CKAP4 targeting RNA, vector, virus, method and application

By targeting CKAP4 RNA and recombinant lentiviral vectors, using the CRISPR-Cas9 system to knock out or interfere with the CKAP4 gene, the problem of irrepressible breast cancer cell proliferation and invasion is solved, and effective breast cancer treatment effect is achieved.

CN120249278APending Publication Date: 2025-07-04FIRST AFFILIATED HOSPITAL OF KUNMING MEDICAL UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510420139.X
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-03
Publication Date
2025-07-04

AI Technical Summary

Technical Problem

The prior art is difficult to effectively target the blockade of CKAP4 protein, resulting in the proliferation, migration and invasion of breast cancer cells that are difficult to effectively inhibit, and there is a lack of effective anti-tumor drug targets.

Method used

Breast cancer cells with CKAP4 knockout or inhibition of CKAP4 knockout or expression were prepared by using RNA targeting CKAP4 and recombinant lentiviral vectors to knockout or interfere with CKAP4 gene expression through the CRISPR-Cas9 system, and were used to prepare breast cancer drugs.

Benefits of technology

It significantly inhibits the proliferation, migration and invasion of breast cancer cells. In vivo and in vivo experiments showed that CKAP4 knockdown or expression inhibition effect was significant, slowing tumor growth, and providing the application prospects of breast cancer drugs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120249278A_ABST
    Figure CN120249278A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of CKAP4, in particular to CKAP4 targeting RNA, a carrier, a virus, a method and application. According to the embodiment of the invention, a recombinant lentiviral vector is constructed by guiding a Cas9 enzyme to target an RNA sequence for knocking out CKAP4, or by adopting RNA to target interference CKAP4 or cloning the RNA sequence into a lentiviral vector, the recombinant lentiviral vector is packaged to obtain a recombinant lentivirus, and the recombinant lentivirus is transferred into a breast cancer cell to obtain a breast cancer cell with CKAP4 knockout or expression inhibition, so that the CKAP4 knockout or expression inhibition CKAP4 knockout or expression inhibition CKAP4 knockout or expression inhibition CKAP4 knockout or expression inhibition CKAP4 is realized. And introducing the CKAP4 knockout or expression-inhibited breast cancer cells into a mouse body to obtain CKAP4 knockout breast cancer tissues. Tests show that the CKAP4 targeting RNA, the carrier, the virus and the method can inhibit proliferation, migration and invasion of breast cancer cells, and have application prospects as breast cancer drugs.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the technical field of CKAP4, and specifically relates to RNAs, vectors, viruses, methods and applications targeting CKAP4. Background Art

[0002] Cytoskeleton Associated Protein 4 (CKAP4) is a palmitoylated type II transmembrane protein, containing a large number of negatively charged regions, highly folded into a random coil structure, with multiple ion binding sites, and its amino acid sequence contains low complexity domains and intrinsically disordered regions. The predicted molecular weight of CKAP4 is 57.7 kDa, and the accurate molecular weight is 58 kDa as determined by SDS-PAGE under reducing conditions. CKAP4 is mainly localized in the endoplasmic reticulum and can also be present in the cell membrane and cytoplasm.

[0003] CKAP4 controls the transport of α5β1 integrin by interacting with β1 integrin, regulates the adhesion of tumor cells to fibronectin, and enhances the metastatic potential of tumor cells; it can also act as a receptor for Dickkopf1 (DKK1), activating the phosphoinositide 3-kinase (PI3K) / protein kinase B (AKT) pathway in cancer, promoting cell migration and proliferation. CKAP4 also acts as a sensitive intracellular mechanosensor, which can specifically respond to the solid-phase stress in the tumor microenvironment through liquid-liquid phase separation, regulate the curvature and branching of microtubules, enhance the motility of tumor cells, and promote their metastasis in vivo. In hepatocellular carcinoma, CKAP4 can regulate endoplasmic reticulum autophagy by interacting with RETREG1 and TRIM21 proteins, indirectly promoting the proliferation of hepatocellular carcinoma cells.

[0004] Clinically, since CKAP4 is highly expressed in various solid tumor tissues and is associated with tumor metastasis and poor patient prognosis, it is expected to be a potential biomarker for cancer diagnosis and prognosis assessment. Targeted blockade of CKAP4 has broad prospects in inhibiting the migration and invasion of cancer cells, and related research provides new targets and ideas for the development of new anti-tumor drugs. Summary of the Invention

[0005] Therefore, this application provides RNAs, vectors, viruses, methods and applications targeting CKAP4.

[0006] In the first aspect, the embodiment discloses an RNA targeting CKAP4, and its nucleotide sequence is shown as any one of SEQ ID NO:5-8 or as any one of SEQ ID NO:17-20.

[0007] In a second aspect, the embodiment also discloses a primer set, the nucleotide sequences of which are as shown in SEQ ID NO: 9 and 10, or as shown in SEQ ID NO: 11 and 12, or as shown in SEQ ID NO: 13 and 14, or as shown in SEQ ID NO: 15 and 16. Among them, the primer set of SEQ ID NO: 9 and 10 can obtain the RNA shown in SEQ ID NO: 5 after annealing treatment. The primer set of SEQ ID NO: 11 and 12 can obtain the RNA shown in SEQ ID NO: 6 after annealing treatment. The primer set of SEQ ID NO: 13 and 14 can obtain the RNA shown in SEQ ID NO: 7 after annealing treatment. The primer set of SEQ ID NO: 15 and 16 can obtain the RNA shown in SEQ ID NO: 8 after annealing treatment.

[0008] In a third aspect, the embodiment discloses a recombinant lentiviral vector, which is a lenti-CRISPRv2 plasmid carrying any one of the nucleotide sequences shown in SEQ ID NO: 5-8 or a lenti-CRISPRv2 plasmid carrying any one of the nucleotide sequences shown in SEQ ID NO: 17-20.

[0009] In a fourth aspect, the embodiment discloses a method for preparing the recombinant lentiviral vector. The method includes: obtaining a linearized lenti-CRISPRv2 fragment; ligating the annealing product obtained by the above method with the linearized lenti-CRISPRv2 fragment to obtain a recombinant fragment; transferring the recombinant fragment into Escherichia coli; screening positive clones from the culture of the transformants; and extracting the recombinant lentiviral vector from the culture of the positive clones.

