Site for stably expressing protein in HEK293T cell gene NG027973.1 and application of site

Abstract

The invention discloses a site for stably expressing a protein in an HEK293T cell gene NG027973.1 and an application of the site for stably expressing the protein in the HEK293T cell gene NG027973.1. According to the present invention, the obtained stable expression site is located at the upstream 69 bp and the downstream 134bp of the 135153 base in the HEK293T cell gene NG027973.1, such that the 135084-135287 base can be integrated, and the stable expression can be performed; according to the invention, a target gene is integrated to a stable expression region in a site-specific integration manner. The site information provided by the invention is clear, site-specific integration of foreign protein genes can be realized at the site, the protein can be stably expressed, the screening process and time in the cell construction process can be greatly shortened, and the research and development cost can be reduced.

Description

Technical Field

[0001] The present invention belongs to the field of biopharmaceuticals, and particularly relates to a site for stably expressing a protein in the HEK293T cell gene NG_027973.1 and its application. Background Art

[0002] With the continuous expansion of the application field of biopharmaceuticals, from cancer treatment to the prevention and treatment of chronic diseases, the medical community's regulatory measures for biopharmaceuticals are becoming increasingly stringent. Currently, the expression systems commonly used in the biopharmaceutical industry include the Escherichia coli expression system, the yeast expression system, the insect cell expression system, and the mammalian cell expression system. However, when the first three expression systems post-translationally modify foreign proteins, there are certain differences from the natural proteins produced in the human body, which to a certain extent affects the effectiveness and safety of pharmaceutical proteins. In addition, the construction methods of existing engineered cell lines mostly use random integration, which not only results in long-term unstable expression, but also affects the quality of foreign proteins and increases production costs.

[0003] The HEK293 (Human Embryonic Kidney 293) cell line has been approved by the FDA for the production of therapeutic proteins with high requirements for humanization. As a major branch of the HEK293 cell line, HEK293T cells are widely used in the expression of therapeutic proteins. Compared with the CHO cell expression system, its post-translational modification is closer to that of humans, and the activity and quality of the expressed therapeutic proteins are more superior. At present, the mode of harvesting products by transient transfection of HEK293T cells is difficult to meet the needs of industrial large-scale production, and it is necessary to construct a cell line with long-term stable expression. The traditional development of recombinant HEK293T cell lines (Cell line development, CLD) based on random integration is a multi-stage and time-consuming process. Positive clone strains must be obtained through multiple rounds of screening under pressure. The resulting positive clone cell bank will also show heterogeneity, and it is necessary to conduct expensive and laborious screening on the clone cell bank. The problem of long-term unstable expression of HEK293T cells caused by traditional application strategies has always restricted the industrial application of the HEK293T cell expression system. Integrating the target gene into a stable site in the HEK293T cell genome based on site-specific integration technology to construct an HEK293T cell line with efficient and stable recombinant protein expression is an effective way to solve the above problems.

[0004] Bushman proposed the concept of gene integration "safe harbours" sites in 2012. These are ideal integration sites within specific genomic regions that can not only ensure high and stable transcriptional ability but also do not interfere with the normal expression of other genes in the cell. When foreign genes are integrated into "safe harbours" sites, they do not interfere with the activity of endogenous gene expression, thereby avoiding metabolic and phenotypic changes. Currently, the three sites on the human genome considered to have the potential for gene integration "safe harbours" include the AAVS1 site, the CCR5 site, and the human ROSA26 homologous site. Although the above hotspots have shown relatively stable transgenic expression potential in human cell lines, it is still far from sufficient for constructing HEK293 engineering cells that stably express foreign proteins. Therefore, finding ideal integration sites remains the primary task for constructing HEK293T cell lines that stably express pharmaceutical proteins. Searching for integration sites in the HEK293T cell genome that are suitable for wide, high, and long-term stable expression is one of the research hotspots in the current biopharmaceutical field. Summary of the Invention

[0005] In view of the deficiencies of the prior art, the present invention provides a site for stable protein expression within the HEK293T cell gene NG_027973.1 and its application. The site information provided by the present invention is clear. At this site, site-directed integration of foreign protein genes can be achieved, and proteins can be stably expressed, which can greatly shorten the screening process and time during cell construction and reduce R & D costs.

