cas12a system-modified silicon nanowire field-effect transistor sensor and the silicon nanowire field-effect transistor sensor modified with ordinary single-stranded probes of the present invention. Detailed Embodiments
[0075] The following specific examples illustrate the embodiments of the present invention. Those skilled in the art can easily understand the other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.
[0076] One or more method steps mentioned in the present invention do not exclude the existence of other method steps before and after the combined steps or the insertion of other method steps between these explicitly mentioned steps, unless otherwise specified; it should also be understood that the combined connection relationship between one or more devices / apparatuses mentioned in the present invention does not exclude the existence of other devices / apparatuses before and after the combined devices / apparatuses or the insertion of other devices / apparatuses between these two explicitly mentioned devices / apparatuses. Moreover, unless otherwise specified, the numbering of each method step is only a convenient tool for identifying each method step, rather than restricting the arrangement order of each method step or limiting the scope of implementation of the present invention. The change or adjustment of their relative relationship, without substantial change in technical content, should also be regarded as the scope of implementation of the present invention.
[0077] Before further describing the specific embodiments of the present invention, it should be understood that the protection scope of the present invention is not limited to the following specific embodiments; it should also be understood that the terms used in the embodiments of the present invention are for describing specific embodiments, rather than limiting the protection scope of the present invention; in the specification and claims of the present invention, unless otherwise clearly indicated in the text, the singular forms "a", "an" and "the" include the plural forms.
[0078] When an embodiment gives a numerical range, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those skilled in the art of this technology. In addition to the specific methods, devices, and materials used in the embodiments, according to the knowledge of those skilled in the art of the prior art and the description of the present invention, any methods, devices, and materials of the prior art similar or equivalent to those described in the embodiments of the present invention can also be used to implement the present invention.
[0079] Aiming at the problems in the prior art that double-stranded DNA with a longer molecular size cannot be directly and quickly detected, and it is easy to entangle during detection, resulting in inability to quickly and accurately identify, etc., the present application couples the CRISPR-Cas system with a field-effect transistor to form a sensor. The surface-coupled CRISPR-Cas system can precisely cut the target DNA fragment in the long double-stranded DNA through its cutting function. The Cas protein binds to the target DNA fragment, and the negative charge of the nucleic acid molecule will induce a positive charge on the surface of the transistor, thereby changing the electrical characteristics (such as current or gate voltage) of the transistor, so as to achieve high-sensitivity and high-accuracy detection of nucleic acid concentration.
[0080] The principle and process of the field-effect transistor sensor modified by the CRISPR-Cas system in the present application for detecting the concentration of the target substance in the solution are asFigure 1 As shown. After the double-stranded DNA cluster containing the target sequence contacts the CRISPR-Cas system coupled to the sensor surface, the CRISPR-Cas system will recognize and bind to the target DNA fragment in the target sequence. At this time, the ability of the system to cut double-stranded DNA will be activated, cutting the target DNA fragment from the DNA cluster, without being affected by nucleic acid entanglement and without affecting the reaction of the remaining target sequences in the cluster. In this way, the problem that double-stranded DNA cannot be directly used for detection and the nucleic acid entanglement problem caused by too long double-stranded DNA can be effectively solved.
[0081] The applicant of this application has obtained through a large number of previous experimental studies that when the length of the target DNA fragment is about 60 bp, the detection effect is the best. Therefore, the sequences of the target DNA fragments selected in the following embodiments of this application are shown in SEQ ID NO: 6 and SEQ ID NO: 7.
[0082] In the following embodiments of this application, a method for preparing a field-effect transistor is specifically disclosed. However, those skilled in the art can understand that as long as it is a field-effect transistor that can implement the above concept of the present invention, it is acceptable, and it is not limited to the field-effect transistor described in the embodiments of this application.
[0083] Example 1
[0084] In this example, a silicon nanowire field-effect transistor was prepared using an SOI wafer by the method in the patent with the application number 202410605815.6, and the wafer was cut into a size of 3 mm × 4 mm. The prepared field-effect transistor was placed on a PCB substrate. The prepared field-effect transistor is as Figure 2 shown, Figure 2 a is the field-effect transistor prepared in this example, Figure 2 b and 2c are the silicon nanowire arrays in the field-effect transistor, Figure 2 d is the cross-sectional view of a single silicon nanowire.
[0085] Example 2
[0086] In this example, a sensor was prepared by coupling the CRISPR-Cas system with a field-effect transistor.