[0010] In a fifth aspect, the embodiment discloses a method for preparing the recombinant lentiviral vector. The method includes: obtaining a linearized GV493 fragment; ligating a DNA molecule of any one of SEQ ID NO: 17-20 with the linearized GV493 fragment to obtain a recombinant fragment; transferring the recombinant fragment into Escherichia coli; screening positive clones from the culture of the transformants; and extracting the recombinant lentiviral vector from the culture of the positive clones.

[0011] In a sixth aspect, the embodiment discloses a recombinant lentivirus carrying any one of the nucleotide sequences shown in SEQ ID NO: 5-8 and the Cas9 coding sequence or a recombinant lentivirus carrying any one of the nucleotide sequences shown in SEQ ID NO: 17-20.

[0012] In a seventh aspect, an embodiment discloses a method for preparing breast cancer cells with CKAP4 knockout or expression inhibition. The method includes: obtaining breast cancer cells and the recombinant lentivirus of the sixth aspect; mixing and transfecting the solution containing the recombinant lentivirus with the culture medium of the breast cancer cells, culturing the transfected solution, and screening breast cancer cells with CKAP4 knockout or expression inhibition.

[0013] In an eighth aspect, an embodiment discloses a breast cancer drug, which includes the recombinant lentiviral vector of the third aspect.

[0014] In a ninth aspect, an embodiment discloses a breast cancer drug, which includes the recombinant lentivirus prepared by the method of the sixth aspect.

[0015] In a tenth aspect, an embodiment discloses the application of the RNA of the first aspect, the recombinant lentiviral vector of the third aspect, or the recombinant lentivirus prepared by the sixth aspect in the preparation of a breast cancer drug. Description of the Drawings

[0016] Figure 1 Expression results in breast cancer and adjacent tissues provided for the examples. Figure 1 A is an immunohistochemical staining map of CKAP4 protein. Figure 1 B is a statistical graph of CKAP4 protein expression level. Figure 1 C is the CKAP4 protein expression score.

[0017] Figure 2 Expression results in breast cancer (T) and adjacent tissues (N) provided for the examples. Figure 2 A is a statistical graph of relative CKAP4 mRNA expression level (n = 12). Figure 2 B is a WB detection graph (n = 12). ***P < 0.001.

[0018] Figure 3 WB detection graph of CKAP4 protein expression in various breast cancer cells provided for the test examples.

[0019] Figure 4 Results of knocking down CKAP4 in breast cancer cells based on Cas9 ribozyme provided for the RT-PCR test example (A) and the WB test example (B) respectively. "sg-CKAP4-1#" represents gRNA1, "sg-CKAP4-2#" represents gRNA2, "sg-CKAP4-3#" represents gRNA3, and "sg-CKAP4-4#" represents gRNA4.

[0020] Figure 5 CKAP4 expression result graph in breast cancer cells with CKAP4 knockout or expression inhibition provided for the test examples. Figure 5A is the relative mRNA expression level of the CAKP4 gene in HCC1806 cells with CKAP4 expression inhibited (shCKAP4-1 / shCKAP4-2) and MDA-MB-231 cells with CKAP4 expression inhibited (shCKAP4-1 / shCKAP4-2). Figure 5 B is the WB graph of the CKAP4 expression level in HCC1806 cells with CKAP4 expression inhibited (shCKAP4-1 / shCKAP4-2) and MDA-MB-231 cells with CKAP4 expression inhibited (shCKAP4-1 / shCKAP4-2). ***P < 0.001. "shCKAP4-1" represents double-stranded RNA 1 interfering with CKAP4, and "shCKAP4-2" represents double-stranded RNA 2 interfering with CKAP4.

[0021] Figure 6 In vitro proliferation detection results of breast cancer cells with CKAP4 knockout or expression inhibited provided for the test example. Figure 6 A is the SRB experiment results of HCC1806 cells with CKAP4 expression inhibited (shCKAP4-1 / shCKAP4-2) and MDA-MB-231 cells with CKAP4 expression inhibited (shCKAP4-1 / shCKAP4-2). **P < 0.01, ***P < 0.001. Figure 6 B is the EdU experiment results of HCC1806 cells with CKAP4 expression inhibited (shCKAP4-1 / shCKAP4-2) and MDA-MB-231 cells with CKAP4 expression inhibited (shCKAP4-1 / shCKAP4-2). **P < 0.01, ***P < 0.001.

[0022] Figure 7 Cell cycle detection results of breast cancer cells of HCC1806 cells with CKAP4 expression inhibited (shCKAP4-1 / shCKAP4-2) and MDA-MB-231 cells with CKAP4 expression inhibited (shCKAP4-1 / shCKAP4-2) provided for the flow cytometry test example. **P < 0.01, ***P < 0.001.

[0023] Figure 8 Cell cycle detection results of breast cancer cells of HCC1806 cells with CKAP4 expression inhibited (shCKAP4-1 / shCKAP4-2) and MDA-MB-231 cells with CKAP4 expression inhibited (shCKAP4-1 / shCKAP4-2) provided for the WB test example. **P < 0.01, ***P < 0.001.

[0024] Figure 9Apoptosis results of breast cancer cells of HCC1806 cells with inhibited CKAP4 expression (shCKAP4-1 / shCKAP4-2) and MDA-MB-231 cells with inhibited CKAP4 expression (shCKAP4-1 / shCKAP4-2) provided for flow cytometry test cases. **P < 0.01, ***P < 0.001.

[0025] Figure 10 Cell migration results of breast cancer cells of HCC1806 cells with inhibited CKAP4 expression (shCKAP4-1 / shCKAP4-2) and MDA-MB-231 cells with inhibited CKAP4 expression (shCKAP4-1 / shCKAP4-2) provided for cell scratch test cases. **P < 0.01, ***P < 0.001.. *P < 0.05, **P < 0.01, ***P < 0.001.

[0026] Figure 11 Cell invasion results of breast cancer cells of HCC1806 cells with inhibited CKAP4 expression (shCKAP4-1 / shCKAP4-2) and MDA-MB-231 cells with inhibited CKAP4 expression (shCKAP4-1 / shCKAP4-2) provided for Transwell test cases. **P < 0.01, ***P < 0.001.. *P < 0.05, **P < 0.01, ***P < 0.001.