[0006] The technical solution of the present invention is as follows:

[0007] The first object of the present invention is to provide a site for stable protein expression within the HEK293T cell genome, and the site for stable protein expression is located within 69 bp upstream and 134 bp downstream of the 135153rd base of the HEK293 cell gene NG_027973.1.

[0008] Furthermore, the site for stable protein expression is located within the 135084-135287 bases of the HEK293T cell gene NG_027973.1; the nucleotide sequence of the 135084-135287 bases of the HEK293T cell gene NG_027973.1 is as shown in SEQ ID NO.1.

[0009] Furthermore, when using the CRISPR / Cas9 technology to site-directedly transfer the coding gene of the target protein, the site for stable protein expression can be recognized by the target sequence of 5'NNNNNNNNNNNNNNNNNNNNNGG 3' of the CRISPR / Cas9 technology.

[0010] In the present invention, this locus is located at the 12th intron of the TRAF3 gene on the HEK293T cell genome NG_027973.1.

[0011] Furthermore, in the embodiments of the present invention, the following 6 groups of sequences were selected for the 5'NNNNNNNNNNNNNNNNNNNNNGG 3' sequence:

[0012] 5’-CCACAAGCCGCGCCCACAATTGG-3’、

[0013] 5’-ACAGCTTGGTGGGTGCCCGGTGG-3’、

[0014] 5’-TCTGGTGCTGCCATCTGTCCTGG-3’、

[0015] 5’-CGCGGCCACGGGGAGAGCCGAGG-3’、

[0016] 5’-GCTGTCCCCGCGCGGCCACGGGG-3’、

[0017] 5’-CACGGGAGCTCAGGGCACAGGGG-3’。

[0018] In the present invention, the above 6 groups of sequences cover most of the upstream, middle, and downstream sequences within 204 bases of the present invention within 69 bp upstream and 134 bp downstream of the 135153rd base of the HEK293T cell gene NG_027973.1, indicating that all 204 bases of the present invention can be used as sites for stable protein expression.

[0019] The present invention does not limit the above 6 groups of sequences. The above 6 groups of sequences are only used as preferred technical means to introduce the coding gene of the target protein into the above stable expression site through the CRISPR-Cas9 technology. When using other sequences or even other means of introducing the target gene, the object of stable expression of foreign proteins in the present invention can still be achieved.

[0020] Furthermore, the protein is a protein with a molecular weight less than 160 KDa.

[0021] Furthermore, the protein is one of a polypeptide, a functional protein, an antibody, and a fusion protein.

[0022] The second object of the present invention is to provide a HEK293T fluorescent platform cell for rapid site-directed integration of a target gene. The HEK293T fluorescent platform cell line contains EGFP, the Bxb1 recombinase recognition site attP, and a promoter trap.

[0023] Furthermore, the one containing EGFP and the Bxb1 recombinase recognition site attP is obtained by transferring a recombinant donor vector into the HEK293T fluorescence platform cell line; the recombinant donor vector contains the phage attachment site (attP) recognized by the large serine recombinase (Bxb1), and the attP is located in the region between the 5'-homologous arm and the 3'-homologous arm of the recombinant donor vector; the large serine recombinase (Bxb1) expression cassette is located between two phage attachment sites attP, and a resistance screening gene expression cassette and a fluorescent protein gene expression cassette are also included between the two phage attachment sites (attP).

[0024] Furthermore, the attP sequence is located in the region between the 5'-homologous arm and the 3'-homologous arm on the recombinant donor vector; the promoter of the resistance screening gene expression cassette is located between the 5'-homologous arm and the 5'-terminal attP sequence; the promoter of the fluorescent protein gene expression cassette is located downstream of the resistance gene expression cassette; the 5'-homologous arm and the 3'-homologous arm are sequences with a length of 600 bp upstream and downstream of the site where the protein is stably expressed, respectively.

[0025] Furthermore, the HEK293T fluorescence platform cells are obtained by transferring the recombinant donor vector, the sgRNA plasmid corresponding to the target sequence, and the Cas9 plasmid into HEK293T cells.