[0087] Since the scaffold sequence of AsCas12a is relatively short, the Cas protein selected in this example is AsCas12a, and the corresponding guide RNA sequence is: AAUUUCUACUCUUGUAGAUACUGCUACUGUAAUUCCAAACCG (SEQ ID NO: 1); among them, the spacer sequence is ACUGCUACUGUAAUUCCAAACCG (SEQ ID NO: 2), and the scaffold sequence is AAUUUCUACUCUUGUAGAU (SEQ ID NO: 3).
[0088] Using the silicon nanowire field-effect transistor prepared in Example 1, the above AsCas12a protein and guide RNA were sequentially coupled to the surface of the silicon nanowire field-effect transistor. The specific steps are as follows:
[0089] Step 1: Immerse the silicon nanowire field-effect transistor in a 2% APTES anhydrous ethanol solution overnight to complete the coupling of amino groups.
[0090] Step 2: Immerse the silicon nanowire field-effect transistor coupled with amino groups in a 2.5% glutaraldehyde PBS solution for 2 h to complete the coupling of aldehyde groups.
[0091] Step 3: Drop 1 μM PBS solution containing AsCas12a protein onto the surface of the silicon nanowire field-effect transistor to make the liquid cover the surface of the transistor, and incubate for 2 hours to complete the coupling of the Cas protein.
[0092] Step 4: Drop 1 μM DEPC (diethyl pyrocarbonate) aqueous solution containing guide RNA onto the surface of the silicon nanowire field-effect transistor to make the liquid cover the surface of the transistor, and incubate for 45 min to complete the construction of the CRISPR-Cas12a system on the surface of the silicon nanowire field-effect transistor.
[0093] Step 5: Rinse the sensor 3 - 5 times with DEPC solution and dry it to obtain a field-effect transistor sensor modified with the CRISPR-Cas12a system.
[0094] The cross-sectional schematic diagram of the finally prepared field-effect transistor sensor modified with the CRISPR-Cas12a system is as shown in Figure 3 shown, and the overall schematic diagram is as shown in Figure 4 shown.
[0095] Example 3
[0096] In this example, the silicon nanowire field-effect transistor sensor modified by the CRISPR-Cas12a system prepared in Example 2 is selected to detect the target substance in the solution. The target substance to be detected in this example is Bacillus anthracis, a double-stranded DNA bacterium with a full length of about 5.3 Mb. The target DNA fragment in this example exists on the Ba318 sequence on the Bacillus anthracis chromosome (the specific acquisition website of the Ba318 sequence is https: / / www.ncbi.nlm.nih.gov / nuccore / AF205352.1 / ).
[0097] Using a Bacillus anthracis genomic DNA standard product (purchased from Shanghai Xinyu Biotechnology Co., Ltd.), add AccI endonuclease to the Bacillus anthracis genomic DNA standard product, mix evenly and let stand for 10 min to obtain the standard solution for subsequent testing. The specific operation of the detection is as follows: In a light-shielded environment at room temperature of 26 °C, apply a source-drain voltage of -0.4 V and a gate voltage of -10 V, and drop PBS (10 mM) solution on the sensor surface. First, measure the drain current of the sensor in the PBS (10 mM) solution as the reference current (denoted as I0). Then, replace the PBS (10 mM) solution with a standard solution with a concentration of 1 fM. After waiting for the sensor current to balance, replace the solution on the sensor surface back to the PBS (10 mM) solution. After equilibrium, measure the current I1 of the sensor, and calculate the current response value ΔI = I1 - I0; sequentially replace the concentration of the above standard solution with 10 fM, 100 fM, 1 pM, 10 pM, 100 pM, and repeat the above process. The final test results are as Figure 5 shown. Combining the above tests for curve fitting to obtain a standard curve. The specific standard curve is y = A*(x / B)^C / (1+(x / B)^C), where A = 0.2524 ± 0.00296, B = 7.400E-15 ± 8.666E-16, C = 0.3522 ± 0.0181, and R2 = 0.99875.
[0098] From Figure 5 the results, it can be seen that as the concentration of the standard solution increases, the current response value generated in the silicon nanowire field-effect transistor sensor is higher. When detecting the test solution, substitute the current signal value generated by the field-effect transistor sensor into the above standard curve to calculate the concentration of the test solution. Therefore, the silicon nanowire field-effect transistor sensor coupled with the CRISPR-Cas system in this example can achieve highly sensitive detection of the target sequence in long double-stranded DNA.