[0027] Figure 12 Results of inhibiting the in vivo growth of breast cancer tissues by knocking out CKAP4 provided for in vivo transplantation test cases. Figure 12 Schematic diagram of establishing a xenograft tumor model in nude mice with A cells. Figure 12 B is the curve of the change in the volume of the transplanted tumor. Figure 12 C is the solid figure of the transplanted tumor. Figure 12 D is the statistical chart of the weight of the transplanted tumor. Figure 12 E is the result of immunohistochemical detection of the expression of the proliferation protein ki-67. **P < 0.01, ***P < 0.001. Detailed implementation manners

[0028] In order to make the objectives, technical solutions and advantages of the present application clearer and more understandable, the present application will be further described in detail below in conjunction with embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and are not used to limit the present application. The reagents not specifically described in detail in the present application are all conventional reagents and can be obtained from commercial channels; the methods not specifically described in detail are all conventional experimental methods and can be learned from the prior art.

[0029] The expression of CKAP4 mRNA and protein in human breast cancer tissues is higher than that in adjacent tissues

[0030] 1. Clinical samples

[0031] A total of 101 postoperative specimens of breast cancer patients who underwent surgical treatment in the hospital from January 2015 to January 2017 were collected. The tissues were routinely fixed with 4% neutral formalin, and tissue sections were prepared for hematoxylin-eosin staining. The pathological results were confirmed by two experienced pathologists above the attending physician level. Histopathological typing of the tissues was performed according to the WHO Breast Tumor Pathology Diagnosis (2019 Edition), and the pathological diagnosis was non-special invasive breast cancer. Histological grading was carried out according to the Nottingham grading system score. The follow-up data of the patients were collected by telephone. This study was approved by the Ethics Committee.

[0032] 2. Methods

[0033] (1) Hematoxylin-eosin (HE) staining

[0034] The paraffin blocks of breast cancer tissues or tissue microarray paraffin blocks were sectioned, fixed on glass slides, stained, and sealed.

[0035] (2) Immunohistochemical staining (IHC)

[0036] The paraffin blocks of breast cancer tissues or tissue microarray paraffin blocks were sectioned, dewaxed, hydrated, antigen repaired, endogenous peroxidase blocked, and incubated with the primary antibody (CKAP4 antibody, Enzo Life Science) at 37°C for 1 hour. After washing, the secondary antibody (enzymatically labeled goat anti-mouse / rabbit IgG polymer) was added and incubated at 37°C for 20 minutes. After washing, color development, counterstaining, dehydration, clearing, and sealing were performed. The total score was calculated by multiplying the proportion of positive tumor cells by the staining intensity score. The proportions of positive tumor cells were 0 (5%), 1 (6 - 25%), 2 (26 - 50%), 3 (51% - 75%), 4 (76 - 100%) respectively. The staining intensity score was 0 (none), 1 (weak), 2 (medium), 3 (strong) points. According to the final score, <5% of the cells were stained, regardless of the staining intensity, and it was determined to be negative (-); 1 - 4 points were recorded as weak (+); 5 - 8 points were moderate (++); 9 - 12 points were strong (+++). In the subsequent statistical analysis, negative and weak expression were determined as the low-expression group, and medium and strong expression were determined as the high-expression group.

[0037] (3) Real-time fluorescence quantitative reverse transcription PCR

[0038] Total RNA was extracted from fresh breast cancer tissues and adjacent breast tissues using Trizol reagent. The concentration of total RNA was measured using NANODROP2000, and the quality of RNA was analyzed by agarose gel electrophoresis. The total RNA with determined concentration and quality was reverse-transcribed into cDNA. The reverse transcription system, calculated based on 10 μL, included 2 μL RT Master Mix (5×), 100 ng - 1 μg total RNA, and the remaining volume of Nuclease-free water.

[0039] The cDNA samples obtained by reverse transcription were subjected to qPCR. The qPCR reaction system, calculated based on 20 μL, included 1 μL cDNA, 0.8 μL 10 μM upstream primer, 0.8 μL 10 μM downstream primer, 10 μL 1×TSING Master SYBR Green I qPCR Mix-UDG (Without ROX), and the remaining volume of double-distilled water. The qPCR reaction steps included: 50 °C for 2 min; 95 °C for 2 min; 95 °C for 15 s; 40 cycles; 60 °C for 1 min. The expression of RNA was normalized to the level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA. Data analysis was performed using Bio-Rad CFX96 Manager software.

[0040] Among them, the upstream primer for detecting CKAP4 mRNA was: aagctgtgaagcaaggggag, shown as SEQ ID NO:1. The downstream primer for detecting CKAP4 mRNA was: ggatttggtgagctccgtca, shown as SEQ ID NO:2. The upstream primer for detecting GAPDH mRNA was: gaaagcctgccggtgactaa, shown as SEQ ID NO:3. The downstream primer for detecting GAPDH mRNA was: gcccaatacgaccaaatcagaga, shown as SEQ ID NO:4.

[0041] (4) Protein immunoblotting (western blotting, WB)

[0042] Fresh breast cancer tissues and adjacent breast tissues were lysed with RIPA buffer to extract total proteins, and the protein concentration was detected using the BCA method. SDS-PAGE electrophoresis was performed, and then the gel was transferred to a PVDF membrane using a membrane transfer instrument and blocked at room temperature for 1 - 2 h. The primary antibody (Proteintech, catalog number #14475-1-AP, dilution factor 1:1000) was added and incubated at 4 °C for 12 hours. After washing, the secondary antibody (horseradish peroxidase-labeled goat anti-rabbit IgG) was added and incubated at room temperature for 2 h, followed by color development. The protein expression level was analyzed using ImageJ software.

[0043] 3. Results

[0044] As shown in Table 1 and Figure 1 as described below, 101 clinical breast cancer samples were collected, and immunohistochemical staining was performed on breast cancer tissues and adjacent breast tissues to detect the expression level of CKAP4 protein, and semi-quantitative analysis was carried out. According to the scoring principle, the CKAP4 expression level was divided into a low-expression group and a high-expression group. The results showed that among 101 breast cancer tissues, 32 cases had low expression (accounting for 68.3%), and 69 cases had high expression (accounting for 31.7%); among the paired adjacent breast tissues of the same patients, 81 cases had low expression (accounting for 80.2%), and 20 cases had high expression (accounting for 19.8%). The expression of CKAP4 in breast cancer tissues was significantly higher than that in adjacent breast tissues.

[0045] Twelve pairs of breast cancer tissues and corresponding breast tissues were randomly selected from the above samples, and the mRNA and protein expression levels of CKAP4 were detected by qPCR and WB. As Figure 2 shown, the mRNA and protein expression levels of CKAP4 in breast cancer tissues were higher than those in adjacent tissues.