[0026] Furthermore, the target sequence is preferably: 5'-CCACAAGCCGCGCCCACAATTGG-3', 5'-ACAGCTTGGTGGGTGCCCGGTGG-3', 5'-TCTGGTGCTGCCATCTGTCCTGG-3', 5'-CGCGGCCACGGGGAGAGCCGAGG-3', 5'-GCTGTCCCCGCGCGGCCACGGGG-3', 5'-CACGGGAGCTCAGGGCACAGGGG-3'.

[0027] Furthermore, the HEK293T fluorescence platform cell line is obtained by integrating the expression cassette (CMV Promoter -attP-Puro-SV40 Promoter -EGFP-attP) into the site where the protein is stably expressed in the HEK293T cell gene NG_027973.1 by using the CRISPR / Cas9 technology.

[0028] In the present invention, a method for constructing the fluorescence platform cell line of the recombinant HEK293T cells is also provided, including the following steps:

[0029] (1) Transfect the plasmid vector into HEK293T cells by liposome transfection to obtain a recombinant HEK293T cell pool;

[0030] Among them, the plasmid vectors are respectively the expression vector for integrative expression of EGFP in HEK293T cells for later RMCE, the sgRNA plasmid corresponding to the target sequence, and the Cas9 plasmid;

[0031] (2) Screen the cell pool with antibiotics to obtain HEK293T recombinant cells expressing the resistance gene;

[0032] (3) Adhere and culture the HEK293T recombinant cells, detect the expression level of the protein, and perform suspension acclimation on the adherent HEK293T cells expressing EGFP;

[0033] (4) Culture and verify the stability of the suspension-acclimated HEK293T recombinant cells, and detect the expression level of EGFP.

[0034] The third object of the present invention is to provide an application of the site for stable expression of a protein in the HEK293T cell gene NG_027973.1 in the stable expression of an exogenous protein or polypeptide in HEK293T cells.

[0035] Furthermore, the coding gene of the exogenous protein is constructed at the site for stable expression of the protein in the HEK293T cell NG_027973.1, and the coding gene of the exogenous protein is rapidly and accurately integrated by combining the promoter trap technology and the RMCE technology.

[0036] The fourth object of the present invention is to provide a recombinant expression vector for rapidly constructing a stable expression of an exogenous protein in HEK293T cells, and the coding gene of the protein is located between two bacterial attachment sites (attB) of the recombinant expression vector.

[0037] In the present invention, the recombinant expression vector is a vector suitable for expression in HEK293T cells.

[0038] Furthermore, the recombinant expression vector contains a large serine recombinase (Bxb1) expression cassette, a promoterless resistance gene expression cassette and a target gene expression cassette located between two bacterial attachment sites (attB) recognized by the large serine recombinase (Bxb1) expression cassette.

[0039] Furthermore, the recombinant expression vector also includes a promoter sequence located upstream of the coding gene of the protein, and the promoter controls the expression of the protein.

[0040] Further, the promoter is one of CMV (a strong mammalian expression promoter derived from human cytomegalovirus), EF-1α (a strong mammalian expression promoter derived from human elongation factor 1α), SV40 (a mammalian expression promoter derived from simian vacuolating virus 40), PGK1 (a mammalian promoter derived from the phosphoglycerate kinase gene), UBC (a mammalian promoter derived from the human ubiquitin C gene), human beta actin (a mammalian promoter derived from the β-actin gene), and CAG (a strong hybrid mammalian promoter).

[0041] In the present invention, there is also provided a method for constructing an expression vector for expressing a protein in HEK293T cells, including the following steps: inserting the coding gene of the protein into the region between two bacterial attachment sites (attB) of the plasmid, so that the coding gene of the protein is located between the recombinase recognition sites and both are located downstream of the promoter to form a promoter trap, thereby obtaining the expression vector for expressing the protein in HEK293T cells.