[0099] The schematic diagram of the cleavage of the target DNA fragment on the Bacillus anthracis genomic DNA sequence by AccI endonuclease and AsCas12a protein is asFigure 6 as shown
[0100] The sequences of the target DNA fragments obtained by cleavage with AccI endonuclease and AsCas12a protein are as follows:
[0101] Forward cleavage strand: 5’-ATACTATAGTGGCAAAGTGGATAAAAACGGAAAACGTGGTTTTACTGCTACTGTAATTCCA-3’ (SEQ ID NO: 6);
[0102] Reverse cleavage strand: 5’-CGGTTTGGAATTACAGTAGCAGTAAAACCACGTTTTCCGTTTTTATCCACTTTGCCACTATAGT-3’ (SEQ ID NO: 7).
[0103] Furthermore, the nucleic acid detection capabilities of the silicon nanowire field effect transistor sensor coupled with the CRISPR-Cas system prepared in this application and the silicon nanowire field effect transistor sensor coupled with a single-stranded probe (the silicon nanowire field effect transistor sensor coupled with a single-stranded probe is formed by coupling the probe to the surface of the silicon nanowire field effect transistor through amino and hydroxyl groups) were tested, and the coefficient of variation was calculated by repeating the measurement three times. The detection sequences (synthesized by Shanghai Dina Biotechnology Co., Ltd.) are shown in Table 1.
[0104] Table 1 Detection sequences
[0105]
[0106]
[0107] Specific detection operation: Under a light-shielded environment at room temperature of 26 °C, a source-drain voltage of -0.4 V and a gate voltage of -10 V were applied, and a PBS (10 mM) solution was dropped on the surface of the silicon nanowire field effect transistor sensor. First, the drain current of the sensor in the PBS (10 mM) solution was measured as the reference current (denoted as I0). Then, the PBS (10 mM) solution was replaced with a standard solution with a concentration of 1 fM. After waiting for the sensor current to reach equilibrium, the solution on the sensor surface was replaced back with the PBS (10 mM) solution. After equilibrium, the current I1 of the sensor was measured, and the current response value ΔI = I1 - I0 was calculated.
[0108] The detection results are as Figure 7 shown, where Figure 7 the abscissa represents different sensors and the sequences to be detected, the left ordinate represents ΔI / I, and the right ordinate represents the coefficient of variation. From Figure 7As can be seen from the results, to amplify the response signal, traditional single-stranded DNA probes achieve this by extending the length of the target DNA. For example, in this experiment, when the ssDNA was extended from 60 nt to 120 nt, ΔI / I was amplified by approximately two times. However, the resulting target entanglement problem would increase the coefficient of variation, leading to an increase in the detection difference. When using the CRISPR-Cas system in this application as a probe, it can detect both single-stranded DNA and double-stranded DNA. For example, when detecting ssDNA in this experiment, the CRISPR-Cas system cleaved the 120-nt single-stranded sequence into a 60-nt single-stranded sequence; when detecting dsDNA, the CRISPR-Cas system cleaved the 120-nt double-stranded sequence into a 60-nt double-stranded sequence. Compared with ssNDA, dsDNA amplified the detection signal, but the coefficient of variation did not increase. At the same time, compared with single-stranded probe detection, the CRISPR-Cas system in this application can significantly reduce the coefficient of variation for both ssDNA and dsDNA. Therefore, the cleavage ability of the CRISPR-Cas system can avoid the target entanglement problem and ensure accurate and reliable detection.
[0109] In summary, the present invention provides a field-effect transistor sensor based on the CRISPR-Cas system, which can be used for detecting nucleic acid concentration. When performing detection: the CRISPR-Cas system cleaves the target DNA fragment in the forward direction and amplifies the response signal through a rapid change in the field-effect transistor current, thereby completing the detection of nucleic acid concentration. This method has a fast response speed, high sensitivity and specificity, and strong versatility, and can directly detect long-sized single-stranded and double-stranded target DNA, with broad application prospects.
[0110] The above are only the preferred embodiments of the present invention, and do not impose any formal or substantial limitations on the present invention. It should be noted that for those of ordinary skill in the art in this technical field, without departing from the method of the present invention, several improvements and supplements can still be made, and these improvements and supplements should also be regarded as the protection scope of the present invention. Any equivalent changes, modifications, and evolutions made by those skilled in the art who are familiar with this specialty without departing from the spirit and scope of the present invention, when using the technical content disclosed above, are all equivalent embodiments of the present invention; at the same time, any equivalent changes, modifications, and evolutions made to the above embodiments based on the essential technology of the present invention still fall within the scope of the technical solution of the present invention.
Claims
1. A field effect transistor sensor based on the CRISPR-Cas system, characterized in that, The field effect transistor sensor includes a field effect transistor and a CRISPR-Cas system modified on its surface; the CRISPR-Cas system includes a Cas protein and a guide RNA, and the Cas protein is one or more selected from Cas9, Cas12a, Cas12b, and Cas12f; The guide RNA includes a scaffold sequence and a spacer sequence.