[0046] As Figure 3 shown in the WB analysis of the CKAP4 protein expression map in breast cell lines, compared with breast epithelial cell lines (MCF-10A, 184B5), HER-2 overexpressing breast cancer cell lines (SKBR-3), Luminal breast cancer cell lines (T47D, MCF-7), the expression of CKAP4 was significantly upregulated in TNBC cell lines (MDA-MB-231, HCC1806, HS578T, 149PT); among them, the expression of CKAP4 in MDA-MB-231 and HCC1806 cells was relatively high. These results suggest that the transcriptional and translational expression levels of CKAP4 are both increased in breast cancer, especially in TNBC (triple-negative breast cancer), and it may play a regulatory role in the occurrence and development of cancer.

[0047] Table 1 Statistical analysis of CKAP4 protein expression in breast cancer and adjacent tissues

[0048]

[0049] Knockout of CKAP4

[0050] In addition, high expression of CKAP4 is a poor prognostic factor for patients with pancreatic cancer and lung cancer, and it promotes the proliferation and migration of tumor cells. Therefore, the embodiments of the present application provide RNAs, vectors, viruses and methods targeting CKAP4.

[0051] The embodiment discloses an RNA, whose nucleotide sequence is shown as SEQ ID NO: 5-8. This RNA can guide the Cas9 ribozyme to cleave and remove the gene sequence of CKAP4, achieve the knockout of the CKAP4 gene in breast cancer cells in vivo and in vitro, and then interfere with or inhibit the proliferation, migration and invasion of breast cancer cells, thereby playing a role in preventing or treating breast cancer, and having the application prospect of developing into a drug for preventing or treating breast cancer.

[0052] The embodiment also discloses a primer set, whose nucleotide sequence is as shown in SEQ ID NO: 9 and 10, or as shown in SEQ ID NO: 11 and 12, or as shown in SEQ ID NO: 13 and 14, or as shown in SEQ ID NO: 15 and 16. Among them, the primer set of SEQ ID NO: 9 and 10 can obtain the RNA containing SEQ ID NO: 5 after annealing treatment. The primer set of SEQ ID NO: 11 and 12 can obtain the RNA containing SEQ ID NO: 6 after annealing treatment. The primer set of SEQ ID NO: 13 and 14 can obtain the RNA containing SEQ ID NO: 7 after annealing treatment. The primer set of SEQ ID NO: 15 and 16 can obtain the RNA containing SEQ ID NO: 8 after annealing treatment. Specifically, it is shown in Table 2 below.

[0053] In Table 2, the sequence "CACCG" is usually part of the precursor sequence of the guide RNA (gRNA) in the CRISPR-Cas9 system. In the lentiCRISPRv2 vector, the CACCG sequence is a specific sequence for cloning gRNA. It is located in front of the gRNA sequence to help ensure the correct expression and function of the gRNA. The sequence "CAAA" is usually used to ensure the correct orientation of the cloned gRNA sequence in the vector. In the lentiCRISPRv2 vector, the CAAA sequence is usually located behind the gRNA sequence to help ensure the correct orientation of the cloned gRNA sequence in the vector. These sequences are very important in the design and synthesis of oligos because they ensure the correct cloning and expression of the gRNA, so that the CRISPR-Cas9 system can effectively target and edit specific DNA sequences.

[0054] Table 2 gRNA and its primers

[0055]

[0056]

[0057] The examples also disclose a method for synthesizing the above RNA. The method includes preparing an annealing reaction solution, treating the annealing reaction solution at 37 °C for 30 min, treating it at 95 °C for 5 min, and allowing it to cool naturally, thereby obtaining the RNAs shown in SEQ ID NO: 5-8 respectively. Among them, the annealing reaction solution contains 2 μL of 10× annealing buffer (Invitrogen), 5 μL of any one of 100 μM F1-F4, 5 μL of any one of 100 μM R1-F4, and the balance of ddH2O, with a total volume of 20 μL.

[0058] To facilitate the introduction of the RNA and Cas9 ribozyme into breast cancer cells, the examples also provide a recombinant lentiviral vector. The recombinant lentiviral vector is the lenti-CRISPRv2 plasmid (Addgene, #52961) carrying the nucleotide sequence shown in any one of SEQ ID NO: 5-8.

[0059] The examples also disclose a method for preparing the recombinant lentiviral vector. The method includes: obtaining a linearized lenti-CRISPRv2 fragment; ligating the annealing product obtained by the above method with the linearized lenti-CRISPRv2 fragment to obtain a recombinant fragment; transferring the recombinant fragment into Escherichia coli; screening positive clones from the culture of the transformants; and extracting the recombinant lentiviral vector from the culture of the positive clones.

[0060] In some examples, the step of obtaining the linearized lenti-CRISPRv2 fragment includes: preparing a plasmid digestion reaction solution, digesting the plasmid digestion reaction solution at 37 °C for 30 min, and recovering the target fragment of 12.8 kb by agarose gel electrophoresis from the digested solution. Among them, the plasmid digestion reaction solution contains 5 μg of lenti-CRISPRv2, 3 μL of FastDigest BsmBI, 2 μL of 10× FastDigest Buffer, 0.6 μL of 100 mM DTT (freshly prepared), and the balance of water, with a total volume of 60 μL.

[0061] In some examples, the step of ligating the annealing product obtained by the above method with the linearized lenti-CRISPRv2 fragment to obtain a recombinant fragment includes: preparing a ligation reaction solution, and reacting the ligation reaction solution at 16 °C for 1 h. Among them, the ligation reaction solution contains 2 μL (100-200 ng) of the primer annealing product, 1 μL (50-100 ng) of the linearized lenti-CRISPRv2 fragment, 1 μL of 10× T4 DNA Ligation Buffer, 2 μL of T4 DNA ligase, and the balance of water, with a total volume of 10 μL.

[0062] The recombinant lentiviral vector obtained by the above method, when transfected into cells, can synthesize recombinant lentivirus carrying the nucleotide sequence shown in any one of SEQ ID NO: 5-8 and the Cas9 coding sequence in vivo.

[0063] Based on this, the embodiment also discloses a method for preparing recombinant lentivirus carrying the nucleotide sequence shown in any one of SEQ ID NO: 5-8 and the Cas9 coding sequence. The method includes: co-transfecting HEK293T cells with the recombinant lentiviral vector, PSPAX2 plasmid and PMD2.G plasmid, and harvesting the recombinant lentivirus from the culture of the transformant.