[0042] The beneficial technical effects of the present invention are as follows:

[0043] The stable expression site obtained in the present invention is within 69 bp upstream and 134 bp downstream of the 135,153rd base of the HEK293T cell gene NG_027973.1, and can integrate foreign protein genes and express them stably. The present invention integrates the target gene into the stable expression region by site-directed integration, constructs a platform cell for inserting foreign genes, and provides a method and strategy for the rapid and efficient integration of foreign genes. By designing the expression vector and introducing the promoter trap technology, the present invention solves the potential off-target problems that may occur in other integration methods. By site-directed integration of foreign genes within 69 bp upstream and 134 bp downstream of the 135,153rd base of the stable expression site NG_027973.1 in the HEK293T genome, the present invention overcomes the expression instability caused by the position effect and the repeated and cumbersome cell line screening process, greatly shortening the original screening time of 6 - 12 months to 2 - 4 weeks, and effectively solving the problems of long R & D time and high cost in constructing stable expression cell lines. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 It is a schematic diagram of site-directed integration of the present invention.

[0045] In the figure: A is a schematic diagram of site-specific integration of EGFP and the landing pad "attP" sequence; B is a schematic diagram of site-specific integration of foreign proteins by RMCE.

[0046] Figure 2This is the plasmid map of pEGFP-HSA of the present invention.

[0047] Figure 3 This is the plasmid map of PUC57-attp-EGFP of the present invention.

[0048] Figure 4 This is the plasmid map of PUC57-Bxb1-attB-IFNβ-HSA of the present invention.

[0049] Figure 5 This shows the expression of EGFP in the expression cell lines constructed with different target sequences of the present invention at different passages.

[0050] Figure 6 This shows the expression of IFNβ-HSA in the expression cell lines constructed with different target sequences of the present invention at different passages. Detailed implementation manners

[0051] The present invention will be specifically described below in conjunction with the accompanying drawings and examples.

[0052] Detection methods involved:

[0053] Method for measuring the average fluorescence intensity of cells: Culture the cells until the confluence reaches about 90%, digest the cells with 0.25% trypsin, and terminate the digestion with a complete medium equal in amount to the trypsin. Collect the cells in a sterile centrifuge tube, centrifuge at 1000 rpm / min for 5 min, discard the supernatant, resuspend with PBS, collect through a cell filter into a flow cytometry sample tube, and analyze the fluorescence intensity of the cells using blank HEK293T cells as a negative control with a flow cytometer.

[0054] The pEGFP-HSA plasmid in the present invention was constructed and preserved by the research group in the early stage. The plasmid map is as Figure 2 shown. Those skilled in the art can construct it according to the plasmid map information by using conventional technical means, or can entrust a commercial company to construct it.

[0055] In the nucleotide sequences involved in the present invention, N represents any one of A, C, G or T, and V represents any one of A, C or G.

[0056] Example 1: Screening of stable expression sites

[0057] (1) Sorting of potential stable site cell lines expressing EGFP

[0058] By transfecting the plasmid containing the fusion protein gene (HSA-EGFP), which was constructed and preserved by the research group in the early stage (as Figure 2)。Previously, HEK293T cells expressing the HSA-EGFP fusion protein were constructed by transfecting the pEGFP-HSA plasmid, and cells that could emit green fluorescence were sorted by flow cytometry.

[0059] (2) Expression of green fluorescent protein during subculture

[0060] The sorted cells above were collected into a 12-well plate and expanded into a T25 culture flask after growing to confluence to form a cell pool initially expressing EGFP. Without adding any screening pressure, the cells were continuously cultured for 70 passages. During subculture, due to position effects caused by random integration, etc., the level of EGFP expression in the recombinant cells gradually decreased, and the proportion of fluorescent cells gradually decreased.

[0061] During cell subculture, a fluorescence inverted microscope was used to observe the fluorescence intensity. During cell subculture, strong fluorescence increased while weak fluorescence decreased, indicating that cells with unstable expression of green fluorescent protein may have weakened fluorescence during subculture due to fluctuations in gene expression or changes in post-transcriptional modification, easy loss of foreign genes, etc. Increasing the number of subcultures gradually screened out cells that could stably express green fluorescent protein for subsequent analysis of the sites stably expressing foreign genes.

[0062] The cells that still expressed green fluorescence after 70 passages without adding any screening pressure were potential platform cells with stable integration. Cells were sorted into a 96-well plate by flow cytometry to ensure that there was only one cell in each well.