2. The sensor according to claim 1, characterized in that, The Cas protein is any one or more selected from SpCas9, AsCas12a, and AacCas12b; and / or, the field effect transistor is a silicon nanowire field effect transistor or a graphene field effect transistor; and / or, the scaffold sequence is any one or more selected from SEQ ID NO: 3, SEQ ID NO: 4, or SEQ ID NO: 5; and / or, the length of the spacer sequence is 18-40 bp.
3. The sensor according to claim 2, wherein The scaffold sequence is as shown in SEQ ID NO: 3; and / or, the spacer sequence is as shown in SEQ ID NO:
2.
4. A method for preparing a sensor according to any one of claims 1 to 3, characterized in that, The method includes: chemically coupling the field effect transistor with the CRISPR-Cas system.
5. The preparation method according to claim 4, wherein The method includes modifying the field effect transistor with amino and aldehyde groups for chemical coupling with the CRISPR-Cas system; preferably, the amino modification uses an amino silane coupling agent, and the aldehyde modification uses a coupling agent with an aldehyde group.
6. The preparation method according to claim 5, characterized in that, The method further includes dropping a PBS solution containing the Cas protein onto the surface of the field effect transistor modified with amino and aldehyde groups to cover the transistor and incubating for 1-3 h to complete the coupling of the Cas protein; and / or, the amino silane coupling agent is APTES; and / or, the amino modification uses an organic solvent as the reaction medium, preferably, the reaction medium is ethanol; and / or, the coupling agent with an aldehyde group is glutaraldehyde; and / or, the aldehyde modification uses PBS as the reaction medium; and / or, the time for amino modification is 5-20 h; and / or, the time for aldehyde modification is 1-5 h.
7. The preparation method according to claim 6, characterized in that, The concentration of the Cas protein in the PBS solution containing the Cas protein is 0.1-10 μM; and / or, the method further includes dropping a DEPC aqueous solution containing the guide RNA onto the surface of the field effect transistor coupled with the Cas protein to cover the transistor and incubating for 0.5-2 h to complete the binding of the guide RNA to the Cas protein, preferably, the concentration of the guide RNA in the DEPC aqueous solution containing the guide RNA is 0.1-10 μM.
8. Use of a sensor according to any one of claims 1 to 3 in nucleic acid detection, characterized in that, The nucleic acid is any one or more selected from synthetic DNA, genomic DNA of bacteria, genomic DNA of viruses, and genomic DNA of fungi.
9. The use according to claim 8, wherein The length of the nucleic acid is 0.01-150 Mb; and / or, the nucleic acid is genomic DNA of bacteria, and the bacteria are any one or more selected from Bacillus anthracis, Bacillus subtilis, Bacillus cereus, Bacillus licheniformis, and Bacillus polymyxa; preferably, the bacteria are Bacillus anthracis.
10. A method for detecting nucleic acid concentration, characterized in that, The detection method using the sensor according to any one of claims 1 to 3 includes: applying voltages to the source, drain, and gate of the sensor to generate a current response value, dropping a PBS solution on the surface of the sensor, and recording the current as I0 at this time; Replacing the PBS solution with the solution to be detected, and enabling the Cas protein to cleave forward and bind to the target DNA fragment of the substance to be detected in the solution to be detected; After the current of the sensor is balanced, replacing the solution to be detected with a PBS solution, and recording the current at this time as I1 after the current of the sensor is balanced; the current response value △I = I1 - I0; Adopting the standard curve method, and obtaining the concentration of the target substance in the solution to be detected according to the standard curve of the target substance concentration - current response and the current response value △I of the solution to be detected.
11. The detection method according to claim 10, wherein, The magnitude of the gate voltage is -15 to -5 V, and the magnitude of the source-drain voltage is -10 to 10 V; and / or, the detection temperature is 20 to 30 °C; and / or, the detection time is 10 to 30 min.
12. The detection method according to claim 10, wherein, The detection method further includes mixing the solution to be detected with an endonuclease and standing for 5 to 15 min before detection; preferably, the endonuclease is any one selected from AccI enzyme, EcoRI enzyme, BamHI enzyme, HindIII enzyme, XhoI enzyme, or NotI enzyme.
13. The detection method according to claim 10, wherein The length of the target DNA fragment is 50 to 70 bp; preferably, the target DNA fragment is as shown in SEQ ID NO: 6 and SEQ ID NO: 7.
Citation Information
Patent Citations
Double-gate silicon nanowire transistor sensor and manufacturing method
CN118191066A