[0064] In some embodiments, the method for preparing recombinant lentivirus carrying the nucleotide sequence shown in any one of SEQ ID NO: 5-8 and the Cas9 coding sequence specifically includes:

[0065] 1) Seed 4×10 6 HEK293T cells in a 10 cm dish and grow to 70%-90% confluence;

[0066] 2) Mix 12 μg of recombinant Lenti-CRISPR-V2, 8 μg of PSPAX2 and 4 μg of PMD2.G and add them to 1.5 mL of Opti-MEM to obtain a plasmid dilution;

[0067] 3) Add 60 μL of Lipo-2000 to 1.5 mL of Opti-MEM and incubate at room temperature for 5 min to obtain a Lipo-2000 dilution;

[0068] 4) Mix the plasmid dilution and the Lipo-2000 dilution and incubate at room temperature for 20 min to obtain a complex formed by full binding of the plasmid and Lipo-2000.

[0069] 5) Remove the medium from the 10 cm dish, add the plasmid-liposome complex dropwise to the dish, gently shake the dish to evenly distribute the complex on the cell surface, add an appropriate amount of complete medium to 10 mL, and return it to the incubator for continued culture.

[0070] 6) At 48 - 72 hours after transfection, collect the supernatant containing virus particles. Transfer the supernatant to a sterile centrifuge tube, centrifuge at 3000 rpm for 10 - 15 min to remove cell debris. If a higher titer of virus is required, virus concentration can be performed. Common methods include ultracentrifugation, PEG precipitation method, etc. For example, when using the PEG 8000 precipitation method, add PEG 8000 with a final concentration of 8% - 10% and 0.5 M NaCl to the supernatant, incubate overnight at 4°C or for at least 2 - 4 hours. Then centrifuge at 4000 rpm for 30 - 60 minutes, discard the supernatant, and resuspend the precipitate with an appropriate amount of PBS to obtain the concentrated virus solution.

[0071] 7) The collected virus solution needs to be assayed for its titer. Common methods include fluorescence quantitative method (for lentiviruses with fluorescent labels), TCID 50 method, etc., to determine the infectivity of the virus and the amount of virus required for subsequent experiments.

[0072] Through the above - mentioned examples, recombinant lentiviruses carrying the nucleotide sequences shown in any one of SEQ ID NO:5 - 8 and the Cas9 coding sequence were obtained. Transferring the recombinant lentiviruses into breast cancer cells can result in breast cancer cells with CKAP4 knockout or expression inhibition.

[0073] Therefore, the examples disclose a method for preparing breast cancer cells with CKAP4 knockout or expression inhibition. The method includes: obtaining breast cancer cells and recombinant lentiviruses carrying the nucleotide sequences shown in any one of SEQ ID NO:5 - 8 and the Cas9 coding sequence; mixing and transfecting the recombinant lentivirus solution with the culture medium of breast cancer cells, culturing the transfected solution, and screening for breast cancer cells with CKAP4 knockout or expression inhibition.

[0074] In some examples, the method for preparing breast cancer cells with CKAP4 knockout or expression inhibition specifically includes:

[0075] 1) One day before transfection, digest breast cancer cells in the logarithmic growth phase with trypsin and inoculate them into a cell culture plate at an appropriate density. For example, for a 24 - well plate, inoculate about 2 - 5×10 4 cells per well, add an appropriate amount of complete medium to make the cells reach a confluence of 30% - 50% at the time of transfection, and then place the culture plate back into the incubator for continued culture.

[0076] 2) With an MOI of 10, and 5×10 4 cells per well, and a lentivirus titer of 1×10 8 TU / mL, then 5 μL of the lentivirus stock solution needs to be added to each well, and then dilute it to 200 μL with serum - free medium.

[0077] 3) Add 1 - 2 μL of 8 mg / mL polybrene solution to 200 μL of the virus dilution, gently mix well, and incubate at room temperature for 15 - 30 minutes, which can improve the infection efficiency of lentivirus.

[0078] 4) Aspirate the original culture medium in the cell culture plate, gently wash the cells once with PBS, then add the virus dilution containing polybrene to the cell culture wells, and gently shake the culture plate to evenly distribute the virus solution. Return the culture plate to the incubator for continued culture.

[0079] 5) After 12 - 24 hours of transfection, aspirate the culture medium containing the virus, add an appropriate amount of fresh complete culture medium, and continue to culture the cells to reduce the toxicity of the virus and polybrene to the cells.

[0080] 6) After 48 hours of infection, add puromycin for screening to kill the cells that have not been successfully infected. The successfully infected cells will survive, and puromycin needs to be added to the subsequent culture medium all the time.

[0081] 7) After 2 days of puromycin screening, WB or Real - time PCR can be used to verify the knockdown or knockout of CKAP4. Among them, the detection methods of WB or Real - time PCR are the same as those in the above - mentioned examples.

[0082] In some examples, the recombinant lentivirus of RNA shown in any one of SEQ ID NO:5 - 8 and the Cas9 coding sequence was transfected into MDA - MB - 231 cells, and MDA - MB - 231 cells with CKAP4 knockdown were obtained. RT - PCR and Western blot were used to detect the expression level of CKAP4 mRNA and CKAP4 protein in MDA - MB - 231 cells with CKAP4 knockdown, and the detection steps were the same as those in the above - mentioned test examples. As Figure 4 shown, the recombinant lentivirus of RNA shown in any one of SEQ ID NO:5 - 8 and the Cas9 coding sequence significantly reduced the expression levels of CKAP4 mRNA and CKAP4 protein in MDA - MB - 231 cells compared with the control group.

[0083] Targeted interference with CKAP4 expression

[0084] In addition, the examples also provided a method based on interfering RNA to inhibit the expression of CKAP4 in breast cancer cells. For this purpose, the examples also provided double - stranded RNA interfering with CKAP4. In these examples, these double - stranded RNAs can be synthesized by chemical or biological methods.

[0085] Among them, the sense strand of double - stranded RNA1 interfering with CKAP4 is:

[0086] 5’-CAGCUGAAGAGGAGUGUGGGUUCAAGAGA-3’, SEQ ID NO:17, the antisense strand is: 5’-CCCACACUCUCCUUCAGCUG-3’, SEQ ID NO:18.

[0087] The sense strand of double-stranded RNA2 interfering with CKAP4 is:

[0088] 5’-GCAUCGUCAAGAGGAGUACAUUUCAAGAGA-3’, SEQ ID NO:19, the antisense strand is: 5’-AUGUACUCCUCUUGACGAUGC-3’, SEQ ID NO:20.