[0063] After the cells collected in the 96-well plate grew to confluence, they were expanded into a 6-well plate. After culturing for 10 days, the fluorescence of the cells was analyzed by flow cytometry. Cells with a fluorescence proportion higher than 95% at this time were selected, indicating that this cell line could stably express the EGFP reporter gene, and at the same time indicating that the genomic integration site carrying the EGFP reporter gene was a stable expression site; genomic DNA was extracted for subsequent identification of integration sites.

[0064] Example 2: Analysis of integration sites

[0065] The TAIL-PCR technique was used to analyze the sites stably expressing proteins in HEK293T cells. Specifically as follows:

[0066] (1) Genomic DNA of the cell line stably expressing the EGFP reporter gene screened in Example 1 was extracted. Using the known EGFP nucleic acid sequence and with the help of the Genome Walking kit (TAIL-PCR technique), three rounds of thermal asymmetric interlaced PCR were carried out to analyze the unknown sequences near the integration site. The reaction conditions for TAIL-PCR are as follows:

[0067]

[0068] (2) Sequence the secondary TAIL-PCR products and align the obtained sequences with the genome of HEK293T cells in the NCBI database. Through alignment analysis, find the sites in the HEK293T cell genome that stably express foreign proteins, providing a basis for subsequent genetic engineering research.

[0069] (3) Sequencing and analysis

[0070] The flanking sequences of the foreign gene insertion sites of the monoclonal cell lines were amplified. After the secondary TAIL-PCR amplification reaction was completed, 1% agarose gel electrophoresis was performed. Select the brightest band that is not less than 500 bp, that is, the secondary TAIL-PCR band with the degenerate primer LAD-1 (5’-ACGATGGACTCCAGAGCGGCCGCVNVNNNGGAA-3’) added in the pre-amplification reaction. After cutting the gel and dissolving it, DNA sequencing was performed, and the results are as follows:

[0071] DNA sequencing results

[0072]

[0073]

[0074] The size of the sequenced flanking sequence is 693 bp, and through alignment analysis in the NCBI database, the results show that a site in the HEK293T cell genome that stably expresses the green fluorescent gene is randomly integrated into chromosome 14 (NG_027973.1, at the 135153rd base, within the 12th exon of the TRAF3 gene).

[0075] Example 3: Target sequence selection

[0076] According to the proximity principle, use the CCTOP CRISPR / Cas9 online prediction system to predict the sequence of 69 bp upstream and 134 bp downstream of the 135,153rd base of locus NG_027973.1: 5’-CCACAAGCCGCGCCCACAATTGGCCAGCTGGGCCGTGCACGTCAGACT GCCTGCCTCGGCTCTCCCCGTGGCCGCGCGGGGACAGCTTGGTGGGTGCCCGGTGGCCCACCTGTCTCTGGTGCTGCCATCTGTCCTGGGTGTGCCTTCGCCCCAGTGCCTGCTGGAAGTGCCCTCCGTCGCACCCCTGTGCCCTGAGCTCCCGTG-3’ (SEQ ID NO.1), and select the target sequences with higher editing efficiency.

[0077] The relevant parameter settings are as follows:

[0078] 1). The maximum number of mismatched bases allowed for the first 13 bp within the 20 bp sequence after NGG is 1;

[0079] 2). The number of mismatched bases for all 20 bp after NGG is 4.

[0080] The CCTOP CRISPR / Cas9 online prediction system will score the editing efficiency of the identified 5'NNNNNNNNNNNNNN NNNNNNNGG3' target sequences, LOW efficacy (score < 0.56); MEDIUM efficacy (0.56 <= score <= 0.74); HIGH efficacy (score > 0.74).

[0081] Select the sequences with a predicted editing efficiency higher than 0.56 as the target sequences.