[0089] Based on this, the embodiment also provides a method for inhibiting the expression of CKAP4 in breast cancer cells. The method includes: mixing the double-stranded RNA interfering with CKAP4 with a transfection reagent to form a complex of double-stranded RNA and transfection reagent; co-culturing the complex with breast cancer cells; harvesting and screening positive cells from the co-culture, and the positive cells are the breast cancer cells with inhibited CKAP4.

[0090] In some embodiments, the method for inhibiting the expression of CKAP4 in breast cancer cells specifically includes:

[0091] 1) Chemically synthesize the above double-stranded RNA interfering with CKAP4 and dissolve it in RNase-free water to 20 μM.

[0092] 2) Seed HCC1806 cells or MDA-MB-231 cells in the logarithmic growth phase at an appropriate density (such as 2×10 5 cells / well) in a 6-well plate, add 2 ml of complete medium to each well, and culture in an incubator for 24 h to allow the cells to adhere and reach a confluence of 30%-50%.

[0093] 3) Preparation of transfection complex: Operate according to the instructions of Lipofectamine RNAiMAX transfection reagent. In a sterile centrifuge tube, dilute 50 pmol of double-stranded RNA and 5 μL of transfection reagent to 100 μL with Opti-MEM medium respectively, mix gently, and incubate at room temperature for 5 min. Then mix the diluted double-stranded RNA and transfection reagent, mix gently, and incubate at room temperature for 20 min to form a complex of double-stranded RNA and transfection reagent.

[0094] 4) Cell transfection: Aspirate the original culture medium in the 6-well plate, and add 800 μL of Opti-MEM medium to each well. Then, dropwise add the complex of double-stranded RNA and transfection reagent into the cell culture wells, gently shake the culture plate to evenly distribute the complex. Place the culture plate back into the incubator and continue culturing for 4 - 6 h, then replace it with complete medium and continue culturing. Screen positive cells from the culture, and the positive cells are breast cancer cells with inhibited CKAP4 expression.

[0095] The embodiment also provides a lentiviral vector carrying the above interfering RNA, and CKAP4 is interfered with using this vector as a mediator. Based on this, the embodiment also provides a recombinant lentiviral vector. This recombinant lentiviral vector is the GV493 plasmid (GeneChem) carrying the nucleotide sequence shown in any one of SEQ ID NO: 17 - 20.

[0096] The embodiment also discloses a method for preparing this recombinant lentiviral vector. The method includes: obtaining a linearized GV493 fragment; ligating a DNA molecule shown in any one of SEQ ID NO: 17 - 20 with the linearized GV493 fragment to obtain a recombinant fragment; transferring the recombinant fragment into Escherichia coli; screening positive clones from the culture of the transformants; and extracting the recombinant lentiviral vector from the culture of the positive clones.

[0097] In some embodiments, the step of obtaining the linearized GV493 fragment includes: preparing a plasmid digestion reaction solution, digesting the plasmid digestion reaction solution at 37 °C for 3 h, and performing agarose gel recovery of the target fragment on the digested solution. Among them, the plasmid digestion reaction solution contains 2 μg of lenti-CRISPRv2, 1 μL of 10 U / μL AgeI, 1 μL of 10 U / μL EcoRI, 5 μL of 10×CutSmart Buffer, and the balance of water in a volume of 50 μL.

[0098] In some embodiments, the step of ligating a DNA molecule shown in any one of SEQ ID NO: 17 - 20 with the linearized GV493 fragment to obtain a recombinant fragment includes: preparing a ligation reaction solution, and reacting the ligation reaction solution at 16 °C for 1 h. Among them, the ligation reaction solution contains 100 ng of the linearized GV493 fragment, 100 ng of a DNA molecule shown in any one of SEQ ID NO: 17 - 20, 2 μL of 10×T4 DNA Ligation Buffer, 1 μL of T4 DNA ligase, and the balance of water in a volume of 20 μL.

[0099] Based on the recombinant lentiviral vector obtained by the above method, when it is transfected into cells, it can synthesize recombinant lentivirus carrying the nucleotide sequence shown in any one of SEQ ID NO: 17 - 20 in vivo.

[0100] In some embodiments, the method for preparing a recombinant lentivirus carrying any one of the nucleotide sequences of SEQ ID NOs: 17 to 20 specifically includes:

[0101] 1) Seed 4×10 6 HEK293T cells in a 10 cm dish and grow them to 70%-90% confluence;

[0102] 2) Mix 20 μg of a recombinant lentiviral vector carrying any one of the nucleotide sequences of SEQ ID NOs: 17 to 20, 15 μg of pHelper1.0, and 10 μg of pHelper2.0 and add them to 1.5 mL of Opti-MEM to obtain a plasmid dilution;

[0103] 3) Add 60 μL of Lipo-2000 to 1.5 mL of Opti-MEM and incubate at room temperature for 5 min to obtain a Lipo-2000 dilution;

[0104] 4) Mix the plasmid dilution and the Lipo-2000 dilution and incubate at room temperature for 20 min to obtain a complex formed by sufficient binding of the plasmid and Lipo-2000.

[0105] 5) Remove the medium from the 10 cm dish, add the plasmid-liposome complex dropwise to the dish, gently shake the dish to evenly distribute the complex on the cell surface, add an appropriate amount of complete medium to 10 mL, and return it to the incubator for continued culture.

[0106] 6) 48 - 72 hours after transfection, collect the supernatant containing virus particles. Transfer the supernatant to a sterile centrifuge tube and centrifuge at 3000 rpm for 10 - 15 min to remove cell debris. If a higher titer of virus is required, virus concentration can be performed. Commonly used methods include ultracentrifugation, PEG precipitation, etc. For example, when using the PEG 8000 precipitation method, add PEG 8000 with a final concentration of 8% - 10% and 0.5 M NaCl to the supernatant, incubate at 4°C overnight or for at least 2 - 4 hours. Then centrifuge at 4000 rpm for 30 - 60 min, discard the supernatant, and resuspend the precipitate with an appropriate amount of PBS to obtain the concentrated virus solution.

[0107] 7) The collected virus solution needs to be assayed for its titer. Commonly used methods include fluorescence quantitative method (for lentiviruses with fluorescent labels), TCID 50 method, etc., to determine the infectivity of the virus and the amount of virus required for subsequent experiments.

[0108] Through the above embodiments, a recombinant lentivirus carrying any one of the nucleotide sequences of SEQ ID NOs: 17 to 20 is obtained. Transferring the recombinant lentivirus into breast cancer cells can obtain breast cancer cells with inhibited CKAP4 expression.

[0109] To this end, the embodiments disclose a method for preparing breast cancer cells with inhibited CKAP4 expression. The method includes: obtaining breast cancer cells and a recombinant lentivirus carrying any one of the nucleotide sequences of SEQ ID NO: 17-20; mixing and transfecting the recombinant lentivirus solution with the culture medium of breast cancer cells, culturing the transfected solution, and screening for breast cancer cells with inhibited CKAP4 expression.

[0110] In some embodiments, the method for preparing breast cancer cells with inhibited CKAP4 expression specifically includes:

[0111] 1) One day before transfection, digest breast cancer cells in the logarithmic growth phase with trypsin and inoculate them into a cell culture plate at an appropriate density. For example, for a 24-well plate, inoculate about 2-5×10 4 cells per well, add an appropriate amount of complete medium to make the cells reach a confluence of 30%-50% at the time of transfection, and then place the culture plate back into the incubator for continued culture.

[0112] 2) With an MOI of 10, 5×10 4 cells per well, and a lentivirus titer of 1×10 8 TU / mL, 5 μL of the lentivirus stock solution needs to be added to each well, and then it is diluted to 200 μL with serum-free medium.

[0113] 3) Add 1-2 μL of an 8 mg / mL polybrene solution to the 200 μL of virus dilution, mix gently, and incubate at room temperature for 15-30 min to improve the infection efficiency of the lentivirus.

[0114] 4) Aspirate the original medium in the cell culture plate, gently wash the cells once with PBS, and then add the virus dilution containing polybrene to the cell culture wells, gently shake the culture plate to evenly distribute the virus solution. Place the culture plate back into the incubator for continued culture.

[0115] 5) 12-24 hours after transfection, aspirate the medium containing the virus, add an appropriate amount of fresh complete medium, and continue to culture the cells to reduce the toxicity of the virus and polybrene to the cells.

[0116] 6) After 48 h of infection, add puromycin for screening to kill the cells that have not been successfully infected, and the cells that have been successfully infected will survive. Puromycin needs to be added to the subsequent medium all the time.

[0117] 7) After 2 days of puromycin screening, WB or Real-time PCR can be used to verify the knockdown or reduction of CKAP4. Among them, the detection methods of WB or Real-time PCR are the same as those in the above embodiments.

[0118] As Figure 5 shown, the expression level of CKAP4 decreased in breast cancer cells with CKAP4 expression inhibited.

[0119] Targeted inhibition of CKAP4 and subsequent inhibition of breast cancer cell proliferation

[0120] In some test cases, the SRB staining method and EdU staining method were used to test the proliferation of HCC1806 cells with CKAP4 expression inhibited and breast cancer cells with CKAP4 expression inhibited.

[0121] As Figure 6 shown, the proliferation ability of HCC1806 cells with CKAP4 expression inhibited was significantly decreased compared with that of HCC1806 cells without CKAP4 expression inhibition, and the proliferation ability of MDA-MB-231 cells with CKAP4 expression inhibited was significantly decreased compared with that of MDA-MB-231 cells without CKAP4 expression inhibition. This indicates that targeted inhibition of CKAP4 can inhibit the proliferation of breast cancer cells. Knock out of CKAP4 arrests breast cancer cells in the G1 phase

[0122] In some test cases, flow cytometry and WB were used to detect the cell cycle of HCC1806 cells with CKAP4 expression inhibited and MDA-MB-231 cells with CKAP4 expression inhibited. Among them, the primary antibody for detecting the expression level of CDK4 protein by WB was purchased from Cell Signaling, with the product number 12790 and the dilution ratio 1:1000. The primary antibody for detecting the expression level of CDK6 protein by WB was purchased from Cell Signaling, with the product number 3136 and the dilution ratio 1:1000. The primary antibody for detecting the expression level of CyclinD1 protein by WB was purchased from Cell Signaling, with the product number 2978 and the dilution ratio 1:1000. The primary antibody for detecting the expression level of CyclinB1 protein by WB was purchased from Cell Signaling, with the product number 4138 and the dilution ratio 1:1000. The primary antibody for detecting the expression level of β-actin protein by WB was purchased from Cell Signaling, with the product number 4970 and the dilution ratio 1:1000.

[0123] As Figure 7 shown, the number of cells in the G1 phase and G2 / M phase of HCC1806 cells with CKAP4 expression inhibited increased compared with that of HCC1806 cells without CKAP4 expression inhibition, and the total number of cells in the S phase decreased. The number of cells in the G1 phase and G2 / M phase of MDA-MB-231 cells with CKAP4 expression inhibited increased compared with that of MDA-MB-231 cells without CKAP4 expression inhibition, and the total number of cells in the S phase decreased.

[0124] As Figure 8As shown, the protein expression levels of CDK4, CDK6, Cyclin D1, and Cyclin B1 in CKAP4 expression-suppressed HCC1806 cells were downregulated compared to those in non-CKAP4 expression-suppressed HCC1806 cells. The protein expression levels of CDK4, CDK6, Cyclin D1, and Cyclin B1 in CKAP4 expression-suppressed MDA-MB-231 cells were downregulated compared to those in non-CKAP4 expression-suppressed MDA-MB-231 cells.

[0125] CDK4 is a key kinase in cell cycle regulation, which binds to Cyclin D1 to promote the G1 / S phase transition. CDK6 binds to Cyclin D and regulates the progression of the G1 phase of the cell cycle. Cyclin D1 is a key regulatory protein in the G1 phase, which binds to CDK4 / 6 to promote cell cycle progression. Cyclin B1 binds to CDK1 and regulates the G2 / M phase transition. This indicates that CKAP4 expression-suppressed breast cancer cells are arrested in the G1 phase.

[0126] Knockout of CKAP4 promotes apoptosis of breast cancer cells

[0127] In some test cases, flow cytometry was used to detect the apoptosis of CKAP4 expression-suppressed HCC1806 cells and CKAP4 expression-suppressed MDA-MB-231 cells.

[0128] As Figure 9 shown, the proportion of cell death and apoptosis in CKAP4 expression-suppressed HCC1806 cells was increased compared to that in non-CKAP4 expression-suppressed HCC1806 cells. The proportion of cell death and apoptosis in CKAP4 expression-suppressed MDA-MB-231 cells was increased compared to that in non-CKAP4 expression-suppressed MDA-MB-231 cells.

[0129] This indicates that knocking out CKAP4 promotes apoptosis of breast cancer cells.

[0130] Knockout of CKAP4 and subsequent inhibition of breast cancer cell migration

[0131] In some test cases, a cell scratch assay was used to detect the migration of CKAP4 expression-suppressed HCC1806 cells and CKAP4 expression-suppressed MDA-MB-231 cells.