[0082] Sequence number Target sequence score SEQ ID NO.2 5’-CCACAAGCCGCGCCCACAATTGG-3’ 0.80 SEQ ID NO.3 5’-ACAGCTTGGTGGGTGCCCGGTGG-3’ 0.82 SEQ ID NO.4 5’-TCTGGTGCTGCCATCTGTCCTGG-3’ 0.79 SEQ ID NO.5 5’-CGCGGCCACGGGGAGAGCCGAGG-3’ 0.88 SEQ ID NO.6 5’-GCTGTCCCCGCGCGGCCACGGGG-3’ 0.80 SEQ ID NO.7 5’-CACGGGAGCTCAGGGCACAGGGG-3’ 0.81

[0083] Example 4: Construction of EGFP platform cell line

[0084] Use the CRISPR / Cas9-mediated gene knockout technology and homologous recombination during the gene repair process after knockout to site-specifically integrate the green fluorescent protein gene (EGFP, 26.7KDa) at the target site. The CRISPR / Cas9-mediated homologous recombination technology requires the construction of an sgRNA plasmid and an EGFP recombinant donor plasmid. The construction process is as follows:

[0085] 1. Construction of sgRNA plasmid

[0086] 1) According to the target sequence selected in Example 3, synthesize an oligonucleotide chain.

[0087] SEQ ID NO.8 sgRNA-F1 5'TTTGCCACAAGCCGCGCCCACAATTGGT 3' SEQ ID NO.9 sgRNA-R1 5'TAAAACCAATTGTGGGCGCGGCTTGTGG 3' SEQ ID NO.10 sgRNA-F2 5'TTTGACAGCTTGGTGGGTGCCCGGTGGT 3' SEQ ID NO.11 sgRNA-R2 5'TAAAACCACCGGGCACCCACCAAGCTGT 3' SEQ ID NO.12 sgRNA-F3 5'TTTGTCTGGTGCTGCCATCTGTCCTGGT 3' SEQ ID NO.13 sgRNA-R3 5'TAAAACCAGGACAGATGGCAGCACCAGA 3' SEQ ID NO.14 sgRNA-F4 5'TTTGCGCGGCCACGGGGAGAGCCGAGGT 3' SEQ ID NO.15 sgRNA-R4 5'TAAAACCTCGGCTCTCCCCGTGGCCGCG 3' SEQ ID NO.16 sgRNA-F5 5'TTTGGCTGTCCCCGCGCGGCCACGGGGT 3' SEQ ID NO.17 sgRNA-R5 5'TAAAACCCCGTGGCCGCGCGGGGACAGC 3' SEQ ID NO.18 sgRNA-F6 5'TTTGCACGGGAGCTCAGGGCACAGGGGT 3' SEQ ID NO.19 sgRNA-R6 5'TAAAACCCCTGTGCCCTGAGCTCCCGTG 3'

[0088] 2) Anneal and connect the synthesized oligonucleotide chains (1-6 pairs)

[0089]

[0090] Metal bath at 95℃ for 5min, then naturally cool to room temperature;

[0091] 3) Use BBsI enzyme to digest the PSK-u6-gRNA plasmid, and recover the digested vector by gel;

[0092] 4) Connect the recovered plasmid vector with the annealed oligonucleotide chain

[0093]

[0094] Ligate at 22°C for 1 hour or at 4°C overnight;

[0095] 5) Transform into DH5α competent state;

[0096] 6) Select positive clones for sequencing;

[0097] 7) Expand the positive clone strains and extract the plasmids.

[0098] 2. EGFP recombinant donor plasmid (plasmid map as shown in Figure 3 As shown): Plasmid vector information is as follows Figure 1 A, obtained by transformation on an existing plasmid vector expressing EGFP. The 5'arm and 3'arm are the upstream and downstream homology arms of the target site recognized by each pair of sgRNA, respectively, with a length of 600 bp, and the GOI is the integrated target gene.

[0099] 1) Through primer design and PCR amplification, obtain 5'arm and 3'arm of 600bp length upstream and downstream of the site (such as Figure 1 A);

[0100] 2) Use double enzyme digestion and gel recovery to remove the original homology arms of the donor plasmid;

[0101] 3) Connect the 5'arm and 3'arm corresponding to the target site respectively by homologous recombination;

[0102] 4) The target gene EGFP sequence is contained in the original plasmid.

[0103] 3. The constructed sgRNA plasmid, recombinant donor plasmid, and Cas9-DTU plasmid (donated by Dr. Helene F Kildegaard of the Technical University of Denmark) were co-transfected into HEK293T cells cultured under the conditions of 37 °C and 5% CO2 using Lipofectamine 3000 transfection reagent at a mass ratio of 1.8:1.8:1. Meanwhile, a blank control group was set up. After 24 h of transfection, 10 μg / ml puromycin was used for pressure screening until all the cells in the control group died. The screened cell pool was expanded, and monoclonal cells that only emitted green fluorescence and did not emit red fluorescence were sorted out using a BD flow cytometer as platform cells.

[0104] 4. After expanding the cloned cell line, a part of the cells was taken to extract genomic DNA, and identification was carried out by 5’junction PCR, 3’JunctionPCR, and out-out PCR.

[0105] 5. Retain the positive clone platform cell line.

[0106] 6. Suspension domestication of adherent cells. The recognition criteria for successful cell suspension domestication are as follows: the cell density is maintained above 1.0×10 6 cell / mL, the viability is above 90%, and the number of cells can double every 24 h.

[0107] Example 5: Site-specific integration of IFNβ-HSA

[0108] The platform cell line of the present invention is not limited to the expression and production of IFNβ-HSA protein. The protein can be polypeptide, functional protein, antibody, fusion protein, etc. Taking IFNβ-HSA (89KDa) as an example, the recombinant IFNβ-HSA donor plasmid PUC57-Bxb1-attB-IFNβ-HSA was constructed by conventional technical means in the art (such as Figure 4 ). The gene expressing the β interferon-human serum albumin fusion protein (IFNβ-HSA, 89KDa) was site-specifically integrated at the target site using the recombinase-mediated cassette exchange technology.

[0109] The sequence expressing the foreign protein IFNβ-HSA was integrated into the platform cell line constructed in Example 4 using a promoterless expression cassette. Through BxbⅠ recombinase, the sequence between attB and attP was replaced according to its recognition site, thereby realizing the rapid and efficient integration of the foreign protein (such as Figure 1 B).

[0110] 1. The EGFP recombinant donor plasmid carried the attP specific site of the Bxb1 integrase system LP (such as Figure 1B) Verify the expression ability and stability of the cells, and establish a stable platform cell line with site-specific integration of the IFNβ-HSA gene through gene recombination mediated by the site-specific recombinase Bxb1.

[0111] 2. The recombined genome will form hybrid sites attL and attR that are not recognized by the Bxb1 integrase; it does not have the EGFP gene expression cassette; and due to the previously set promoter trap, the cells after recombination will form a complete bleomycin resistance gene expression cassette. Therefore, the cells that have successfully undergone recombination and expression will show no green fluorescence and have bleomycin resistance.

[0112] 3. After screening with bleomycin and flow sorting, 5’junction and 3’junction PCR are performed to verify whether correct DNA recombination has occurred on the 5’HA side and the 3’HA side.

[0113] 8. Retain the cell line stably expressing IFNβ-HSA.

[0114] Test examples:

[0115] 1. Use a BD flow cytometer to detect the green fluorescence intensity of the cell line constructed in Example 4.

[0116] Detection method: Continuously passage the cell line obtained in Example 4 for 60 passages. Collect cells every 10 passages, detect the fluorescence of the cells with a flow cytometer and measure the intensity. The detection results show that more than 98% of the cells in the cell lines constructed according to different target sequences in Example 4 still express green fluorescent protein after 60 consecutive passages, and the fluctuation range of the green fluorescence intensity between the 0th generation and the 60th generation does not exceed 30%, meeting the requirements of the Food and Drug Administration (FDA) for a stably expressing cell line, that is, the protein expression level of a stable production cell line should remain above 70% of the initial level after 50 consecutive passages (such as Figure 5 ).

[0117] 2. Use a urinary microalbumin assay kit to detect the expression of IFNβ-HSA in the cell line constructed in Example 5.

[0118] Detection method: Continuously passage the cell line obtained in Example 5 for 60 passages under serum-free culture conditions. Collect the cell fermentation supernatant of each passage every 10 passages, use a urinary microalbumin assay kit to detect the HSA content nmg / L in the fermentation broth, and calculate the expression level of IFNβ-HSA according to formula ①. The detection result analysis shows that the cells constructed according to different target sequences in Example 5 have the ability to stably express IFNβ-HSA (such as Figure 6 ).