[0132] As Figure 10As shown, the cell migration rates of HCC1806 cells with CKAP4 expression inhibited at 24 h, 48 h, and 72 h were all decreased compared with those of HCC1806 cells without CKAP4 expression inhibition. The cell migration rates of MDA-MB-231 cells with CKAP4 expression inhibited at 24 h, 48 h, and 72 h were all decreased compared with those of MDA-MB-231 cells without CKAP4 expression inhibition. This indicates that knocking out CKAP4 can inhibit the migration of breast cancer cells.

[0133] Knockout of CKAP4 and subsequent inhibition of breast cancer cell invasion

[0134] In some test cases, the invasion of HCC1806 cells with CKAP4 expression inhibited and MDA-MB-231 cells with CKAP4 expression inhibited was detected by Transwell assay.

[0135] As Figure 11 shown, the number of invasive cells of HCC1806 cells with CKAP4 expression inhibited was decreased compared with that of HCC1806 cells without CKAP4 expression inhibition. The number of invasive cells of MDA-MB-231 cells with CKAP4 expression inhibited was decreased compared with that of MDA-MB-231 cells without CKAP4 expression inhibition. This indicates that knocking out CKAP4 can inhibit the invasion of breast cancer cells. Knockout of CKAP4 and subsequent inhibition of the proliferation of xenografts in vivo

[0136] In some test cases, HCC1806 cells with CKAP4 expression inhibited and MDA-MB-231 cells with CKAP4 expression inhibited were injected into the transplanted tumors of breast cancer model mice to test the proliferation of the transplanted tumors. Specifically as follows:

[0137] Six-week-old female BALB / c nude mice (Beijing) were raised under specific pathogen-free (SPF) conditions. All animal experiments were approved by the Animal Ethics Committee. As Figure 12 shown in A, 1×10 6 CKAP4-knockout HCC1806 breast cancer cells or MDA-MB-231 cells with CKAP4 expression inhibited were subcutaneously injected into the mammary fat pads of nude mice, and the size of subcutaneous tumors was observed every 4 days. The growth of tumors was dynamically observed with a vernier caliper, and the calculation formula was volume = 1 / 2 (width² × length), and breast cancer model mice (shCKAP4-1 group and shCKAP4-2 group) were obtained. And 1×10 6 HCC1806 breast cancer cells or MDA-MB-231 cells were used as the control group (Ctrl). After observing for 22 days, at the end of the observation, euthanasia was performed by rapid cervical dislocation. The tumors were excised and weighed. The tumor tissues were taken, dehydrated, embedded, sectioned, and stained with HE to observe the histological morphology and immunohistochemical analysis. The specific method was the same as described above.

[0138] As Figure 12 B, Figure 12 C and Figure 12 D shown, compared with the control group, the tumor growth rates of the shCKAP4-1 group and the shCKAP4-2 group were significantly slowed down, and the volumes and weights of the transplanted tumors were significantly decreased. As Figure 12 E shown, the number of Ki-67 positive cells, a cell proliferation protein, in the xenograft tumors of the shCKAP4-1 group and the shCKAP4-2 group was less than that of the control group. This indicates that CKAP4 knockdown effectively inhibits the growth of breast cancer tumors in vivo.

[0139] As described above, only the preferred specific embodiments of the present application are provided, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope disclosed in the present application should be covered by the protection scope of the present application.

Claims

1. An RNA targeting CKAP4, whose nucleotide sequence is as shown in any one of SEQ ID NO: 5-8 or as shown in any one of SEQ ID NO: 17-20.

2. A primer set, whose nucleotide sequence is as shown in SEQ ID NO: 9 and 10, or as shown in SEQ ID NO: 11 and 12, or as shown in SEQ ID NO: 13 and 14, or as shown in SEQ ID NO: 15 and 16; Among them, The primer set of SEQ ID NO: 9 and 10 can obtain an RNA containing the sequence shown in SEQ ID NO: 5 after annealing; the primer set of SEQ ID NO: 11 and 12 can obtain an RNA containing the sequence shown in SEQ ID NO: 6 after annealing; the primer set of SEQ ID NO: 13 and 14 can obtain an RNA containing the sequence shown in SEQ ID NO: 7 after annealing; the primer set of SEQ ID NO: 15 and 16 can obtain an RNA containing the sequence shown in SEQ ID NO: 8 after annealing.

3. A recombinant lentiviral vector, which is the lenti-CRISPRv2 plasmid carrying any one of the nucleotide sequences shown in SEQ ID NO: 5-8 or the lenti-CRISPRv2 plasmid carrying any one of the nucleotide sequences shown in SEQ ID NO: 17-20.

4. A method for preparing the recombinant lentiviral vector as described in claim 3, including: Obtaining a linearized lenti-CRISPRv2 fragment; Connecting the annealing product of the primer set as described in claim 2 with the linearized lenti-CRISPRv2 fragment to obtain a recombinant fragment; Transferring the recombinant fragment into Escherichia coli; Screening positive clones from the culture of the transformants; Extracting the recombinant lentiviral vector from the culture of the positive clones.

5. A method for preparing the recombinant lentiviral vector as described in claim 3, including: Obtaining a linearized GV493 fragment; Connecting a DNA molecule as shown in any one of SEQ ID NO: 17-20 with the linearized GV493 fragment to obtain a recombinant fragment; Transferring the recombinant fragment into Escherichia coli; Screening positive clones from the culture of the transformants; Extracting the recombinant lentiviral vector from the culture of the positive clones.

6. A recombinant lentivirus carrying any one of the nucleotide sequences shown in SEQ ID NO: 5-8 and the Cas9 coding sequence or a recombinant lentivirus carrying any one of the nucleotide sequences shown in SEQ ID NO: 17-20.

7. A method for preparing breast cancer cells with CKAP4 knockout or expression inhibition, including: Obtaining breast cancer cells and the recombinant lentivirus as described in claim 6; Mixing and transfecting the solution containing the recombinant lentivirus with the culture medium of breast cancer cells; Culturing the transfected solution; Screening breast cancer cells with CKAP4 knockout or expression inhibition.

8. A breast cancer drug, including the recombinant lentiviral vector as described in claim 3.

9. A breast cancer drug, including the recombinant lentivirus prepared by the method as described in claim 6.

10. Use of the RNA according to claim 1, the recombinant lentiviral vector according to claim 3, or the recombinant lentivirus according to claim 6 in the preparation of a drug for treating breast cancer.