[0119] IFNβ-HSA 表达量 =(n×M IFNβ-HSA ) / M HSA ①

[0120] Where: M IFNβ-HSA Indicates the molecular weight of IFNβ-HSA; M HSA Indicates the molecular weight of HSA.

[0121] The 6 groups of target sequences screened in Example 3 of the present invention cover most of the upstream, middle and downstream sequences within the 204bp base of the present invention. The 69bp upstream and 134bp downstream base ranges at the 135153rd base in the HEK293T cell gene NG_027973.1 of the present invention can successfully construct site-specific integrated stable expression cell lines, and can stably express exogenous proteins.

[0122] The above is only a preferred embodiment of the present invention, and the present invention is not limited to the above embodiments. It is understood that other improvements and changes directly derived or associated by those skilled in the art without departing from the spirit and concept of the present invention should be considered to be included in the protection scope of the present invention.

Claims

1. Use of a stable expression site within gene NG_027973.1 in HEK293T cells in the stable expression of an exogenous protein or polypeptide in HEK293T cells, characterized in that, The application integrates the coding gene of an exogenous protein or polypeptide at a stable expression site within the HEK293T cell gene NG_027973.1, and the stable expression site is within 69 bp upstream and 134 bp downstream of the 135153rd base of the HEK293T cell gene NG_027973.

1.

2. The application according to claim 1, characterized in that The stable expression site is within the 135084 - 135287 bases of the HEK293T cell gene NG_027973.1; the nucleotide sequence of the 135084 - 135287 bases of the HEK293T cell gene NG_027973.1 is shown as SEQ ID NO.

1.

3. The application according to claim 1, wherein The stable expression site can be recognized by the CRISPR / Cas9 technology using 5'NNNNNNNNNNNNNNNNNNNNNGG3' as the target sequence.

4. The application according to claim 1, wherein The molecular weight of the protein is less than 160 KDa.

5. A recombinant donor vector for mediating the integration of the attP sequence of the unified recognition site into the stable expression site described in claim 1, characterized in that, The recombinant donor vector contains the phage attachment site attP sequence recognized by the large serine recombinase Bxb1; the number of the phage attachment site attP sequences is 2.

6. The recombinant donor vector according to claim 5, wherein, The attP sequence is located in the region between the 5' homologous arm and the 3' homologous arm of the recombinant donor vector; between the two attP sequences, there also contains a resistance screening gene expression cassette and a fluorescent protein gene expression cassette. The promoter of the resistance gene expression cassette is located between the 5' homologous arm and the 5'-end attP sequence; the promoter of the fluorescent protein gene expression cassette is located downstream of the resistance gene expression cassette; the 5' homologous arm and the 3' homologous arm are sequences with a length of 600 bp upstream and downstream of the stable expression site respectively.

7. A HEK293T fluorescent platform cell for rapid site-directed integration of a target gene, characterized in that, The HEK293T fluorescent platform cell is obtained by transferring the recombinant donor vector described in claim 5, the sgRNA plasmid corresponding to the target sequence described in claim 3, and the Cas9 plasmid into HEK293T cells.

8. A recombinant expression vector for rapidly constructing HEK293T cells stably expressing exogenous proteins, characterized in that, The recombinant expression vector contains a large serine recombinase Bxb1 expression cassette, a target gene expression cassette, and a promoterless resistance gene expression cassette; the resistance gene expression cassette is located between two bacterial attachment sites attB recognized by the large serine recombinase Bxb1; the recombinant expression vector also includes a promoter sequence upstream of the coding gene of the protein, and the promoter sequence controls the expression of the protein.

9. The expression vector according to claim 8, wherein The promoter is one of a strong mammalian expression promoter derived from human cytomegalovirus, a strong mammalian expression promoter derived from human elongation factor 1α, a mammalian expression promoter derived from simian vacuolating virus 40, a mammalian promoter derived from the phosphoglycerate kinase gene, a mammalian promoter derived from the human ubiquitin C gene, a mammalian promoter derived from the β-actin gene, and a strong hybrid mammalian promoter.

10. A HEK293T recombinant cell line for stable protein expression, characterized in that, The HEK293T recombinant cell line is obtained by transferring the recombinant expression vector described in claim 8 into the fluorescent platform cell described in claim 7.

Images